ID: 950005620

View in Genome Browser
Species Human (GRCh38)
Location 3:9689271-9689293
Sequence GTGGTGGCCCAGGAACATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950005611_950005620 17 Left 950005611 3:9689231-9689253 CCTCAGAAGTCAGCCATCTGGTT 0: 1
1: 0
2: 1
3: 18
4: 152
Right 950005620 3:9689271-9689293 GTGGTGGCCCAGGAACATAAAGG 0: 1
1: 0
2: 0
3: 6
4: 152
950005615_950005620 4 Left 950005615 3:9689244-9689266 CCATCTGGTTGGTGAAGGGCACT 0: 1
1: 0
2: 0
3: 24
4: 153
Right 950005620 3:9689271-9689293 GTGGTGGCCCAGGAACATAAAGG 0: 1
1: 0
2: 0
3: 6
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950005620 Original CRISPR GTGGTGGCCCAGGAACATAA AGG Intronic
907110520 1:51922561-51922583 AAGGTGGGCCAGGAACATATAGG - Intronic
910472895 1:87574293-87574315 GTAGTGGCCATGGAACAGAAAGG + Intergenic
910682542 1:89882246-89882268 GCTGTGCCCCAGGAACACAAAGG + Intronic
910823129 1:91373230-91373252 GTGGTGGCAAAGGAACAGACTGG + Intronic
911764346 1:101656171-101656193 GTGTTGGGGCAGGAAAATAATGG + Intergenic
912926245 1:113915719-113915741 GTGGTGGCTGAGGAGCATGAGGG - Intergenic
914195907 1:145448073-145448095 GTGGTTGCCCAGGAAGCTCAGGG + Intergenic
915024922 1:152818693-152818715 GTGGTGGCCTTGGAACTTCAGGG + Intergenic
916091349 1:161309952-161309974 GTGGGGGACCAGGAACTGAACGG + Exonic
1065455985 10:25907215-25907237 GTGGTGGTGCAGGAACAAGACGG - Intergenic
1066438986 10:35419484-35419506 GTGGTGGCCATGGACCATGAGGG + Intronic
1067541025 10:47153276-47153298 GTGATGGGCCAAGAACATGATGG - Intergenic
1067959756 10:50834862-50834884 GTGGTGGCCTAAGAACAGGATGG + Intronic
1068943471 10:62704749-62704771 GTGGTGGCGGAGGAACAGGAGGG - Intergenic
1073292713 10:102421270-102421292 GCTGGGGCGCAGGAACATAACGG + Intronic
1075349801 10:121713583-121713605 GTGGTGGCGCAGAAAGATGATGG - Intergenic
1077395908 11:2321106-2321128 GTTGTGACCCAGGGACCTAAGGG - Intergenic
1078803604 11:14672647-14672669 GAGGTGGCAGAGCAACATAAAGG - Intronic
1079012183 11:16837914-16837936 GTGGTGCCCCAGTGACATAAGGG + Intronic
1079385974 11:19980121-19980143 GGGGTGGCCCATGAGCATCAGGG - Intronic
1080769203 11:35324969-35324991 GCCATGGCCCAGGAACATATTGG + Intronic
1080790000 11:35514088-35514110 GTGGTTGTCCAGCAGCATAAAGG - Intronic
1081562444 11:44230237-44230259 GTGGTGGCTGAAGAACAGAAGGG + Intronic
1083155808 11:60822138-60822160 GTGGTGGCCCAGAGACAGAGAGG + Intergenic
1083633302 11:64106693-64106715 GCTGTGGCCCAGGATCCTAAAGG + Intronic
1084303679 11:68267519-68267541 GTGGTGGCCCATGAACAGGATGG - Intronic
1084430251 11:69106902-69106924 GTGGGGGCCCAGCCACAGAAAGG + Intergenic
1086033250 11:82384971-82384993 GTGGTGGCCCAAGAGCCCAAGGG + Intergenic
1086094488 11:83036841-83036863 GGCGTGTCCAAGGAACATAAAGG + Intronic
1086425484 11:86678454-86678476 GTGGTGGCCCAGCAGGATAGGGG + Intergenic
1088429662 11:109745100-109745122 GTGTTGGCCCAGGAAGGAAAAGG - Intergenic
1088812173 11:113399329-113399351 GTGGATGCCCAGGAACGTGAAGG + Exonic
1089367762 11:117931574-117931596 GTGGTGGGCAAAGAACAGAAAGG + Intergenic
1090149174 11:124363950-124363972 TTGATGGCCCAGGAACAAAATGG - Intergenic
1095633867 12:44408465-44408487 GTGGTGGAGCAGGAGCAAAAGGG + Intergenic
1098441946 12:70528404-70528426 GTGGTGGCGAAGGATCATTAGGG + Intronic
1100197543 12:92264399-92264421 TTCTTGCCCCAGGAACATAATGG + Intergenic
1100229606 12:92593768-92593790 GTGGTGATCCAGGCACAAAAAGG + Intergenic
1101460341 12:104884550-104884572 GGGTTTGCCCAGGAACATAGAGG - Intronic
1103781742 12:123403307-123403329 GTGGGGACCCAAGAACAGAATGG - Intronic
1105572330 13:21614524-21614546 GTGGTGTCGCAGGAAAACAAAGG - Intergenic
1118260325 14:64240408-64240430 GTGGAGGCCCTGGAGGATAAGGG - Intronic
1121995903 14:98602673-98602695 GGGGTCTCCCAGGAACTTAAAGG + Intergenic
1122322505 14:100863870-100863892 GTCTTGGCTCTGGAACATAAAGG - Intergenic
1122445736 14:101767201-101767223 GTGGTGGCACTGGAATGTAAAGG - Intronic
1122924183 14:104892190-104892212 CTGGTGGCCCAGGTGCTTAAGGG + Intronic
1127848058 15:62888702-62888724 TTGCTGGCCTAAGAACATAAGGG + Intergenic
1129512694 15:76136721-76136743 ATGGTGCCCCAGGAAGCTAAGGG + Intronic
1133114271 16:3567272-3567294 GTGGGGCCCCAGGAACTCAATGG + Intronic
1134741826 16:16554550-16554572 GTGGTGTCCCAGGCTCCTAATGG - Intergenic
1137857262 16:51807419-51807441 GTGGTGGCCTAGGGCCATAGAGG - Intergenic
1138470577 16:57232373-57232395 GTAATAGCCCAAGAACATAAGGG + Intronic
1139550357 16:67669407-67669429 GTGGTGTCCAAGGAACACACAGG - Intergenic
1140210541 16:72966475-72966497 ATGGTGGCCAAAGACCATAATGG + Intronic
1141131868 16:81443002-81443024 TTGGTGCTCCAGGAACAGAAAGG - Intergenic
1143718378 17:8792622-8792644 GTGGTTGCCCGGGACCAAAATGG + Intergenic
1144089113 17:11837758-11837780 GAGGTGGCACAGGCAAATAATGG - Intronic
1152326435 17:79642230-79642252 GTGTTGGCCAAAGGACATAAAGG + Intergenic
1152491758 17:80639667-80639689 GTGGTGCCCCAGGCACAGACAGG - Intronic
1153951117 18:10058556-10058578 GTGGTGGCCCTGGAAGGTATTGG + Intergenic
1154389414 18:13923587-13923609 GTGGTTACGCAGGAACAGAATGG + Intergenic
1158375337 18:56857227-56857249 TTAGTGGACCAGGAACATATTGG + Intronic
1161687535 19:5710689-5710711 GCTGTGGCCAAGGAACAGAATGG - Intronic
1163801223 19:19367038-19367060 ATGGTGGCCCAGGAGCAGCAAGG + Intergenic
1164768860 19:30792625-30792647 TTGGTGGCCCATGCACAGAAGGG + Intergenic
1165404206 19:35619926-35619948 CTGGGGGCCCAGGAACTTCAAGG - Intronic
1166689589 19:44814410-44814432 CTGGTGGCCCACGAACTAAAAGG + Intronic
1167074478 19:47240226-47240248 ATCGTGGCTCTGGAACATAACGG + Intergenic
925807030 2:7660713-7660735 GTGCAGGGCCAAGAACATAAAGG + Intergenic
928371756 2:30744985-30745007 GTGGTGGCCCAGCCACAGAGCGG - Intronic
928586532 2:32764325-32764347 TTGGTTTCCCAGGCACATAAAGG + Intronic
930050715 2:47214219-47214241 TTGGTTGCCTAGGAACAGAATGG + Intergenic
932573200 2:72949062-72949084 GTGGTGAGCCAGGAAGAGAATGG + Intronic
935549119 2:104432926-104432948 GTGGTGGTTCTGGAGCATAAAGG + Intergenic
936960361 2:118066994-118067016 ATGGTGGCCCCGTAATATAATGG + Intergenic
937724574 2:125146774-125146796 GTGGTGGCCAAGGATGAAAATGG - Intergenic
938213114 2:129485242-129485264 GTGGTGGGCCAGGCAGGTAAGGG + Intergenic
942234671 2:173892478-173892500 TTGGTGGCCCAGGAACAGGCAGG - Intergenic
946305619 2:218855532-218855554 GTGGTGTCCCAGGAGCAGAATGG + Intergenic
948363117 2:237436650-237436672 GTGAGGGCCCAGGAGCAGAATGG + Intergenic
1170746332 20:19102429-19102451 GTGGTGGCCCAGGCGCTGAATGG + Intergenic
1171520117 20:25769356-25769378 CTGGAGGCCCAGGAATGTAAGGG - Intronic
1171556802 20:26087137-26087159 CTGGAGGCCCAGGAATGTAAGGG + Intergenic
1172189268 20:33052142-33052164 GTGGTGTTCCAGGAACAGCAGGG - Intergenic
1173299641 20:41790443-41790465 GTGTTGGCCAACTAACATAAAGG + Intergenic
1175299284 20:57931546-57931568 ATGGTGGCCCAGGTACTTCAGGG + Intergenic
1176654252 21:9575642-9575664 CTGGAGGCCCAGGAATGTAAGGG - Intergenic
1178355280 21:31906188-31906210 ATGGTGGCCAAGGTAAATAATGG - Intronic
1181857915 22:25795696-25795718 GTGGCGGCCCAGAAATATGATGG + Intronic
1183983715 22:41557750-41557772 GGGGTGGCGGAGGAACAGAAAGG - Intergenic
1184098442 22:42329138-42329160 GTGCTGGCCCTGGAAGAGAATGG - Intronic
950005620 3:9689271-9689293 GTGGTGGCCCAGGAACATAAAGG + Intronic
954158317 3:48700878-48700900 GTGGTGGCTCTGGAACACACAGG - Intronic
954464354 3:50645923-50645945 GTGGTGTCCCATGACCAAAAGGG - Intronic
960967720 3:123116694-123116716 GGGGTGGACCAGAAGCATAAAGG + Intronic
963652337 3:147995831-147995853 GTGGTGGAGCTGGAAAATAAAGG + Intergenic
964696966 3:159519916-159519938 GTGGTGGCCCTGGATCCCAAGGG - Intronic
968845805 4:3041038-3041060 GTGGTGGTCCAGGAAGAGAGGGG + Intergenic
970979246 4:22077542-22077564 GTGGTTGGCCTGGAACAGAAGGG - Intergenic
978358986 4:107908152-107908174 GTGGTGGTCTATGAAAATAAGGG - Intronic
980107344 4:128600459-128600481 GCAGTGACCCAGGAACACAAAGG + Intergenic
984503563 4:180589284-180589306 GTGGTGCCTCAGAATCATAAAGG + Intergenic
984508983 4:180656061-180656083 GTGGTGGAAGAGGAAGATAAAGG - Intergenic
988428613 5:31092938-31092960 GTGATGACCCTGGAACAAAATGG + Intergenic
989492700 5:42076636-42076658 CTGGTGGCACAGGATCATGAGGG - Intergenic
991521503 5:67503194-67503216 GTAGTGGTCCAGGATCTTAATGG - Intergenic
992481442 5:77156151-77156173 GAGGTGGCCCAGAAACATCTTGG + Intergenic
992719268 5:79543896-79543918 ATGGTGGCACAGGGAAATAAAGG + Intergenic
993850981 5:93008648-93008670 GTGGTGACCCAGGAAAAAGACGG + Intergenic
994897953 5:105729695-105729717 GTGGTTGCCTAGGACAATAAGGG + Intergenic
995838036 5:116417442-116417464 GTGTGAGCCCAGGCACATAAAGG - Intergenic
998867643 5:146521378-146521400 CTGGGAGCCCAGGATCATAAAGG + Intergenic
998923393 5:147095941-147095963 CTTGTGTCCCAGGAACATTAAGG + Intergenic
999450176 5:151671999-151672021 ATGGAGACCCAGGAACACAATGG - Intronic
1003627826 6:7759393-7759415 GTGGTGGCCGAGGACCTCAAGGG - Intronic
1006302134 6:33199339-33199361 GGGGTGGCCCAGGAGGAGAAGGG + Exonic
1008264831 6:49412085-49412107 GTGGTTGCCCGGGACCATGATGG - Intergenic
1011108042 6:83804450-83804472 ATGGTGGCCCTGGAACACGATGG - Intergenic
1012836156 6:104271011-104271033 GTGGTGGGGCAGGAAGTTAATGG - Intergenic
1018867267 6:167755971-167755993 GGGGTGGCCCGGTAACATCAGGG - Intergenic
1019985582 7:4653008-4653030 GTGGTGGCCCAGGAAAGCAGTGG + Intergenic
1021312855 7:19114534-19114556 TTTGTGGGCCAGGAACATACTGG - Intronic
1022792789 7:33705406-33705428 GAGGTGGACCAGGAAGACAAAGG - Intergenic
1023340452 7:39213904-39213926 GATGTGGCCAAGGAAGATAACGG - Intronic
1025280605 7:57624310-57624332 CTGGAGGCCCAGGAATGTAAGGG - Intergenic
1025304125 7:57841197-57841219 CTGGAGGCCCAGGAATGTAAGGG + Intergenic
1027112847 7:75454530-75454552 GCGGTGTCCCAGGAACACAGAGG + Intronic
1027285091 7:76639141-76639163 GCGGTGTCCCAGGAACACAGAGG + Intergenic
1028902663 7:96118687-96118709 GTGGTGGACCAGGAGCAGAGTGG + Intergenic
1030876991 7:114825929-114825951 GTGAAGCCCCAGGAAGATAATGG - Intergenic
1031821944 7:126512954-126512976 GTTGTGGTCCATGAAAATAATGG - Intronic
1033172214 7:139094171-139094193 GTGGGGGCCCAGGAATCTAATGG - Intronic
1034151712 7:148922017-148922039 CTGCTGGCCAAGGAACATCAAGG + Intergenic
1034407755 7:150916607-150916629 GTGGTGGCTCAGGAGGATGAGGG + Intergenic
1038142665 8:24863766-24863788 GTGGTGGCCCACGACCATTCTGG + Intergenic
1038521165 8:28233396-28233418 GTGGAGGCTCAGGAACCTCACGG + Intergenic
1039298965 8:36188808-36188830 GTGGTTGCCCAGGAGGAAAATGG - Intergenic
1042382005 8:68127459-68127481 ATTGTGGCCCAGGATCATAAAGG + Intronic
1042433305 8:68734378-68734400 GTGGGGCCACAGGAACATACAGG - Intronic
1044324630 8:90845955-90845977 GTGGTCTCCCAGCAACTTAAAGG - Intronic
1044931817 8:97259077-97259099 GTGGTGGCAGAGGAACGAAAAGG - Intergenic
1045695670 8:104806246-104806268 GTGGTGGCTCATGCCCATAATGG - Intronic
1048054385 8:130849475-130849497 GGGCTGGACCAGGCACATAAAGG + Intronic
1049213054 8:141395564-141395586 GGGGTGGCCCACGCACCTAAGGG - Intronic
1050552528 9:6760118-6760140 GTGGTTGCCTAGGGACAGAAGGG - Intronic
1050845552 9:10213317-10213339 GTTGTGGCCCAGGATAATCAGGG + Intronic
1052016412 9:23473534-23473556 GTGGTGTCCCATGGACATCAAGG - Intergenic
1056781591 9:89554981-89555003 GTGGTGGCCCAGGGAAATGTGGG - Intergenic
1058450718 9:105093780-105093802 GTGGGAGCCCAGGAACATTTTGG + Intergenic
1058885620 9:109319974-109319996 GGGGTGGCCCAAGAAGAAAAAGG + Intronic
1062688791 9:137830260-137830282 GTGTGGGGCAAGGAACATAAGGG - Intronic
1062698825 9:137888749-137888771 GTGGTTGCCCAGGAAGCTCAGGG - Intronic
1186342845 X:8661739-8661761 GTGCTTGCCCAGGACCATCAGGG - Intronic
1187614916 X:20982215-20982237 CTAGTGGACCAGGAACACAATGG + Intergenic
1187674444 X:21701748-21701770 GTGATGGCCCAGGAGCAGGAGGG - Intergenic
1188107703 X:26163824-26163846 CTGGTGCCCCAGGGAGATAAAGG + Intergenic
1189710416 X:43805461-43805483 GTGGTTGCCCAGGGCCAGAAAGG - Intronic
1194523163 X:94943075-94943097 GTGCTGGCCCAGGGAGATCAGGG - Intergenic
1200385562 X:155887106-155887128 GTGGTGGCCCAGAAGCCGAAAGG - Intronic