ID: 950008144

View in Genome Browser
Species Human (GRCh38)
Location 3:9704452-9704474
Sequence CCCGGCTGGGGGTAGCCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 1, 2: 2, 3: 13, 4: 160}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950008132_950008144 9 Left 950008132 3:9704420-9704442 CCGGTGCTGTCCAGAGTGCTGAC 0: 1
1: 0
2: 0
3: 15
4: 217
Right 950008144 3:9704452-9704474 CCCGGCTGGGGGTAGCCATGGGG 0: 1
1: 1
2: 2
3: 13
4: 160
950008131_950008144 24 Left 950008131 3:9704405-9704427 CCTGGACAGCGATTTCCGGTGCT 0: 1
1: 0
2: 0
3: 5
4: 35
Right 950008144 3:9704452-9704474 CCCGGCTGGGGGTAGCCATGGGG 0: 1
1: 1
2: 2
3: 13
4: 160
950008134_950008144 -1 Left 950008134 3:9704430-9704452 CCAGAGTGCTGACAGAGCGGACC 0: 1
1: 0
2: 0
3: 4
4: 97
Right 950008144 3:9704452-9704474 CCCGGCTGGGGGTAGCCATGGGG 0: 1
1: 1
2: 2
3: 13
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950008144 Original CRISPR CCCGGCTGGGGGTAGCCATG GGG Intronic