ID: 950008468

View in Genome Browser
Species Human (GRCh38)
Location 3:9705712-9705734
Sequence CTGCAGAAGGTGAGGCTGAA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 483
Summary {0: 1, 1: 0, 2: 1, 3: 49, 4: 432}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950008464_950008468 -10 Left 950008464 3:9705699-9705721 CCACTGCTGGGACCTGCAGAAGG 0: 1
1: 0
2: 5
3: 48
4: 287
Right 950008468 3:9705712-9705734 CTGCAGAAGGTGAGGCTGAATGG 0: 1
1: 0
2: 1
3: 49
4: 432
950008457_950008468 22 Left 950008457 3:9705667-9705689 CCCTACTCACTGTTCCTCTTCCT 0: 1
1: 0
2: 3
3: 43
4: 702
Right 950008468 3:9705712-9705734 CTGCAGAAGGTGAGGCTGAATGG 0: 1
1: 0
2: 1
3: 49
4: 432
950008460_950008468 8 Left 950008460 3:9705681-9705703 CCTCTTCCTTCTTGGCTGCCACT 0: 1
1: 0
2: 6
3: 30
4: 460
Right 950008468 3:9705712-9705734 CTGCAGAAGGTGAGGCTGAATGG 0: 1
1: 0
2: 1
3: 49
4: 432
950008455_950008468 24 Left 950008455 3:9705665-9705687 CCCCCTACTCACTGTTCCTCTTC 0: 1
1: 0
2: 5
3: 70
4: 697
Right 950008468 3:9705712-9705734 CTGCAGAAGGTGAGGCTGAATGG 0: 1
1: 0
2: 1
3: 49
4: 432
950008462_950008468 2 Left 950008462 3:9705687-9705709 CCTTCTTGGCTGCCACTGCTGGG 0: 1
1: 0
2: 2
3: 42
4: 330
Right 950008468 3:9705712-9705734 CTGCAGAAGGTGAGGCTGAATGG 0: 1
1: 0
2: 1
3: 49
4: 432
950008458_950008468 21 Left 950008458 3:9705668-9705690 CCTACTCACTGTTCCTCTTCCTT 0: 1
1: 1
2: 5
3: 56
4: 692
Right 950008468 3:9705712-9705734 CTGCAGAAGGTGAGGCTGAATGG 0: 1
1: 0
2: 1
3: 49
4: 432
950008456_950008468 23 Left 950008456 3:9705666-9705688 CCCCTACTCACTGTTCCTCTTCC 0: 1
1: 0
2: 3
3: 48
4: 574
Right 950008468 3:9705712-9705734 CTGCAGAAGGTGAGGCTGAATGG 0: 1
1: 0
2: 1
3: 49
4: 432
950008454_950008468 30 Left 950008454 3:9705659-9705681 CCTGTGCCCCCTACTCACTGTTC 0: 1
1: 0
2: 1
3: 18
4: 252
Right 950008468 3:9705712-9705734 CTGCAGAAGGTGAGGCTGAATGG 0: 1
1: 0
2: 1
3: 49
4: 432

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950008468 Original CRISPR CTGCAGAAGGTGAGGCTGAA TGG Exonic
900033127 1:385619-385641 CTGCAGAAGGTCTGGCTGGAAGG - Intergenic
900053966 1:615509-615531 CTGCAGAAGGTCTGGCTGGAAGG - Intergenic
901180750 1:7340288-7340310 CTGGAGAAGGTAAGACTGGAGGG + Intronic
901287525 1:8092830-8092852 CTGCAGCAGCTGAGTATGAACGG - Intergenic
901505291 1:9681343-9681365 CTTGAGAGGGTGAGGCTGGAGGG - Intronic
901833163 1:11906414-11906436 TTGCAGAGGGGGAAGCTGAAGGG + Intergenic
902677156 1:18016699-18016721 ATGCAGCAGGTGATGATGAAAGG + Intergenic
902826067 1:18975152-18975174 CTGCGGAAGGTGAAGCTACAGGG - Intergenic
903362912 1:22788230-22788252 TTGCAGATGGTGAGGGTGCAAGG + Intronic
903887171 1:26547249-26547271 CTGAAGAAGGCAACGCTGAAAGG + Exonic
904395404 1:30217817-30217839 CAGCTGAAGGGGAGGCTGAAGGG - Intergenic
904420259 1:30386621-30386643 CTGGAGGAGGTGAGCCGGAAGGG - Intergenic
904434587 1:30485960-30485982 CTGCAGGAGGTCCGGCTGCAGGG + Intergenic
904937328 1:34140935-34140957 CTGCAGGAAGTGAGGCTGGAGGG - Intronic
906035622 1:42748693-42748715 CTGCAGGAGATGGGGCTGAGTGG + Intronic
906241420 1:44244636-44244658 CTGCAGACAAGGAGGCTGAAGGG - Intronic
906532239 1:46530533-46530555 CTACACATGGTGAGGCTGGAGGG - Intergenic
906754469 1:48296446-48296468 CTGCAAAAAGTAGGGCTGAAAGG - Exonic
906935751 1:50212760-50212782 TTGCAGAAGGTGAGGAGGAAAGG - Intergenic
906992723 1:50755858-50755880 CTGCTGCAGCTGTGGCTGAAAGG - Intronic
907046881 1:51305002-51305024 CTGCACAGGGTGGGGCTGACAGG - Intronic
907233549 1:53023854-53023876 CAGCAGAGAGTGAGGGTGAAAGG - Intronic
907325606 1:53637001-53637023 CTGCAGGACGTGAGGGTGACTGG + Intronic
907456668 1:54580776-54580798 ATGGAGATGGTGAGGCTGCAGGG + Intronic
909165835 1:72222708-72222730 CTTCAGAAGCTGAGGCAAAAAGG + Intronic
910609118 1:89121271-89121293 CTGTAGAAGGAGAGGATAAAAGG + Intronic
910727288 1:90352345-90352367 CTGAAGAAACTGAGGCTTAAGGG + Intergenic
911725187 1:101235853-101235875 CTTAAGAACGTGAGGCTGAGAGG - Intergenic
912208616 1:107534733-107534755 CTAAAGAAGGTGTGGCTGACAGG - Intergenic
913223600 1:116679431-116679453 CTGCGGTGGGTGAGGATGAAAGG - Intergenic
914406312 1:147377221-147377243 CTGCCGTAGATGAGGCTGCAGGG + Intergenic
915349880 1:155217691-155217713 CTGAAGAAGATGAGGAGGAAGGG - Intergenic
915353222 1:155239602-155239624 CTGAAGAAGGTGAGGAGGAAGGG - Exonic
915363524 1:155300675-155300697 CTGCATAGGGTGAGGCTGCTGGG - Intronic
915856196 1:159388996-159389018 CTGGGGAAGGTGAGCTTGAAGGG + Intergenic
918223224 1:182455256-182455278 AAGCAGAAGGTGAGGAGGAAAGG + Intronic
919665046 1:200283571-200283593 CTGCAGAAAGCGAGGAGGAAGGG - Intergenic
919777163 1:201201824-201201846 CTGTATAAGGTGAGGCTGGAGGG + Exonic
922255488 1:223889770-223889792 CTGCAGAAGGCCTGGCTGGAAGG - Intergenic
922535016 1:226373217-226373239 CAGCAGAACGTGAGCGTGAAGGG + Intronic
922770070 1:228176871-228176893 CTGCAGCGGGTGAGGCTGGACGG - Exonic
923196075 1:231668936-231668958 CTAAAGAAGGGAAGGCTGAAAGG - Intronic
923207347 1:231771910-231771932 CTCCAGATGCTGAGGCAGAAAGG - Intronic
923515581 1:234695421-234695443 CTGCAGAAGGAATGGCTGGAGGG - Intergenic
924336690 1:242992639-242992661 CTGCAGAAGGTCTGGCTGGAAGG - Intergenic
1065328665 10:24571636-24571658 CTGCAGAAGGTGGAGGTGGAAGG - Intergenic
1066272537 10:33837549-33837571 CAGCAGAAGGGGAGCCAGAAAGG - Intergenic
1066369649 10:34809627-34809649 CTGCAGAGGGAGTGGCTGGAAGG + Intronic
1066616198 10:37297475-37297497 CTGTAGAATGTGACACTGAAAGG + Intronic
1067344530 10:45427995-45428017 CTGCAGAAGCAGAGGGGGAAGGG - Intronic
1068092967 10:52455360-52455382 CTGAAGAAGGTGAGTCAGAAAGG - Intergenic
1068117314 10:52749447-52749469 ATGCAGAAGCTGGAGCTGAATGG - Intergenic
1068729087 10:60336172-60336194 TTGCAAAAGGTGAGGTTAAAAGG + Intronic
1070287208 10:75092786-75092808 GTGCAGAATCTGAGGCTGCAGGG - Intergenic
1071409484 10:85374699-85374721 CTGCAGAAGCTGAAGATCAAGGG + Intergenic
1071862394 10:89687407-89687429 CTTCAGATGGGGTGGCTGAAGGG + Intergenic
1072528759 10:96298301-96298323 CTGAAGAATGTGAGGATAAATGG + Intergenic
1073638387 10:105222650-105222672 CTGCAGATGATGAGGCACAATGG + Intronic
1074406605 10:113184904-113184926 CAGGAGAAGGGGAGGCAGAAAGG + Intergenic
1074673882 10:115826516-115826538 CTGCAGGAGGTGAGAGTAAAAGG - Intronic
1075151246 10:119934724-119934746 AGGTAGAAGATGAGGCTGAAGGG - Intronic
1075155286 10:119971193-119971215 CTGCAGAGTGTGGGGCTGGAGGG - Intergenic
1075672175 10:124270303-124270325 TTGGGGAAGGTGAGGCTGGAGGG - Intergenic
1075717617 10:124566148-124566170 CTGGAGAAGGTGATGCTGGGAGG - Intronic
1076141128 10:128079096-128079118 CTGAAACAGGTGATGCTGAAAGG - Intronic
1076800135 10:132817933-132817955 CTGCCGACGGTGAGGATGGAGGG - Intronic
1077849411 11:6060870-6060892 CTACAGAAGGTGAAGCAGAGGGG + Intergenic
1078151616 11:8764475-8764497 ATGAAGAAGCTGAGGCTGAAAGG + Intronic
1079397477 11:20077627-20077649 GAGCAGAAGGTAAGGCAGAAAGG + Exonic
1079896214 11:26121857-26121879 CAGCAGAAGGTGAGCATGCAAGG - Intergenic
1080502693 11:32885683-32885705 CTGCAGACGGCAAGGCTAAAAGG + Intergenic
1081724809 11:45320869-45320891 CTGGAGAAGCTGAGGCAGCATGG + Intergenic
1081750740 11:45509123-45509145 ATGCAGAAACTGAGGCTCAAAGG + Intergenic
1081967885 11:47180441-47180463 CTGAAGGAGGTGAGGCTGGGTGG - Exonic
1082837590 11:57663003-57663025 CTGTACAAGATGAGGCTGGAGGG + Intergenic
1082986561 11:59174384-59174406 CATCAGAAGGTGAGGGTGGAGGG + Intronic
1083044363 11:59720053-59720075 ATGCAGAAATTGAGGCTTAAGGG + Intronic
1083603073 11:63961027-63961049 TTGCAGCAGGTGAGGCTGACGGG + Intergenic
1084162505 11:67357367-67357389 CAGCAGAAGGGGAAGCTGAGAGG + Intronic
1084327799 11:68411757-68411779 CAGCAGAGGGTGAGGCTGCTGGG - Intronic
1084766490 11:71312373-71312395 CAGCAGAAGGTGAGCTGGAAAGG + Intergenic
1084954099 11:72682313-72682335 CTGGAGGAGGTGAGTCTGAAAGG - Intergenic
1085829044 11:79880167-79880189 CAGAAGAGGGTGAGACTGAAAGG + Intergenic
1086100448 11:83093912-83093934 ATGCAGAACGTGAGGCTAGATGG - Intergenic
1086105110 11:83139010-83139032 CTGGAGAAGGTGATGATTAAGGG - Intergenic
1086164781 11:83764904-83764926 CTGCAGAATGATAGGCTGATAGG + Intronic
1088190839 11:107226474-107226496 CTGCGGAGGGAGAGGCTAAAGGG - Intergenic
1088868384 11:113870578-113870600 CAGCAGCAGGTTAGGTTGAAAGG - Intronic
1089127070 11:116184058-116184080 ATGGAGAAAGTGAGGCTGAAGGG - Intergenic
1089323981 11:117644738-117644760 CTGCACCAGGTGGAGCTGAAGGG + Intronic
1090073149 11:123561383-123561405 CAGCAGAAGGAGAGGATGAAAGG + Intronic
1090199441 11:124843688-124843710 ACGCAGAAGCTGAGGCTCAAAGG - Intergenic
1090634428 11:128681794-128681816 CTTCAGAATGTGACGCTGATGGG - Intergenic
1091192956 11:133709349-133709371 ATGCTGAGGGTGAGGGTGAAGGG - Intergenic
1091198020 11:133748275-133748297 CTGAAGAAACTGAGTCTGAAAGG + Intergenic
1091555046 12:1566738-1566760 CTCCAGAAGGTGAGGGAGAGGGG - Exonic
1091749591 12:3014155-3014177 CTGTGGAAGCTGAGGCTGAGAGG - Intronic
1091777022 12:3191285-3191307 TTGCAGAAAGGGAGCCTGAAAGG - Intronic
1092531936 12:9352142-9352164 CTGTAGAAGGAGAGGCTGCCGGG - Intergenic
1092871284 12:12808004-12808026 CTCCAGAAGGAGAGGTCGAAGGG - Intronic
1093047171 12:14460711-14460733 CTGTAGAAGCTGAGGCTGGGAGG - Exonic
1093131781 12:15400358-15400380 GTGCAGCAGGTGAGGCTGCTGGG - Intronic
1094715104 12:33005999-33006021 CTGCAGAAAGAGAGGCAGAGTGG - Intergenic
1098139189 12:67434352-67434374 ATGCAGGAAATGAGGCTGAAGGG - Intergenic
1098702394 12:73645596-73645618 CTGCAGATGGTGGGACTGAAAGG - Intergenic
1099587857 12:84544634-84544656 CTGGAGAGGCTGAGGCAGAATGG - Intergenic
1100641432 12:96485300-96485322 AGGCAGAAGATGAGGCAGAAAGG - Intergenic
1101652800 12:106693085-106693107 CTGCAGAAGGTGGAGCTGACAGG - Intronic
1102002420 12:109565785-109565807 CTGGAGGAGGTGATGCTGGAGGG + Intronic
1103017866 12:117509466-117509488 CTGCAGAAGGAAGGGCTGCAAGG + Intronic
1103722353 12:122981563-122981585 AGGGAGAAGGTGAGGCTGGAAGG - Exonic
1103859664 12:124002300-124002322 GTGCAGGAGGTGAGGTTGGAAGG + Intronic
1104203840 12:126617501-126617523 CTCCAGCAGGTGGGGCTAAAGGG - Intergenic
1105241395 13:18611965-18611987 CTTCAGAAGTTGAGTCTCAAGGG - Intergenic
1106568271 13:30905759-30905781 CAGCTGAAGGAAAGGCTGAAAGG + Intergenic
1106701878 13:32237866-32237888 CTGCAGCAGCTGCTGCTGAAAGG + Exonic
1108922081 13:55688591-55688613 CTGGGGAAGTTGAGGCTGCAGGG - Intergenic
1109099123 13:58157312-58157334 CTGATGAAGGAGGGGCTGAAAGG + Intergenic
1110418591 13:75279206-75279228 AAGTAGAAGGTGGGGCTGAATGG - Intergenic
1110568246 13:76977530-76977552 GTGAAGAAGGTGTGGCTCAAAGG - Intergenic
1111213264 13:85108680-85108702 CTGCAAATGGTGGGACTGAAAGG - Intergenic
1112012382 13:95302830-95302852 ATGAGGAAGGTGAAGCTGAAAGG + Intergenic
1112464929 13:99635474-99635496 ATGTGGAAGGGGAGGCTGAATGG - Intronic
1113045736 13:106152785-106152807 GTGGAGAATGTGAGGCTGAGGGG + Intergenic
1113073372 13:106444432-106444454 CTGAAGTGGGTGAGGCTGAGGGG - Intergenic
1113717591 13:112524056-112524078 CTGCAGATGCTGAGGGTGACGGG - Intronic
1113728990 13:112626200-112626222 CTGCAGAAGGTCAGGCCCAAGGG + Intergenic
1113767760 13:112891628-112891650 CCGCAGGAGCTGAGGCTGCAGGG - Intergenic
1113926979 13:113947087-113947109 CTACAGAAGGTGAGGTGGAGCGG + Intergenic
1114772024 14:25438905-25438927 CTGTTGAAGGTGGGACTGAATGG + Intergenic
1115615827 14:35093757-35093779 CTCCAGAGGCTGAGGCAGAATGG - Intronic
1117351243 14:54883881-54883903 CTAAAGAAGGTGAGGCAGGAAGG + Intronic
1118513020 14:66497041-66497063 CTTCAGCAGGTGCTGCTGAAGGG + Intergenic
1119135408 14:72213739-72213761 ATCCAGATGGTCAGGCTGAAAGG - Intronic
1119913317 14:78371378-78371400 CAGCAGAAGGGGAGGTGGAAGGG - Intronic
1120816847 14:88869753-88869775 CTTCAGAAGGGGTGGCGGAAGGG - Intronic
1121438147 14:93932355-93932377 CTGGGGGAGGTGAGGCCGAAGGG - Intergenic
1122802017 14:104235865-104235887 CTGCAGGAGGTGGTGCTGCAAGG + Intergenic
1122878322 14:104678887-104678909 CTGCAGAAACTGAGGCTCAAAGG + Intergenic
1123489963 15:20773185-20773207 CTTCAGAAGTTGAGTCTCAAGGG + Intergenic
1123546462 15:21342272-21342294 CTTCAGAAGTTGAGTCTCAAGGG + Intergenic
1123984457 15:25632848-25632870 CTGCAGAGGGAGAGGCAGAGTGG + Intergenic
1124065739 15:26342084-26342106 CAGCTGAAGGTGAGGGTGAGGGG - Intergenic
1124364467 15:29062250-29062272 CTGCATACGGGGAGGCTGCACGG + Intronic
1125520689 15:40346350-40346372 CTGCATGAGGTGGGGCTGGAGGG + Intergenic
1125537734 15:40452218-40452240 CCGCAGCAAGTGAGGCTGTATGG + Intronic
1126369987 15:47935246-47935268 CTGCCTAACGTAAGGCTGAAAGG - Intergenic
1126372648 15:47963531-47963553 ATTAAGAAGGTGGGGCTGAAAGG - Intergenic
1127059133 15:55164151-55164173 CTGCTGAAGGTGCGGTGGAAAGG - Intergenic
1127891318 15:63254032-63254054 GGGCACAAGCTGAGGCTGAAGGG - Intronic
1127965851 15:63922459-63922481 CTGCAGAAGGGGACCCTGAGGGG + Intronic
1128254224 15:66185251-66185273 CTGCAGAACTTGAGGCAGCAGGG - Intronic
1128666197 15:69539958-69539980 CTGAAGGAAGTGAGGCTGAGCGG - Intergenic
1129422033 15:75436048-75436070 CCTCAGAAGTTGAGGCTGCAAGG + Intronic
1130971868 15:88739950-88739972 GTGGAGAAGGTGAGGCATAATGG + Intergenic
1131206425 15:90452214-90452236 CTGGAGGAGGTGAGACTTAAGGG + Intronic
1202954790 15_KI270727v1_random:69487-69509 CTTCAGAAGTTGAGTCTCAAGGG + Intergenic
1132562734 16:605449-605471 CTGCAGAGGGCGAGGCTGCGAGG - Intronic
1132838629 16:1967370-1967392 TTGCAGAAGATGTGGCTGCATGG - Exonic
1132981464 16:2740438-2740460 GTGAGGAAGGTGAGGCTGGAGGG - Intergenic
1133595129 16:7283603-7283625 CTGAGGACGGTGAGGCTGAGTGG - Intronic
1133893376 16:9902827-9902849 CTGAAGAGGATGAGGCAGAAAGG - Intronic
1136223641 16:28844647-28844669 CTGCAGAGGGTGGGGCTGGATGG - Intronic
1136604608 16:31325040-31325062 CTGGAGGAGGTGAGGAGGAAAGG - Intronic
1137308451 16:47229441-47229463 CTGCAAGAGATAAGGCTGAAGGG + Intronic
1139519767 16:67474422-67474444 CAGAAGAAGGTGAGGCTAGAAGG - Intronic
1139712985 16:68790626-68790648 CTGCAGAGGCGGAGGCTGGAGGG - Intronic
1140137676 16:72222213-72222235 CTTGAGAAGGTGAGGCAGGAAGG - Intergenic
1140190514 16:72811891-72811913 CCGGAGCAGGTGAGGCTGGAAGG - Exonic
1141375982 16:83531267-83531289 CAGGAGAAACTGAGGCTGAAAGG - Intronic
1141826692 16:86485638-86485660 CTTCAGAAGGAAAGGCTGAGAGG - Intergenic
1141921899 16:87141042-87141064 CAGCAGGAAGTGAGGCTGAGGGG - Intronic
1143090941 17:4448873-4448895 CTGGAGAATGTGATGCTGGATGG + Intronic
1143481201 17:7228169-7228191 CTAGAGAAGGTGAGGGTGGAAGG + Intronic
1143864040 17:9911186-9911208 CTGCTGCAGGTGATGCTGGAAGG + Intronic
1144058362 17:11560416-11560438 TTCCAGAAGGTGAGGCTAAGAGG + Exonic
1144084902 17:11799689-11799711 CTTCAGAGGCTGAGGCAGAATGG - Intronic
1144702202 17:17347170-17347192 CTGCCTGAGGTCAGGCTGAACGG - Exonic
1145752358 17:27364341-27364363 CTGCAGGACGGGAGGCAGAATGG - Intergenic
1146950133 17:36899962-36899984 GTGCAGGAGCTGAGGCTGACAGG + Intergenic
1147194241 17:38754634-38754656 CTGCAGAAGGGAAGGCTCACGGG - Intronic
1147833664 17:43314988-43315010 ATGCAGAAGCTGAGGCAGAGAGG - Intergenic
1148640735 17:49185372-49185394 CTGCTCCAGCTGAGGCTGAAAGG + Intergenic
1148816295 17:50330372-50330394 CTGCAGACGGAGGGGCTGAGGGG - Intergenic
1149019760 17:51949726-51949748 CTACAGAAGGTTAGCCTTAAGGG + Intronic
1149641512 17:58205916-58205938 CTGCAGAAGGCTAGGCAGAGGGG + Exonic
1153527944 18:6015353-6015375 TTGCAGAAGGTGGGGGTGGATGG + Intronic
1156447070 18:37244896-37244918 GAGCAGACGGGGAGGCTGAAGGG - Exonic
1156988255 18:43375178-43375200 CTGCACAAGGTAAGCCAGAAGGG - Intergenic
1157543162 18:48526747-48526769 CAGCAGAAGGAGAGGGAGAAGGG - Intergenic
1157705835 18:49805635-49805657 CTGCAGAGGTCGAGGCTGCAGGG - Intronic
1157898087 18:51487337-51487359 CTGGAGAAGCTGAGGCTGAGTGG - Intergenic
1160077439 18:75691790-75691812 CTGCACAAGGTGAGACAGTAGGG - Intergenic
1160767506 19:814985-815007 TTGCAGACGGTGAGGAAGAAGGG + Exonic
1160793609 19:933903-933925 CTGCAGAAGGGGATGCTCCACGG + Intronic
1161040290 19:2107153-2107175 CTGCGGAGGCTGAGGCAGAATGG + Intronic
1162454714 19:10776408-10776430 CTGCAGAATGTGAGCAGGAAGGG + Intronic
1162531402 19:11238263-11238285 CTGCTGAAGTTGAGGCTGTGCGG + Exonic
1162967466 19:14162725-14162747 TTGGGGAAGGTGAGGCTGACAGG + Exonic
1162992847 19:14314596-14314618 GTGCAGAAGGGGAGGCTGGGTGG + Intergenic
1163369894 19:16896233-16896255 CAGCAGGACGTGAAGCTGAATGG - Exonic
1164073780 19:21793987-21794009 CTGCAGCTGGTGTGGCTGGAGGG - Intergenic
1164700563 19:30281289-30281311 CTAAAGAAGGGAAGGCTGAATGG - Intronic
1164934479 19:32200415-32200437 CTGCAGCAGCTGAGGCTCCAGGG - Intergenic
1165162627 19:33826729-33826751 TTGCAGAAGGTGAGGTCGCAGGG + Intergenic
1165470844 19:36003622-36003644 CTCCAGGATGTGAGGCTGGAGGG - Exonic
1165474769 19:36024206-36024228 CAGCACAGGGTGAGGCTCAAAGG + Intronic
925557076 2:5143441-5143463 CTGCCAAATGTGGGGCTGAAGGG + Intergenic
926309218 2:11662329-11662351 CAGCAGAAGGAGCGGCAGAAGGG + Intronic
926332418 2:11836564-11836586 CTTCAGAAGGGTAGACTGAAGGG - Intergenic
926647950 2:15310387-15310409 TTGCAGGAGCTGAGGCTGACTGG - Intronic
926715573 2:15921358-15921380 CTGGAGAAGGAGAGGCTCAGAGG + Intergenic
928014451 2:27642233-27642255 CTGCAGAAGTTTAGACTGGAGGG - Intronic
928438568 2:31272495-31272517 CTGCAGCAGGAGAGGCTTCATGG + Intergenic
928472668 2:31589777-31589799 TTGCAGAAGCTGCAGCTGAAGGG + Intergenic
928930669 2:36620529-36620551 CAGAAGAAGGAGAAGCTGAAAGG - Intronic
929187405 2:39109489-39109511 CAGGAGAGGGGGAGGCTGAATGG - Intronic
929288201 2:40159982-40160004 CTGTAGAAGATGAGCCTGGAGGG + Intronic
929298608 2:40275818-40275840 CTGCTGGAGGTCAGGCTGGATGG + Intronic
929925199 2:46201816-46201838 CTGAAGAAGGTGGGGGTGGAGGG + Intergenic
930381969 2:50641492-50641514 CTGAAGTAGGAAAGGCTGAAGGG - Intronic
931723498 2:65085396-65085418 CTGAATAAGGTGAGACTAAAGGG + Exonic
932091230 2:68808102-68808124 CTGGAGAAGGTGGGGAGGAAGGG - Intronic
932331142 2:70899124-70899146 CGGCAGAAGGTGAGGTTGGGGGG - Intergenic
932635728 2:73386184-73386206 CTGGAGAAGGTGAGGCGGGCCGG + Exonic
932706886 2:74032781-74032803 CTGCAGCAGGTGGGGGTGAAGGG - Intronic
934508198 2:94913326-94913348 CTACAGAGGGTGAGTGTGAATGG - Intergenic
934947960 2:98555616-98555638 CTGCAGAAGGAGCGGCTGCATGG + Exonic
935696893 2:105778019-105778041 CTGAAGAAGGTGAGGAGAAAAGG - Intronic
936252044 2:110874510-110874532 TTGCTCAAGGTCAGGCTGAATGG - Intronic
936678522 2:114743715-114743737 CTGTAAAAGGTGAGGTTGTAAGG + Intronic
937276218 2:120685772-120685794 CTTGAGAAGCTGAGGCTGCAGGG - Intergenic
938132727 2:128731495-128731517 GTGAAGAAGGTGAGGCTGACAGG + Intergenic
938903522 2:135818010-135818032 CTGCTGCTGGTCAGGCTGAAGGG + Exonic
939678979 2:145107186-145107208 ATCCAGCAGGTAAGGCTGAAGGG + Intergenic
940002713 2:148982501-148982523 CTGCTGACTGTGAGGCTGACAGG + Intronic
940737416 2:157469056-157469078 CTGAAGAAGGAGAAGCAGAATGG - Intronic
941188243 2:162344138-162344160 CAGCTGCAGGTGAGGCTGAAAGG - Exonic
941536001 2:166722989-166723011 CTGCTCAAGCTGTGGCTGAAAGG - Intergenic
941800113 2:169650404-169650426 TTGCAGAAGCTGAGGCTGAATGG - Exonic
941928377 2:170917532-170917554 CTGTGGATGGTGAGACTGAAAGG - Intergenic
942507522 2:176659143-176659165 CTGGAGAAGAGAAGGCTGAAGGG + Intergenic
942954559 2:181759119-181759141 TTGCAGAAGGTGAGTGAGAATGG + Intergenic
944284176 2:197929572-197929594 CTTCAGAAGGTTAGGTAGAAGGG + Intronic
944442450 2:199756336-199756358 CAGGAGAAGGTGTGGGTGAAAGG + Intergenic
947889909 2:233608245-233608267 TGGCAGAAGGTGAGGGTGGAGGG + Intergenic
947895338 2:233666100-233666122 TGGCAGAAGGTGAGGGTGGAGGG + Intronic
948285579 2:236782142-236782164 CTGCAGAAGGTGTGTGAGAATGG + Intergenic
949007133 2:241656096-241656118 ATGCAGAAGGAGAGGCTTCAAGG - Intronic
1169106772 20:3002900-3002922 ACGCAGAAGGTGAGGTTGATGGG - Intronic
1169132594 20:3173726-3173748 CTAGAGAGGGTGAGGCTGAGGGG - Intergenic
1169298781 20:4423871-4423893 CAGGAGAAGGTGATGCTGAGTGG + Intergenic
1170093847 20:12622711-12622733 CTGGAGAAGGCCAGGCGGAAAGG + Intergenic
1171190364 20:23154699-23154721 CTTTAGAAGGCGAGGCAGAAGGG + Intergenic
1172495897 20:35383920-35383942 ATGCAGAAGGTGAGGCTCAGGGG - Intronic
1172513418 20:35515907-35515929 CTGCTGGAGGTGAGGATGAGAGG + Exonic
1172812480 20:37658697-37658719 TTGCAGATGGAGAGGCTGAGTGG + Intergenic
1173564922 20:44031789-44031811 CAGCAGAAGTGGAGGGTGAAGGG + Intronic
1173619800 20:44428368-44428390 CTGCATCAGGTGAGGGTGCAGGG - Exonic
1173704041 20:45097082-45097104 ATGAAGAAGCTGAGGTTGAAGGG - Intronic
1173982790 20:47237697-47237719 CAGCAGAATGTGAGGTTGAAAGG - Intronic
1174151562 20:48489695-48489717 GTGGAGAAGGCGAGGCTGATGGG + Intergenic
1174516853 20:51099138-51099160 CTGCAGAAGGGGAGGGAGGAGGG + Intergenic
1174590365 20:51640232-51640254 GTGCAGTGTGTGAGGCTGAAAGG - Intronic
1175246875 20:57587537-57587559 CTGCTCAAGGACAGGCTGAAAGG - Intergenic
1175912505 20:62411514-62411536 GTGCAGAAATTGAGGCTGAGAGG - Intronic
1175943159 20:62547176-62547198 CTGCTGAGGGTGAGGGTGGAGGG - Intergenic
1176047547 20:63100684-63100706 ATGCAGGAGGGGAGGCTGCAGGG - Intergenic
1177087565 21:16725822-16725844 CTGCAGAAGTTCTGGCTGAAAGG + Intergenic
1177447582 21:21217783-21217805 ATGCAGAAGGGGAGGGTGGAGGG + Intronic
1178282026 21:31291910-31291932 CTGAAGAAGGAGAGTCTGGAAGG - Intronic
1178389084 21:32184059-32184081 AGGGAGAGGGTGAGGCTGAATGG - Intergenic
1179286734 21:39983914-39983936 CCTCTGAAGCTGAGGCTGAAAGG + Intergenic
1179339082 21:40487455-40487477 TTGCATGAGGTGAGGCTGGAGGG + Intronic
1179836088 21:44034418-44034440 CTGCAGAAGGCAAGGGAGAAGGG + Intronic
1181027145 22:20132749-20132771 GTGAAGAAGTTGAGGCTGGAGGG - Intronic
1181257093 22:21569666-21569688 GGGCAGGAGGTGAGGCTCAAGGG - Intronic
1182026553 22:27123707-27123729 CTGAAGAAAGGGAGGCAGAAAGG + Intergenic
1182273072 22:29167915-29167937 CAGCAGAAGATGAGGATGACGGG + Exonic
1182680979 22:32079911-32079933 CTGCAGAGGGCAAGGCAGAATGG + Intronic
1183081679 22:35460740-35460762 CTGCAGAAGGTTAGGAAGGAAGG + Intergenic
1183161249 22:36114794-36114816 CTGCAGCAGGTGCAGCAGAAGGG - Intergenic
1183483767 22:38078520-38078542 CTGAGGACGCTGAGGCTGAAGGG - Exonic
1183650801 22:39152362-39152384 GTGCGGAAGGTGAGGCTGCCCGG - Exonic
1183868251 22:40721250-40721272 TTTCAGAAGGTTAGGCTTAAGGG + Intergenic
1183933644 22:41249715-41249737 CTGCTCAAGGTGAGGCCGGAAGG - Exonic
1183983326 22:41555385-41555407 GTTCAGAAGGTGAGGACGAAGGG + Intergenic
1184119542 22:42441103-42441125 CTGGAGAAGGGGAGGCTGGGTGG - Intergenic
1184930730 22:47679209-47679231 CTGCAGAAGCTGAAGCTAACAGG - Intergenic
1185016460 22:48346038-48346060 TTGCAGAAGGTGAGGTCGAAGGG + Intergenic
1185301163 22:50081840-50081862 CGGCAGCCGCTGAGGCTGAAGGG + Intronic
949564242 3:5230325-5230347 CTAGAGAAAGTGAGGCTGAGAGG + Intergenic
950008468 3:9705712-9705734 CTGCAGAAGGTGAGGCTGAATGG + Exonic
950152869 3:10701902-10701924 TCGCAGAAGGTGAGACTGACTGG - Intronic
950228530 3:11255990-11256012 GGGCAGAAGGTGAAGCTGCAAGG + Intronic
950601005 3:14035470-14035492 CTGCAGAAGCAGTGGCAGAAAGG + Intronic
950965039 3:17140155-17140177 CTGCAGAAGGTGAGGATGCTGGG + Intergenic
951994252 3:28709420-28709442 CTGGAGAAAGTGATGCTCAACGG + Intergenic
952307572 3:32159580-32159602 TTGGAGAAGGAGATGCTGAATGG + Exonic
954263903 3:49459120-49459142 CTGCAGAAGGAGGGGCTACAGGG - Intergenic
954603146 3:51887921-51887943 CTGTTGAAGGGGAGTCTGAATGG + Intergenic
955123427 3:56085032-56085054 ATGGAGAAACTGAGGCTGAAAGG - Intronic
956324811 3:68040292-68040314 CAGCAGGAGGGGAGGCTTAAAGG - Intronic
956825975 3:72997093-72997115 CCGGAGAAGGTGAGGGGGAATGG - Intronic
956891951 3:73622404-73622426 CTCCAGATGGTGTGGCAGAAAGG - Intronic
956949287 3:74261799-74261821 CTGCAGAAGGCAGGGCTGATTGG - Intergenic
957477473 3:80744202-80744224 TTGGAGAAGGTTTGGCTGAATGG - Intergenic
957549659 3:81687273-81687295 CAGCAGATGGAGAGGCTGAGGGG + Intronic
958260544 3:91375547-91375569 CTGCAGAAGGTGAGAAGGCAGGG - Intergenic
960791022 3:121430974-121430996 CTGCAGAGAATGAGGCAGAAGGG + Intergenic
961216558 3:125164739-125164761 CTGCATGAGTAGAGGCTGAAAGG + Intronic
961384743 3:126517171-126517193 CTGGAGAACGTGCGGCTGCATGG - Intronic
962081690 3:132145995-132146017 CTGCAGTAGGTGTGGCCAAATGG + Intronic
962267214 3:133952430-133952452 CGGCTGAAGGGGTGGCTGAAAGG - Intronic
963257238 3:143157993-143158015 TTGAAGAAGGTGAGGAAGAAAGG - Intergenic
963433390 3:145237610-145237632 CTGGAGAAGGAGAGGCAGAATGG - Intergenic
963829340 3:149990329-149990351 CTGCAAAAGGTGGGGACGAATGG + Intronic
964389815 3:156185330-156185352 TTGGAGATGGTGAGGCTGGAAGG - Intronic
964508181 3:157422018-157422040 CAGGAGAAGGTGAGGGAGAAAGG - Intronic
964627705 3:158775457-158775479 CTTCAAAAGGTGAGGATGAGTGG + Intronic
964669469 3:159209351-159209373 CAGCAGAAGGGGAGCCGGAAGGG - Intronic
965488960 3:169313485-169313507 CTGCAGGAGGTGAGAGAGAATGG + Intronic
966021372 3:175215838-175215860 GTGCAGAAAGTAAGACTGAATGG + Intronic
966471284 3:180292084-180292106 CAGCAGGAGGAGAGACTGAAAGG + Intergenic
967546153 3:190731262-190731284 CTGAAGGAGGTGAGGCTGTAGGG + Intergenic
968376717 4:50078-50100 CTGCAGGAGGAGAGCCTGCAGGG - Intergenic
968669771 4:1842911-1842933 CAGGAGATCGTGAGGCTGAATGG - Intronic
968959129 4:3734126-3734148 CTGGGGAAGGTGAGGCAGCATGG + Intergenic
969462695 4:7337149-7337171 TTGCAGAAGGTGGGGCTGGAAGG + Intronic
969517904 4:7658746-7658768 CTGGAGAAGGTGAGGCAAATGGG + Intronic
970974750 4:22030595-22030617 CTGCAGAGCATGATGCTGAAAGG - Intergenic
972164684 4:36268610-36268632 CTTCATAAGATCAGGCTGAAAGG - Intergenic
972593468 4:40509776-40509798 CTGCGGAGGCTGAGGCAGAATGG + Intronic
972636757 4:40891125-40891147 CTGGGGAAACTGAGGCTGAAAGG + Intronic
972780095 4:42279820-42279842 CTGCAGAAGGAGCCGCTGCAAGG + Intergenic
977032910 4:91909631-91909653 CTCCAGAAGGTGAGTCTGCTTGG - Intergenic
977212118 4:94230855-94230877 ATTCAGAAGGACAGGCTGAAAGG + Intronic
978567776 4:110102582-110102604 CTGGAGAGGTTGAGGCTGTAGGG + Intronic
979028891 4:115613856-115613878 CTCCAGAAGCTGAGGTTGGAAGG + Intergenic
979240439 4:118442670-118442692 CTGCAGAAAGTCTGGCTGGAAGG + Intergenic
979267471 4:118720113-118720135 TTGAAGAAGGGGAGGCAGAATGG - Intergenic
980000872 4:127486237-127486259 CTGCAGAGGGTGAGGGTGCTTGG + Intergenic
980306548 4:131068085-131068107 TGGCAGAAGGTGAAGGTGAAGGG - Intergenic
981657264 4:147125715-147125737 CTGCAGAAGGTGAGGTGACATGG - Intergenic
981752135 4:148102725-148102747 GTGCAGAAGGTTGTGCTGAATGG - Intronic
981809155 4:148753823-148753845 CTGCAGCAGATGAGGCTGTATGG + Intergenic
982886064 4:160784095-160784117 CCACAGAAGGTGTGGCTGAGAGG + Intergenic
985166098 4:187095728-187095750 AGGGAGAAGGTGAGGCTGCAGGG + Intergenic
985540003 5:483468-483490 CCACAGAAGGTGATGCTGCAGGG + Exonic
985546539 5:512739-512761 CTGGAGAAGGCCAGGCTGAGGGG + Intronic
985656313 5:1133361-1133383 CTGGAGGAGGTGGGGCTGACGGG - Intergenic
985661437 5:1159030-1159052 GGGCAGAGGGTGTGGCTGAATGG - Intergenic
986376597 5:7138118-7138140 CAGCAGAAGCTGATGCTGAAGGG - Intergenic
988283381 5:29179273-29179295 CTGCTGAATATAAGGCTGAATGG + Intergenic
990452971 5:55953877-55953899 CTCCAGAGGATGAGGCAGAAGGG + Intronic
990583345 5:57185874-57185896 CTGCAGTAGGTGGGACTGCAGGG - Intronic
990876696 5:60494368-60494390 CTGCAGGTGGTGAGGCTCAGTGG - Intronic
991245880 5:64507440-64507462 CTTCAGAAACTGAGTCTGAAAGG + Intronic
991402925 5:66273126-66273148 CTGCTGAAGGGGAAGCTGGAAGG - Intergenic
993716319 5:91278806-91278828 CTGGAGAGGCTGAGGCGGAAGGG + Intergenic
996696538 5:126402945-126402967 ATGTAGAATGTGAGGCTAAAAGG + Intronic
996814642 5:127561440-127561462 ATGAAGAATCTGAGGCTGAAAGG - Intergenic
996937296 5:128964279-128964301 CTGCAGAACATGAGGCAGAAGGG + Intronic
996975972 5:129435111-129435133 CCCAAGAAGTTGAGGCTGAATGG - Intergenic
997377733 5:133409341-133409363 CTGTAGCAGGTGAGCCTGAGAGG - Intronic
997892091 5:137686296-137686318 CTGCAGATGATGAGGCTGGCAGG + Intronic
998148966 5:139746409-139746431 CTGCAGAAGGCGGGGCTGGGGGG + Intergenic
998942541 5:147300231-147300253 CTGAAGAAACTGAGGCTCAAAGG + Intronic
999015036 5:148093412-148093434 CTGTCTAAGGTGAGGGTGAAAGG + Intronic
1000784315 5:165525006-165525028 CAGTAGAAAGGGAGGCTGAAAGG + Intergenic
1000901220 5:166913805-166913827 ATGAAGAAAGTGAGGCTCAAAGG + Intergenic
1001794590 5:174491494-174491516 CAGCAAGAGGTGAGGCTGAGAGG - Intergenic
1002092656 5:176814117-176814139 CTGCTGCAGGTGAGGGAGAAAGG - Intronic
1002551704 5:179998539-179998561 CTTGGGAAGGTGAGGCAGAAAGG - Intronic
1002740693 5:181433249-181433271 CTGCAGAAGGTCTGGCTGGAAGG + Intergenic
1003879996 6:10471244-10471266 CTGCAGAAAGAGAGGCTGCAGGG + Intergenic
1003893068 6:10580647-10580669 CTGCAGAGGGTGATGAAGAACGG + Intronic
1004256153 6:14066405-14066427 CTGAAGAACGTGAGCCTGAGGGG - Intergenic
1005072178 6:21872041-21872063 CTGCAGAAGTTGTGGCAGAAGGG - Intergenic
1006298296 6:33179711-33179733 CTGCAGCAGGCGAGGGTGAGTGG - Exonic
1006386609 6:33734583-33734605 CTTCTGAAAGTGAGGCTCAAAGG - Intronic
1006807756 6:36799552-36799574 CTGCAGGCGGGGAGGCTGCAGGG + Intronic
1007304356 6:40892497-40892519 CGGCAGAAGGTGAGGTACAAGGG + Intergenic
1007628083 6:43257789-43257811 CTGCAGGGGGTGAGGGTGATGGG - Intronic
1007932917 6:45708644-45708666 CTGCAGAAGGTCATCATGAAGGG + Intergenic
1008134490 6:47758039-47758061 CTCCAGTTGGGGAGGCTGAAAGG + Intergenic
1008606391 6:53144177-53144199 CTTGAGAAGGTGAGACGGAAGGG + Intronic
1008883770 6:56410139-56410161 CTCCAGAAGGTAGGACTGAAGGG + Intergenic
1008970878 6:57366519-57366541 CTGCAGAAGTGGAGGGTGAGTGG + Intronic
1010828241 6:80498739-80498761 GTGCAGAAGGAGAGGAGGAAGGG + Intergenic
1015390321 6:132674478-132674500 CTCCAGAATGTTAGGGTGAAGGG + Intergenic
1015991241 6:138945620-138945642 CTGAAGAATATGAGGCTGCATGG + Exonic
1016330845 6:142950437-142950459 CTGCAGAATGTTTGCCTGAAGGG - Intergenic
1018399522 6:163408774-163408796 CTGAAGAAGCAGAGGCTGAGAGG - Intergenic
1018755032 6:166841645-166841667 CTGCAGAGGCTGAGTCAGAAAGG + Intronic
1018883475 6:167909367-167909389 ATGGAGAAGGTGAGGATGGAGGG + Intronic
1019245803 6:170708845-170708867 CTGCAGAAGGTCTGGCTGGAAGG + Intergenic
1019612607 7:1944623-1944645 CTGGGAAATGTGAGGCTGAAGGG + Intronic
1019757469 7:2783446-2783468 CCTCAGAGGGTGAGGATGAATGG - Intronic
1019888011 7:3922181-3922203 CCGGAGAAGGTGAGTCTGATTGG + Intronic
1022339757 7:29456917-29456939 CTGCAGATGGGGAAGATGAAGGG - Intronic
1022547577 7:31203120-31203142 CTGATGAAGGTGAGTCTGAGAGG + Intergenic
1022965202 7:35465936-35465958 CTTCAGAAGGTGAGGCTCTGGGG + Intergenic
1023325837 7:39054876-39054898 CTGCAGAAGTTGAGGATAACAGG + Intronic
1023884878 7:44347648-44347670 AAGCAGGAGGTGAGGCTGCAAGG - Intergenic
1024141698 7:46468698-46468720 CTTCAGAATGTGAGGGTCAAAGG + Intergenic
1024261937 7:47579879-47579901 CTGCAGGAGGTGTTGCTGAAGGG - Intronic
1024687529 7:51763016-51763038 GTGGAGGAGGTGAGGCTCAATGG - Intergenic
1025027937 7:55533607-55533629 CTGAAGAAGCTGAGGCTCAGGGG - Intronic
1025094197 7:56084954-56084976 CTGCAGCTGGTGAGTCTGGAGGG + Intronic
1026181676 7:68046770-68046792 CTGGAGAAGGGGAGGAGGAAAGG + Intergenic
1026233370 7:68505022-68505044 CTGCAGGAGCTGAGGCTGCCAGG + Intergenic
1027493906 7:78863570-78863592 CTGCACAAGGTGGGGCCTAATGG - Intronic
1027544518 7:79510162-79510184 CTGCAGAAGGTGAGAGTGAGTGG - Intergenic
1028424026 7:90666054-90666076 TGGCAGAAGATGAGGCTGCAGGG - Intronic
1029375396 7:100174279-100174301 AGGCAGAAGGTGAGGCTGGGAGG + Intronic
1029409502 7:100399654-100399676 CTGGAGAAGGTGGGGTGGAAGGG + Intronic
1029592957 7:101519468-101519490 CTGCAGAGGGAGAGGCTGCCGGG + Intronic
1030319672 7:108152189-108152211 CTGCAGAAGGTGTTGGAGAAGGG + Intronic
1032978190 7:137249981-137250003 CTGCAGAAGGTGATGGAGATTGG - Intronic
1033446331 7:141425541-141425563 ATGCAGAAGGGAAGGATGAAAGG - Intronic
1033619980 7:143053193-143053215 TTGCAGAAGGTAAGGATAAAGGG - Exonic
1033669635 7:143478710-143478732 TTGCTGAAGATGAGGATGAAGGG - Exonic
1034697642 7:153068157-153068179 CTGCAGAAGAGGAAGCTGGAAGG + Intergenic
1035219711 7:157399032-157399054 TCTCAGAGGGTGAGGCTGAACGG + Intronic
1035287407 7:157815156-157815178 GTGAGGACGGTGAGGCTGAAGGG - Intronic
1035502321 8:99353-99375 CTGCAGAAGGTCTGGCTGGAAGG - Intergenic
1035902240 8:3469727-3469749 CTGCCTAAGGTGAGGATGTAGGG - Intronic
1035946511 8:3969280-3969302 CTGCAAAAGATGAGGCTGGGTGG + Intronic
1037319632 8:17630850-17630872 CAGGAGAAGGCGAGGCTGCATGG - Intronic
1037346285 8:17904868-17904890 CTGCAGAAGGTAATGATGGATGG + Intronic
1037411357 8:18601648-18601670 CTCCACTAGGTGAGGCTTAAAGG + Intronic
1039919689 8:41884521-41884543 CTGGAGGAGGTGAAGCTTAAAGG + Intronic
1040139350 8:43892811-43892833 CTTCATAAGCTGAGGCTGTATGG + Intergenic
1042708469 8:71688044-71688066 CAGCAGAAGGTGGGGCACAAGGG - Intergenic
1043172242 8:76979899-76979921 CTGCAGAAGCTGGCGTTGAAAGG - Intergenic
1043231568 8:77808660-77808682 CTGCAGAAGGAGTGCATGAATGG + Intergenic
1044206231 8:89494523-89494545 CTGCAGACAGCAAGGCTGAAAGG + Intergenic
1046111452 8:109730749-109730771 ATGCAGAAATTGAGGCTGAGGGG + Intergenic
1046583425 8:116122044-116122066 CTGAGGAAAGTCAGGCTGAAGGG - Intergenic
1047103226 8:121704050-121704072 CTTCAGAAGTTGAAGCTGAAAGG + Intergenic
1047605931 8:126474317-126474339 CTGCAGATGATGAAGCTGAGTGG + Intergenic
1048162896 8:132037424-132037446 CAGGAGAAGGTGAGCCAGAAGGG - Exonic
1049229373 8:141474118-141474140 CTGCTGTCGGTGAGGCTGCAGGG - Intergenic
1049346614 8:142142628-142142650 CTACAGGAGATGAGGGTGAAAGG - Intergenic
1049567508 8:143348717-143348739 CTGCAGGCTGTGAGGATGAAGGG + Intronic
1049627879 8:143634365-143634387 CTGCGGACAGGGAGGCTGAAAGG + Intergenic
1049807457 8:144547451-144547473 GAGCGGAAGGTGAGGCCGAAGGG - Exonic
1050042865 9:1514098-1514120 CTGAAGAAGGTGAGGCATAGAGG + Intergenic
1050728165 9:8676195-8676217 ATGAAGAAGGTGATGCTTAAAGG - Intronic
1051507959 9:17846201-17846223 CTGCAGAAAGAGAGGGGGAAAGG - Intergenic
1051876174 9:21796135-21796157 CTGGAGAAAGTGAGTCTTAAGGG - Intergenic
1051946203 9:22572879-22572901 CTGCTGCAGCTGTGGCTGAAAGG + Intergenic
1052769133 9:32671508-32671530 CTGCAGATGGTGAGGGTGCCAGG - Intergenic
1052954832 9:34245641-34245663 CTGCACAGGGTGGGGATGAATGG + Intronic
1052958452 9:34273537-34273559 CTGCACAGGGTGGGGATGAATGG - Intronic
1054932767 9:70653283-70653305 CTGCTGAAGGTGAGAGGGAATGG + Intronic
1057220931 9:93257394-93257416 GTAGAGAAGGTGAGGCTGGAGGG - Intronic
1059348585 9:113648945-113648967 CTGCTGGAGGGGAGGCTGAGGGG - Intergenic
1060566812 9:124599947-124599969 CTGCAGATTTTGAGGCTGAAGGG + Intronic
1061378430 9:130239979-130240001 CAGCAGAGGGTGAGCTTGAACGG + Intergenic
1061851289 9:133417606-133417628 CTGCAAGAGGTGAGGCTTGAGGG - Exonic
1061935529 9:133855486-133855508 CTGCAGGAGCAGAGGCTAAAAGG + Intronic
1062097776 9:134711831-134711853 CTGGAGAACGAGACGCTGAAAGG - Intronic
1062423711 9:136496596-136496618 CTGCACCAGGTGAGGCTGGGTGG + Exonic
1062480314 9:136747998-136748020 CTGCAGAACTGGAGGCTGGAGGG - Intronic
1203572513 Un_KI270744v1:144168-144190 CTGCAGGAGGAGAGCCTGCAGGG + Intergenic
1203606001 Un_KI270748v1:58056-58078 CTGCAGAAGGTCTGGCTGGAAGG + Intergenic
1187740551 X:22350774-22350796 AGGCAGAAGGTGAGGCACAATGG - Intergenic
1189267211 X:39726044-39726066 CTGCACACAGGGAGGCTGAATGG - Intergenic
1192800825 X:74463111-74463133 CTGCAGAGGGAGAGGATGGATGG + Intronic
1192808475 X:74529933-74529955 CTGCTGAAGGTGAGCCTCACTGG - Intronic
1193744641 X:85261094-85261116 CTGAAGAAGGAGAGGAAGAAGGG + Intronic
1195263619 X:103158927-103158949 GGGCAGAAGGTGGGGCAGAAGGG - Intergenic
1196059434 X:111391494-111391516 CAGCAGAAGATGAAGCTGAAAGG - Intronic
1197986126 X:132268333-132268355 CTGAAGAATGTGAGGAAGAATGG - Intergenic
1198087187 X:133292745-133292767 CTGCAGGAGGTGGGGCTCAGTGG + Intergenic
1202172164 Y:22061313-22061335 CTCCGGAAGCTGAGGCAGAATGG - Intergenic
1202219198 Y:22525058-22525080 CTCCGGAAGCTGAGGCAGAATGG + Intergenic
1202323981 Y:23671007-23671029 CTCCGGAAGCTGAGGCAGAATGG - Intergenic
1202388168 Y:24344493-24344515 CTGCAGAAGGTCTGGCTGGAAGG + Intergenic
1202482619 Y:25325635-25325657 CTGCAGAAGGTCTGGCTGGAAGG - Intergenic
1202546790 Y:25999047-25999069 CTCCGGAAGCTGAGGCAGAATGG + Intergenic