ID: 950007057

View in Genome Browser
Species Human (GRCh38)
Location 3:9698203-9698225
Sequence TAGTGAAGGTAGGTGTATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950007049_950007057 20 Left 950007049 3:9698160-9698182 CCTTTGCCTGACATGAGAATCGT 0: 1
1: 0
2: 0
3: 3
4: 91
Right 950007057 3:9698203-9698225 TAGTGAAGGTAGGTGTATGGTGG 0: 1
1: 0
2: 1
3: 9
4: 159
950007050_950007057 14 Left 950007050 3:9698166-9698188 CCTGACATGAGAATCGTTTGAAG 0: 1
1: 0
2: 2
3: 9
4: 159
Right 950007057 3:9698203-9698225 TAGTGAAGGTAGGTGTATGGTGG 0: 1
1: 0
2: 1
3: 9
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950007057 Original CRISPR TAGTGAAGGTAGGTGTATGG TGG Intronic
900960909 1:5919382-5919404 TAGTGAGGGTAGCTGCATGTGGG - Intronic
903771853 1:25769316-25769338 TGGTGTATGTAGGTGTATGGGGG - Intronic
904982660 1:34519811-34519833 GAGTAAAGGTAGGTGTATCTGGG - Intergenic
905440965 1:37996491-37996513 TAGGGAAGGGAGGGGTTTGGGGG - Intergenic
908820188 1:68078060-68078082 CAGTGAAGGTGTGTGTTTGGGGG + Intergenic
909811550 1:79937588-79937610 TAGTCATGCTATGTGTATGGGGG + Intergenic
909816672 1:80003037-80003059 TAGTGAAGGAGGTTGTATGTGGG + Intergenic
909866497 1:80679184-80679206 TACTGTAGGTAAGTGCATGGAGG + Intergenic
909888843 1:80977397-80977419 TAGTTAAGGTATGTATATTGTGG - Intergenic
911240675 1:95462477-95462499 TAGTGAAGGGAGGAGAATGGTGG - Intergenic
911641410 1:100293799-100293821 AAGTCAAGGTAGGTGTTTGAAGG + Intergenic
911796710 1:102085976-102085998 TAGATAAGGTAGGTGTGTGATGG + Intergenic
913485411 1:119328902-119328924 TAGTGAAGTCAGGTGTGGGGAGG - Intergenic
918627266 1:186670501-186670523 AAGTGAAGGAAAGAGTATGGTGG + Intergenic
921669233 1:217908008-217908030 CAGTGCAGGTAGGCGGATGGAGG - Intergenic
922396172 1:225202978-225203000 TAGTGAGGGTGTGTGTTTGGGGG + Intronic
922816624 1:228453747-228453769 CAGTGAAGGTGGGTGCATGTTGG + Intergenic
923322015 1:232843782-232843804 TATGGAAGGCAGGTGTAAGGTGG + Intergenic
923767178 1:236902743-236902765 TACTGAAGGTGGGTGTAGAGAGG - Exonic
1065477974 10:26161492-26161514 TACTGAAGGCAGTAGTATGGTGG + Intronic
1065692560 10:28350487-28350509 TAGGGTAGGAAGGGGTATGGTGG + Intergenic
1067175035 10:43939719-43939741 CAGTGAAGGCAGCTGTGTGGCGG + Intergenic
1067836188 10:49643371-49643393 TAGTGCAGGGTGGTGGATGGAGG - Intronic
1069648016 10:70018989-70019011 CAGTGAAAGTATGTGTTTGGGGG - Intergenic
1070717349 10:78732366-78732388 GAGTGAAGGGAGGGGTAGGGAGG + Intergenic
1073110124 10:101057726-101057748 TACTGAAGGTGGGTGTTAGGGGG + Intergenic
1077101209 11:823431-823453 TAGTGAAGGGAGGTGGCTGTTGG + Intronic
1080800183 11:35603119-35603141 TGGTGTTTGTAGGTGTATGGGGG - Intergenic
1082043685 11:47707721-47707743 TAGTGTAGGTTAGGGTATGGAGG - Intronic
1083110354 11:60400245-60400267 TAGGGAAGGTAGGCGTAGGTAGG - Intronic
1083998775 11:66284834-66284856 AAGTGAAGGCAGGGGAATGGGGG + Intronic
1087552490 11:99669181-99669203 CAGTGAAGGTAGACATATGGAGG + Intronic
1092528972 12:9328522-9328544 AAGGGAGGGTAGGTGTTTGGGGG + Intergenic
1095524921 12:43114013-43114035 TGGAGAAGGTAAGTGTATGCTGG - Intergenic
1095925987 12:47579728-47579750 TTGGGAAGGTAGGTGTGTGCTGG - Intergenic
1096217073 12:49803650-49803672 TAAGGAAGGGAGGTGTTTGGGGG + Intronic
1096500310 12:52060640-52060662 GAGTGAGGGTATGTGGATGGGGG - Intergenic
1096724721 12:53552307-53552329 TTTTGAAGGTAGGTGTGTTGAGG - Intronic
1099589685 12:84571558-84571580 TAGTGAAGGTGGAAGTAGGGTGG - Intergenic
1100398008 12:94201614-94201636 TAGTGAAGGAAGGAGGATAGTGG - Intronic
1101268096 12:103113367-103113389 AAGAGAAGGAAGGTGTTTGGGGG + Intergenic
1102426614 12:112848864-112848886 GAGTGAGGGTATGTGTTTGGAGG + Intronic
1104893926 12:132152784-132152806 TTGTGGTGGGAGGTGTATGGTGG + Intergenic
1108088429 13:46819605-46819627 GAGTGAAGGAAGGAGTATGGAGG + Intergenic
1108900740 13:55404441-55404463 TGATGAAGGTGGGTGTATAGGGG + Intergenic
1112613335 13:100977490-100977512 TAGGCAAGGTAGGTGGATGTTGG - Intergenic
1113818438 13:113192690-113192712 TAAGGAAGGTAGGGGTTTGGGGG + Intronic
1113879201 13:113614304-113614326 TAGTGAAGACAGGTGTCTGTTGG - Intronic
1114896711 14:27000039-27000061 TAGTGAAGGAAGATGTTTGGTGG - Intergenic
1121406563 14:93722590-93722612 TAGTGATGGTGGTTATATGGTGG + Intronic
1121407940 14:93730271-93730293 TGCTGTAGGTAGGTGTATGTCGG - Intronic
1122980191 14:105188189-105188211 CTGTGAAGGGAGGTGTCTGGAGG - Intergenic
1126041824 15:44598773-44598795 TATTGAAGGTATGTGGAAGGAGG + Exonic
1126154981 15:45557618-45557640 TAGCGAAGGTATGTGTGGGGTGG + Intergenic
1127781802 15:62323026-62323048 AAGTTAAGGTAGCTGGATGGTGG - Intergenic
1129271609 15:74422031-74422053 TGGGGAAGGTGGCTGTATGGAGG + Intronic
1129980113 15:79861306-79861328 TGGGGAAGACAGGTGTATGGAGG - Intronic
1130429990 15:83837841-83837863 TAGAAAAGGGAGGGGTATGGAGG + Intronic
1135209722 16:20514409-20514431 TAGTGCAGGTAGGTGGTTGTGGG + Intergenic
1137572585 16:49576446-49576468 TAGTGAATGTAGTTGCATTGGGG - Intronic
1139737892 16:69008217-69008239 TAGTGAAGGAGGCTGTGTGGTGG - Intronic
1139784314 16:69379121-69379143 TAGGTAAGGTAGGTTTATGTTGG + Intronic
1143052510 17:4137714-4137736 TAGTGCAGGCAGGTGGCTGGCGG + Intronic
1143387880 17:6542851-6542873 TAGTGAAGGTGGATGGAAGGAGG - Intronic
1146674342 17:34762960-34762982 CAGTGAAGGTGGGTGGCTGGTGG - Intergenic
1147970210 17:44215353-44215375 CAGTGAGGATGGGTGTATGGGGG + Intronic
1148332609 17:46821268-46821290 TAGTGAATGGAGGTGTGTGTGGG + Intronic
1150148281 17:62789252-62789274 TAGTGAAGGTAGGAAGAGGGAGG - Intronic
1153189401 18:2521149-2521171 TAGGGAAGGGAGGTTTTTGGTGG - Intergenic
1153314556 18:3709245-3709267 GAGTGAAGGAAGGTGTGTAGGGG - Intronic
1156005844 18:32439885-32439907 TAGTGAATGAAGGTGAATGAAGG + Intronic
1157228353 18:45889119-45889141 TAGAGTAGGATGGTGTATGGAGG - Intronic
1157958663 18:52127530-52127552 TAGTAAATGTAGCTCTATGGAGG - Intergenic
1160053445 18:75457431-75457453 TTGTGAATGTAGGTATATTGGGG + Intergenic
1164799841 19:31067499-31067521 TCATGGAGGTAGGTGTATGATGG - Intergenic
1167708564 19:51096745-51096767 GAGTGATGGTAGGTCTTTGGAGG - Intergenic
928231358 2:29501230-29501252 TAGTGAAGGAAGGGGAATGATGG - Intronic
928443345 2:31311828-31311850 CAGTGAGGGTATGTGTTTGGGGG + Intergenic
931641214 2:64382547-64382569 TTGTGAAGGGAGGGGCATGGTGG - Intergenic
933370085 2:81403623-81403645 TTGTGAAAGTGGGTGTTTGGTGG + Intergenic
936514808 2:113174783-113174805 TAGTGAAGGTAGCTGCATGGAGG + Intronic
936705915 2:115073431-115073453 CAGTGGAGGTGGGTGTGTGGTGG + Intronic
938932522 2:136099288-136099310 TATTGAAGCTGGGTGTATGAAGG - Intergenic
941593952 2:167452475-167452497 CAGTGAGGGTGTGTGTATGGGGG + Intergenic
941774028 2:169372342-169372364 TAATGAAGGTAAGTGTTTCGTGG - Intergenic
942478855 2:176359908-176359930 GAGTGAAGGTAGGAGTCAGGGGG - Intergenic
946481512 2:220061288-220061310 CACTGAAGGTAGGTGTCGGGAGG + Intergenic
947270221 2:228326548-228326570 CAGTGAGGGTATGTGTTTGGGGG - Intergenic
1169734686 20:8825032-8825054 TAGTGTAGGTGAGTCTATGGTGG - Intronic
1170335153 20:15262190-15262212 TAGGAAGGGTAGGTGTAAGGGGG - Intronic
1170954254 20:20964006-20964028 AAGTGAAGGTAGAAGAATGGGGG + Intergenic
1171422850 20:25030458-25030480 TAGTGCAGGTGGGTGTAGTGCGG - Intronic
1172823653 20:37761318-37761340 TAGTGCAGGAATGAGTATGGAGG - Intronic
1173304776 20:41837701-41837723 TTGTGAGGGTAGGGGCATGGGGG - Intergenic
1174682710 20:52423878-52423900 GAGTGAAGGTAGGTGCAGGTAGG - Intergenic
1174682733 20:52423998-52424020 GAGTGAAGGTAGGTGCAGGTAGG - Intergenic
1175625861 20:60487714-60487736 CAGTGAGGGTAGGTGTATTAGGG + Intergenic
1175705498 20:61173590-61173612 TGGTGATGGTAGATGGATGGTGG - Intergenic
950007057 3:9698203-9698225 TAGTGAAGGTAGGTGTATGGTGG + Intronic
950736078 3:15009276-15009298 TTGTGGAGGTAGGTGTAGGGAGG + Intronic
952546273 3:34422949-34422971 TCCTGAAAGAAGGTGTATGGAGG + Intergenic
953421983 3:42761310-42761332 TAGGTAAGGTAGATGTCTGGGGG - Intronic
956751030 3:72344070-72344092 AAATGTGGGTAGGTGTATGGGGG - Intergenic
958023246 3:88021515-88021537 TAGTGAAAGCAGGTGCAAGGCGG - Intergenic
958418095 3:93900789-93900811 TTGTGAAGGTAGGATGATGGTGG - Exonic
960684206 3:120280687-120280709 GAGAGAAGGTGGGTGGATGGGGG - Intronic
961100537 3:124194955-124194977 CAGTGATGGTAGGTATAGGGGGG + Intronic
961641921 3:128370283-128370305 TAGTGAAGGTGGTTGTTAGGAGG + Intronic
961751533 3:129098245-129098267 TGGTGAGGGCAGGTCTATGGAGG - Intronic
963326644 3:143870332-143870354 TATTTAAGGTAGATGTGTGGTGG - Intergenic
964001163 3:151773624-151773646 TGGTGGTGGTTGGTGTATGGGGG + Intergenic
969276394 4:6138633-6138655 CAGTGGATGTAGGTGTGTGGAGG - Intronic
971472414 4:27040917-27040939 TAGTGAAGATGTGTGTTTGGAGG + Intergenic
972681514 4:41310938-41310960 TAGTGATGGCAGGTGGGTGGTGG + Intergenic
973635403 4:52857615-52857637 TATTGAAGGTGGGAGTATTGTGG + Intergenic
976745779 4:88401639-88401661 AGGTGAAGGTAGGTTGATGGTGG + Intronic
978011706 4:103694197-103694219 TAGTGTAAGGAAGTGTATGGTGG - Intronic
978974314 4:114850158-114850180 TATTGAAGGTAGATGCATGCAGG + Intronic
980289135 4:130823139-130823161 TAGTGAGGATGGGTGTGTGGTGG + Intergenic
983439461 4:167762989-167763011 TGGGGAAGGTAGGTGGATGCAGG - Intergenic
985199978 4:187474818-187474840 TAGGTAAGGTAGGAGGATGGAGG - Intergenic
986260434 5:6140916-6140938 TAGAGAAAGTATGTGTATGTAGG - Intergenic
989438820 5:41446216-41446238 TAGTGAGGGTTGGGGTTTGGTGG + Intronic
991227149 5:64286104-64286126 CATTGAGGGTAAGTGTATGGAGG - Intronic
993827288 5:92707155-92707177 TATTGTAGGGAGGTGTATAGAGG - Intergenic
994554456 5:101280392-101280414 AAGTGATGGTAGGTGTTTTGAGG - Intergenic
997885483 5:137626157-137626179 TAGTATAGGTATGTGTGTGGCGG - Intronic
1003008518 6:2404550-2404572 TAGTGATGGTTTGGGTATGGTGG - Intergenic
1003509698 6:6769237-6769259 TAGGAAAGGTAGGAGGATGGTGG - Intergenic
1003584935 6:7380118-7380140 TTGTAAAGGTAGGTTTTTGGAGG - Intronic
1008787793 6:55190468-55190490 TAGTACAGGTAAGTGTATGGTGG + Intronic
1009677863 6:66849851-66849873 TAGTCAAGGTACATGTATGTAGG - Intergenic
1010723080 6:79305671-79305693 AATTGAAGGTAGGTTTATTGGGG - Intergenic
1017609241 6:156167107-156167129 TAGTCAGGGTAGGTGGTTGGGGG + Intergenic
1022894968 7:34740678-34740700 TAGTGACGGTGTGTGTTTGGGGG + Intronic
1027154029 7:75753746-75753768 TAGAGAAGGCAGGTGTCTTGGGG - Intergenic
1027243580 7:76350080-76350102 TGGTGAAGCTGGGTGTACGGGGG + Intronic
1027954314 7:84860097-84860119 TAGGGCAGGTAGGTGTGTAGTGG + Intergenic
1028840476 7:95424155-95424177 TAGTGAAGGAAGCTTTATGTAGG - Intronic
1029714981 7:102320751-102320773 CAGTGCAGGTGGGTGTATGGGGG + Intronic
1032558893 7:132867009-132867031 AAATGATGGTATGTGTATGGTGG - Intronic
1032829049 7:135603851-135603873 TAGGGAAACTAGGTGTTTGGAGG + Intronic
1033599753 7:142880657-142880679 TAGGGAATGGAGGTTTATGGGGG - Intronic
1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG + Intronic
1036943780 8:13075250-13075272 TAGGAAGGGAAGGTGTATGGAGG + Intergenic
1038974995 8:32685452-32685474 TGGTGGAGGTAGGAGTGTGGAGG - Intronic
1041986910 8:63932535-63932557 TATTGAACATATGTGTATGGTGG - Intergenic
1048402830 8:134087947-134087969 AAGTGAAGGGAGGGGTTTGGAGG - Intergenic
1048745020 8:137604857-137604879 GAGTGAAGATAGGTGGATGGTGG + Intergenic
1050851261 9:10289473-10289495 TAGTGATTGTAGGTGTTTGGGGG - Intronic
1051364203 9:16309552-16309574 TGGTGAATGTAAGTGTCTGGGGG - Intergenic
1051680518 9:19603168-19603190 TTGTGGGGGTAGGTGGATGGGGG + Intronic
1052764231 9:32624528-32624550 CAGTGAAGCTAGGTGAATGTGGG - Intergenic
1056748972 9:89331579-89331601 TAATGACGCTATGTGTATGGGGG - Intronic
1056782256 9:89559651-89559673 TAGATGAGGTAGGTGTGTGGGGG + Intergenic
1057688517 9:97261027-97261049 AAGTGATGGTATGTGTATGTGGG - Intergenic
1057966260 9:99506288-99506310 TAGTTAAAGCAGGAGTATGGGGG - Intergenic
1058186166 9:101858005-101858027 CAGTGCAGGTAGGTGTCAGGGGG + Intergenic
1058396124 9:104556594-104556616 TAGTGAGGGTGTGTGTTTGGGGG - Intergenic
1059611212 9:115898584-115898606 AAGTGAAGGTAATTGAATGGGGG + Intergenic
1188970811 X:36613259-36613281 TACTGCAGGTAGGATTATGGAGG - Intergenic
1189995322 X:46632094-46632116 TAGTGATGGTGGGTATATAGGGG - Intronic
1192349126 X:70341369-70341391 TAGAGAAGGGAGAGGTATGGGGG - Intronic
1193541372 X:82776039-82776061 CAGTGAGGGTATGTGTTTGGGGG + Intergenic
1194606855 X:95991220-95991242 TAGGGAAGGTTGCTGCATGGAGG + Intergenic
1194796281 X:98214893-98214915 TAAGGATGGTAGGTGTGTGGAGG - Intergenic
1194899586 X:99493613-99493635 TAGGGAAGGTGTGTGTGTGGTGG - Intergenic
1196778269 X:119360594-119360616 AAGTGTATGCAGGTGTATGGTGG + Intergenic
1197041942 X:121947938-121947960 TAGTGAAAGCAGGAGTGTGGGGG + Intergenic
1198161599 X:134013869-134013891 AAGGCAAGGTAGGTGTTTGGGGG + Intergenic