ID: 950009534

View in Genome Browser
Species Human (GRCh38)
Location 3:9713032-9713054
Sequence GCCCTTCAGCATCCCTGTGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 227}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950009529_950009534 29 Left 950009529 3:9712980-9713002 CCATCTGCCACAAGACAGAGGTT 0: 1
1: 0
2: 1
3: 17
4: 185
Right 950009534 3:9713032-9713054 GCCCTTCAGCATCCCTGTGCGGG 0: 1
1: 0
2: 2
3: 20
4: 227
950009530_950009534 22 Left 950009530 3:9712987-9713009 CCACAAGACAGAGGTTGTGAAAA 0: 1
1: 0
2: 0
3: 19
4: 264
Right 950009534 3:9713032-9713054 GCCCTTCAGCATCCCTGTGCGGG 0: 1
1: 0
2: 2
3: 20
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950009534 Original CRISPR GCCCTTCAGCATCCCTGTGC GGG Exonic
900644908 1:3704612-3704634 ACCCTTCACCAGCCCTGTCCGGG - Intronic
901040464 1:6360196-6360218 GACATTAAGCATCCCTGGGCGGG - Intronic
901650170 1:10738539-10738561 GCCCTGCAGCCTCCTTGTGCGGG - Intronic
903484884 1:23682283-23682305 AACCTTCAGCATCCCTGTGGAGG - Intergenic
904353147 1:29921993-29922015 GCCCTACAGCCTCCCTGGTCTGG + Intergenic
904573206 1:31483632-31483654 GCACATCAGCATCGCTGTCCAGG + Intergenic
906144438 1:43551492-43551514 TCCCTACAGCCTCCCTGAGCTGG + Intronic
906720512 1:48001040-48001062 GCCCTTTAGCAGCACTGGGCTGG - Intergenic
907089302 1:51709586-51709608 GGGCTTCAGCATCTCGGTGCAGG + Intronic
907386442 1:54128661-54128683 GCCAGTCTGCATCTCTGTGCAGG + Intergenic
908509179 1:64837552-64837574 GTCCTACAGCCTCCCTCTGCAGG + Intronic
918178550 1:182066455-182066477 GCCCTTCATCATCCTTGAGGAGG + Intergenic
918346271 1:183610108-183610130 GGACTCCAGCATCCCTGTCCAGG + Intergenic
920053728 1:203178409-203178431 GCCCTCCAGCCTCCCAGTGAGGG - Intergenic
924942101 1:248819016-248819038 GCCTTTCAGCAACCCAGTGAGGG + Intronic
1063809726 10:9691286-9691308 GCCCTCCTCCAGCCCTGTGCAGG + Intergenic
1066056084 10:31681417-31681439 GCCCTTCTCCTTCTCTGTGCAGG + Intergenic
1067166765 10:43871373-43871395 GCCCATGGGCATCCCTCTGCGGG - Intergenic
1067433075 10:46256629-46256651 GGCCTTCTGCCTCCCTGTGGTGG - Intergenic
1067782333 10:49217882-49217904 ACACTTCAGCCTCCCTGGGCAGG + Intergenic
1067983688 10:51116866-51116888 ACCCTTTGGCATCTCTGTGCAGG + Intronic
1069750736 10:70743710-70743732 GCCCTCCAGTCTCCCTGTGCCGG - Intronic
1069886056 10:71624287-71624309 CCCCTGCAGCATCCCTTTTCAGG + Intronic
1069958879 10:72068144-72068166 GCCCTTCAGCACCCCTAGCCTGG + Intronic
1071516006 10:86298482-86298504 GCACTCCAGAACCCCTGTGCTGG + Intronic
1071580003 10:86760483-86760505 TCGCCTCAGCCTCCCTGTGCTGG + Intronic
1072037294 10:91575157-91575179 GCCCTTCTGCTTCCGTGTCCTGG + Intergenic
1072826609 10:98613114-98613136 GCCCTTCAGGGTACATGTGCAGG - Intronic
1073428192 10:103469154-103469176 GACCTTCAGCATCCCCATACGGG - Intergenic
1073549043 10:104380496-104380518 GCTGTGCAGCATCCCTGGGCTGG + Intronic
1074542524 10:114376999-114377021 GCCCTTCACCTTCCCTGTGTTGG - Intronic
1074825930 10:117215967-117215989 CCGCTTCAGCATCCCTGCCCAGG - Intergenic
1076675907 10:132147653-132147675 TCCCTTCCACATCCCTGTCCAGG + Intronic
1076806445 10:132861521-132861543 GCCGCTCAGCATCCGTGTCCAGG - Intronic
1076842569 10:133052979-133053001 GCCCATCTGCTCCCCTGTGCTGG - Intergenic
1076881207 10:133240080-133240102 GCCCTTGGGCACCCCTGTCCGGG + Exonic
1077680784 11:4237974-4237996 GCCCGGCAGCCTCCCTGTCCGGG + Intergenic
1078042402 11:7880073-7880095 GCCCTTCAACATCTCTCAGCTGG + Intergenic
1078899588 11:15629155-15629177 CCCTTTCAGCATCCCTGTGAAGG - Intergenic
1078935442 11:15945424-15945446 GCCCTTCAGCATCAGGCTGCTGG - Intergenic
1079078621 11:17398509-17398531 GCCCTGGAGCCTCCCTCTGCAGG - Intronic
1079168239 11:18066962-18066984 GCCCTTCTCCATCCTTGTGGTGG - Intergenic
1079366786 11:19816852-19816874 GCCCTTCCGCCTCCCTCTTCAGG + Intronic
1079839929 11:25383421-25383443 GGTGTTCAGCATCCCTGTGCAGG + Intergenic
1080275760 11:30501945-30501967 GCCCTTCTCCATCCCTGGGGAGG - Intronic
1080686775 11:34522507-34522529 GGCCTTCAGCTTCACTGTGGGGG + Intergenic
1082084469 11:48038379-48038401 TCCCTTCAGCATCACTGGGGAGG + Intronic
1083384486 11:62297315-62297337 GCCCTTCACCATCCCTGCCTTGG + Intronic
1084954617 11:72684705-72684727 GCCCTGCAGCAGCCCCCTGCTGG - Intergenic
1085153143 11:74268196-74268218 CCCCTTCACCACTCCTGTGCAGG + Exonic
1086455909 11:86958397-86958419 GCCCCTCAGCCTCCCTCTCCTGG + Intergenic
1086523443 11:87697734-87697756 GCCATTCAGCTACCCTGTGCAGG + Intergenic
1086959967 11:92971529-92971551 TCCCTTTTGCTTCCCTGTGCTGG - Intronic
1088416604 11:109596378-109596400 GCCCTTTAGCATCCATCTGCAGG + Intergenic
1090911772 11:131127395-131127417 GCCCTTTTGCATCCATGTGTGGG + Intergenic
1091356484 11:134941621-134941643 GCCCTTCAGCTGACCTGTCCAGG - Intergenic
1091537958 12:1430876-1430898 GCCCCTCAGCATCACTCTCCAGG - Intronic
1091694831 12:2621459-2621481 GCCCTTCAGGATCACGGTGAGGG + Intronic
1096660165 12:53119201-53119223 GCCCTTCAGCACCCGTGCCCTGG + Exonic
1103848743 12:123917575-123917597 GCCCTTCAGCGTGACTGTGGGGG - Exonic
1104407494 12:128530268-128530290 GCCCTTCACCAGGGCTGTGCTGG + Intronic
1104813804 12:131634265-131634287 TCCCCTCCCCATCCCTGTGCAGG - Intergenic
1105401752 13:20102349-20102371 GCCCTTCTGCCTCCCGTTGCCGG - Intergenic
1105600058 13:21878724-21878746 GGCCATCTGCAGCCCTGTGCCGG + Intergenic
1110722997 13:78786601-78786623 GCCCCTCCTCAGCCCTGTGCAGG - Intergenic
1112998029 13:105598100-105598122 GACCTCCAGCATCCCTGTCAAGG + Intergenic
1116580749 14:46637887-46637909 GGTGCTCAGCATCCCTGTGCAGG + Intergenic
1119619085 14:76118214-76118236 CCCCTCCTGCATCCCTTTGCTGG - Intergenic
1119657412 14:76427008-76427030 CCCCTGCAGCATCTCTGTTCAGG - Intronic
1120749564 14:88185634-88185656 GTCCGTCAGCATGGCTGTGCTGG + Exonic
1122532094 14:102435370-102435392 GCCATTCATAGTCCCTGTGCTGG - Intronic
1122679913 14:103451604-103451626 GTCCTTCAGCATGTCTGTGTTGG - Intronic
1122739935 14:103866385-103866407 GACCTGCACCATCCCTGTCCAGG - Intergenic
1122816986 14:104318835-104318857 ACCCATGAGCCTCCCTGTGCAGG + Intergenic
1122978157 14:105179477-105179499 ACCCTTCAGCAGAGCTGTGCCGG + Intronic
1125380249 15:39079692-39079714 GGCCGTCAGCACCTCTGTGCTGG + Intergenic
1126798742 15:52281609-52281631 GCACTTCAGCAACCCTGGGACGG + Intronic
1129237281 15:74231303-74231325 GCCCTGCAGCCCCTCTGTGCTGG + Intergenic
1129771807 15:78207668-78207690 GTCCCTCAGCAACCCTTTGCTGG + Intronic
1132503188 16:293647-293669 TCCCTTGAGCACCCCTGGGCCGG - Exonic
1132895410 16:2226829-2226851 GCCCGTCACCATTGCTGTGCCGG - Intronic
1134270514 16:12729071-12729093 GCCTGTCACCATCTCTGTGCTGG + Intronic
1134375614 16:13670084-13670106 GCCCATCATCATCTCTTTGCTGG + Intergenic
1134816554 16:17210657-17210679 CCCCTTCAGCCTCCCAGTGCTGG + Intronic
1135591354 16:23707052-23707074 GCCATTCACCATCCCTGAGCTGG - Exonic
1136092984 16:27933936-27933958 GCCCTTCATCCTCCCCGTGGAGG - Intronic
1137257552 16:46789610-46789632 TCCCTTCAGCCTCACAGTGCTGG + Intronic
1139513453 16:67440162-67440184 GCCCCTCAGCATCACAGAGCAGG + Intronic
1139647598 16:68342790-68342812 GCCTGCCAGCATCCCTCTGCAGG + Intronic
1142305485 16:89282092-89282114 GCCCATCCGCATGCCTGTCCCGG + Exonic
1143363292 17:6388550-6388572 GCTCATCAGGATGCCTGTGCCGG - Intergenic
1143746151 17:8995710-8995732 GCCCTTCAGCTGCCCTTTTCAGG + Intergenic
1144949364 17:18985651-18985673 GCCCTTCTACAGCCCTGGGCGGG - Intronic
1145090250 17:19980123-19980145 GCCGCTCAGCCTCCCGGTGCAGG - Intergenic
1149304453 17:55334776-55334798 CCCTTTCAGCAACCCTGTGAGGG + Intergenic
1150304851 17:64075874-64075896 TCCCTTCAGCATCAATGTCCTGG - Intronic
1151384816 17:73748587-73748609 GTCCTTCAGCAGCCCGGTGAGGG + Intergenic
1151458318 17:74239720-74239742 GCCCATGAGCATCCATCTGCTGG - Intronic
1151656297 17:75497772-75497794 GCTTTTCAGCATCTCTCTGCTGG + Exonic
1153323598 18:3796121-3796143 GCCCTTCTGTATCTCTGTTCTGG + Intronic
1157133692 18:45033411-45033433 CCCTTGCAGCATCCCTGTGGAGG - Intronic
1159897241 18:74008830-74008852 ACCCTCCAGCATCCGGGTGCAGG - Intergenic
1163263016 19:16202623-16202645 GCGCATCAGAATCACTGTGCTGG - Intronic
1163415376 19:17183317-17183339 GCCCTTCTGGAACCCTCTGCTGG - Intronic
1163813625 19:19450261-19450283 GCCATTCAGCAGCACAGTGCTGG + Intronic
1164971261 19:32534716-32534738 GCCTTTAATCATCCATGTGCAGG - Intergenic
1165314029 19:35043988-35044010 ACCCTTCAGCATCTGTGTCCAGG - Intronic
1165807173 19:38587554-38587576 GCCCCCCAGCATCACTGTGTTGG + Intronic
1167371587 19:49085754-49085776 TCCCTTCTGCATCCCTTTCCCGG + Intronic
925066349 2:931792-931814 GGCCTTCAGCATCCGTGCCCAGG - Intergenic
925066366 2:931843-931865 GGCCTTCAGCATCCGTGCCCAGG - Intergenic
925066383 2:931894-931916 GGCCTTCAGCATCCGTGCCCAGG - Intergenic
925066400 2:931945-931967 GGCCTTCAGCATCCGTGCCCAGG - Intergenic
925066417 2:931996-932018 GGCCTTCAGCATCCGTGCCCAGG - Intergenic
925066433 2:932047-932069 GGCCTTCAGCATCCGTGCCCAGG - Intergenic
925066449 2:932098-932120 GGCCTTCAGCATCCGTGCCCAGG - Intergenic
925066466 2:932149-932171 GGCCTTCAGCATCCGTGCCCAGG - Intergenic
925066483 2:932200-932222 GGCCTTCAGCATCCGTGCCCAGG - Intergenic
925066500 2:932251-932273 GGCCTTCAGCATCCGTGCCCAGG - Intergenic
925066517 2:932302-932324 GGCCTTCAGCATCCGTGCCCAGG - Intergenic
925066534 2:932353-932375 GGCCTTCAGCATCCGTGCCCAGG - Intergenic
925066550 2:932404-932426 GGCCTTCAGCATCCGTGCCCAGG - Intergenic
925066567 2:932456-932478 GGCCTTCAGCATCCGTGCCCAGG - Intergenic
925066584 2:932508-932530 GGCCTTCAGCATCCGTGCCCAGG - Intergenic
926196617 2:10768029-10768051 TCCCGTCAGCAGCCGTGTGCTGG + Intronic
926518147 2:13875795-13875817 TCACTTCAGCCTCCCAGTGCTGG - Intergenic
927846006 2:26473243-26473265 GCCCTTGAACATCCGTGTGGTGG - Exonic
928949015 2:36798275-36798297 GCCCCTAAGAATCCCTGTGTTGG - Intronic
930929468 2:56862699-56862721 GGTGCTCAGCATCCCTGTGCAGG + Intergenic
932493451 2:72135233-72135255 GGGCTTCAGCATCCCTGAGGAGG - Exonic
933166899 2:79086626-79086648 GACCACCAGCATCTCTGTGCTGG + Intronic
937366348 2:121264616-121264638 GCCCACCAGCATCCCTGCCCTGG - Intronic
940744825 2:157555501-157555523 GCAGTGCAGCATTCCTGTGCTGG - Intronic
942342662 2:174964647-174964669 CCCCCTCAGAATCCCTGTGGAGG + Intronic
944785114 2:203062431-203062453 GCCCTGCAAGATCCCTGGGCAGG - Intronic
945280621 2:208032125-208032147 CCCCTTCAGCATCCCTGGCAGGG + Intergenic
947835532 2:233172198-233172220 GTCCTTGGGGATCCCTGTGCAGG + Intronic
948392623 2:237624005-237624027 GTCCTTCAGCATTCCTGGGGGGG + Intergenic
948502798 2:238407243-238407265 GCCCTTCTGTCTCCCTGTCCAGG + Intergenic
948511139 2:238466130-238466152 GCCATCCAGCATCCCTGGGAAGG + Intergenic
1168822600 20:785709-785731 GCCCTTGTTCATCCCTGAGCAGG - Intergenic
1170691082 20:18615474-18615496 GGCCTTCAGCATTCATGTGAAGG - Intronic
1171391073 20:24802111-24802133 GCCCTGCAGCAGCACTGTGTGGG - Intergenic
1171725855 20:28620425-28620447 GCCCCGCAGAACCCCTGTGCTGG - Intergenic
1172891452 20:38268759-38268781 GCCCTTCAGCCTCCCTGTTCTGG - Intronic
1173233533 20:41222040-41222062 GTCCTTCAGCATGGCTCTGCTGG + Intronic
1175233712 20:57493549-57493571 GCAATTCAGCATCTCTCTGCTGG - Intergenic
1176034597 20:63030033-63030055 GCCCTTCAGGACCCCTCTGTGGG + Intergenic
1176298093 21:5085052-5085074 GGCCTGCTGTATCCCTGTGCTGG + Intergenic
1178925112 21:36768251-36768273 TCCCTTCCGCATCCCTGTCCTGG - Intronic
1179858936 21:44176897-44176919 GGCCTGCTGTATCCCTGTGCTGG - Intergenic
1180170347 21:46055106-46055128 AACCTGCAGGATCCCTGTGCGGG - Intergenic
1180390756 22:12280031-12280053 GCCCTGCAGAAGCCCTGCGCTGG - Intergenic
1180836668 22:18933117-18933139 GTGCTTCTGCAGCCCTGTGCAGG - Intronic
1180986219 22:19905427-19905449 GCTCCTCTGCAACCCTGTGCTGG - Intronic
1181562222 22:23712216-23712238 CCTCTTCAGCCTCCCTGTGGTGG - Intergenic
1181627772 22:24133204-24133226 TCCCTACAGCATCCCGGTGGGGG + Intronic
1182477383 22:30583512-30583534 GCTCTCCTGCCTCCCTGTGCTGG - Intronic
1183279099 22:36922701-36922723 GCCCAGGAGCATCCCAGTGCGGG - Intronic
1184110061 22:42389246-42389268 GGCCTGCAGCATCCCAGGGCAGG - Intronic
1203286760 22_KI270734v1_random:158416-158438 GTGCTTCTGCAGCCCTGTGCAGG - Intergenic
950009534 3:9713032-9713054 GCCCTTCAGCATCCCTGTGCGGG + Exonic
953034038 3:39196354-39196376 GACCTGAAGCATCCCTGAGCAGG - Intergenic
953937387 3:47057287-47057309 GCCCCGCATCATCCCTTTGCTGG - Exonic
954114753 3:48460252-48460274 GCCCTTCTGCCTCCCTCTGCTGG - Exonic
954544182 3:51418756-51418778 GAGCTTCAGCTGCCCTGTGCAGG + Exonic
954821110 3:53328209-53328231 GCCCTTCAGGTTCAGTGTGCTGG - Intronic
955232006 3:57107781-57107803 GCCCTTCACCTTCTCTGTGTGGG + Intronic
956171559 3:66437514-66437536 GCCCTCCAGCACCCCTCAGCAGG + Intronic
956641943 3:71423745-71423767 GCCCTTCAGCAACCCTGGCAGGG + Intronic
957409709 3:79824105-79824127 GCACTTCAACATCTCTGGGCAGG + Intergenic
958723553 3:97876132-97876154 CCCCTTCAGCATCCTTTTGGTGG - Exonic
960580711 3:119276250-119276272 GCCCTGTAGCCTCCCTGAGCTGG - Intergenic
960962321 3:123080824-123080846 GCCCTGGAATATCCCTGTGCAGG - Intronic
961662187 3:128475341-128475363 GCCCTTCCGCATCCTAGTACTGG + Intergenic
961810892 3:129521171-129521193 GCCTCTCAGCAGCCCTGTGAAGG + Intergenic
962382453 3:134908836-134908858 GCTCTGCAGAATCCATGTGCAGG - Intronic
968175649 3:196547234-196547256 GCCCCTCAGCAGCCATGAGCAGG - Intergenic
968884216 4:3318640-3318662 ACCCATCAGCATCCCTTTGGGGG + Intronic
971590243 4:28458297-28458319 GCTCTGCAGGATCCCAGTGCTGG - Intergenic
977735858 4:100414618-100414640 GGATTTCAGCATTCCTGTGCAGG + Intronic
980050642 4:128036481-128036503 CCGCTTCAGCATCCCAGTGCTGG - Intronic
984849789 4:184143690-184143712 GCCCCTCTGCAGCCCAGTGCGGG + Intronic
986608549 5:9545927-9545949 GCCCTCCACCTTCCCCGTGCAGG - Exonic
987456168 5:18149851-18149873 GCCTGCCAGCATTCCTGTGCTGG - Intergenic
992175686 5:74146718-74146740 GCCCTTCACCATCGATGTGCAGG - Intergenic
995067438 5:107878036-107878058 ATCTTTCTGCATCCCTGTGCTGG + Intronic
998410916 5:141910533-141910555 TTCCCTCAGCATCCCTGAGCTGG + Intergenic
998783666 5:145685841-145685863 GCTCTTCAGCTTCCCTATCCTGG + Intronic
999434043 5:151549353-151549375 GACCTGCAGCAGCTCTGTGCCGG + Exonic
1002785361 6:395927-395949 GCCCTCCACCATACCTGGGCTGG - Exonic
1003762553 6:9196766-9196788 TTCCCTCAGCCTCCCTGTGCTGG - Intergenic
1005775858 6:29130115-29130137 GCCCTTGGGCAACCATGTGCAGG - Intergenic
1006417010 6:33910667-33910689 GTCCCTCAGCCTCCCTGAGCTGG - Intergenic
1006949299 6:37808405-37808427 GCACTTCAGCCTGCCTTTGCAGG - Intergenic
1007077141 6:39075130-39075152 CCCCTGCAGCACCCCTGAGCAGG + Intronic
1008128095 6:47691054-47691076 TCTCTACAGCAACCCTGTGCAGG - Intronic
1009975101 6:70663801-70663823 GGGCTTCAGCATCTCTGTGCAGG - Intergenic
1010768335 6:79801315-79801337 ATCCTGCAGCATCCCTGTACAGG - Intergenic
1011613700 6:89179013-89179035 GCCGTCCAGCATCGCAGTGCGGG + Exonic
1012588643 6:100952077-100952099 GCCTTTAATCATCCATGTGCAGG + Intergenic
1012729732 6:102866984-102867006 GCCCTTCCGAATCCCTCTGTGGG - Intergenic
1014157270 6:118125847-118125869 GCCCTCCTCCATCCCTGAGCTGG - Intronic
1017719743 6:157236191-157236213 GCCCTTCAGCAGGCCTGGGTCGG + Intergenic
1018232895 6:161692655-161692677 CCCCCTCAGCCTCCCAGTGCTGG - Intronic
1018974754 6:168556119-168556141 ACACTTCAGCTTCCCCGTGCGGG - Intronic
1019047363 6:169159403-169159425 GCCCTGCCGCATCTCTGGGCTGG + Intergenic
1020116840 7:5481009-5481031 GGCCTTCAGCTTCCCTGGGAAGG - Exonic
1022318114 7:29263902-29263924 GCCCGGCAGCCTCCCTGTCCGGG + Intronic
1023576329 7:41631464-41631486 GCTGTGCAGCATCCCTGAGCAGG + Intergenic
1024229635 7:47354417-47354439 GCCCGTGAACATCCCTGTGTGGG - Intronic
1024733118 7:52274321-52274343 CCCCCTCCGCATCCCTGTGCTGG + Intergenic
1032577732 7:133073272-133073294 GCCCTTCAGCATTGAAGTGCAGG - Intronic
1032626691 7:133598732-133598754 CCGCTTCAGCCTCCCAGTGCTGG - Intronic
1035055118 7:156030153-156030175 GCCCCTCTGCCTCCCTGTCCTGG + Intergenic
1035743202 8:1944321-1944343 GCCCTGCAGCGCCCCTGTGTAGG + Intronic
1035997413 8:4563481-4563503 CCCGTTCAGTATTCCTGTGCCGG + Intronic
1037963435 8:23116431-23116453 GCCCCTCAGCCTCCCTGCTCTGG - Intronic
1038395450 8:27242655-27242677 GCTGTTCAGGATCCCTGTGTGGG + Intronic
1040849524 8:51884666-51884688 GCACTGCAGCATCCTCGTGCTGG - Intronic
1042723078 8:71844630-71844652 GCCCTTCAACATGTCTGCGCAGG + Intronic
1044480651 8:92683521-92683543 GCTCTTCAGCAGTCCTGGGCAGG - Intergenic
1046813845 8:118562358-118562380 GCCTTTCAGCACCCCTCTTCTGG - Intronic
1048013728 8:130479614-130479636 CCCCTGCAACATCCCTGTGATGG + Intergenic
1048030753 8:130629429-130629451 GCCCTTCTGCATGACTGTGCTGG + Intergenic
1049377409 8:142295842-142295864 GCCCTGCAGCATGGCTCTGCAGG + Intronic
1049396753 8:142404489-142404511 GCCCACCAGCATTCCTGGGCTGG + Intergenic
1050587688 9:7130083-7130105 GACTTTCACCAGCCCTGTGCAGG + Intergenic
1051602574 9:18889823-18889845 GCCCTTCAGTAGCACTGTGCAGG + Intronic
1053100028 9:35363944-35363966 GCCATTCAGCATCCTGGTCCTGG + Intronic
1056299024 9:85222732-85222754 GACCGTCAGCATCCCTGAGCTGG + Intergenic
1056436375 9:86578956-86578978 GCCCCTTTGCCTCCCTGTGCTGG + Intergenic
1058608707 9:106751956-106751978 GCCCTTCATCATGCCTCTCCAGG - Intergenic
1059281719 9:113139783-113139805 GTCCCACAGAATCCCTGTGCAGG + Intergenic
1060600384 9:124873514-124873536 GCCCTGCAGCCTCCCTGTGCAGG + Intronic
1061323704 9:129849185-129849207 CCCCTCCAGCAGACCTGTGCAGG + Intronic
1061629903 9:131865718-131865740 GCCTTTCAGCAGCCATGTGCAGG + Intronic
1061737443 9:132670844-132670866 GGCCCGCAGCATCGCTGTGCTGG + Exonic
1203451404 Un_GL000219v1:120555-120577 GCCCTGCAGAACCCCTGCGCTGG - Intergenic
1187398296 X:18937095-18937117 GCCCCCCAGCATTCCTGAGCAGG + Intronic
1187485127 X:19695839-19695861 GCCATTCAGTCTCCCTGTGTGGG - Intronic
1188113685 X:26219729-26219751 GCCTTTAATCATCCATGTGCAGG - Intergenic
1189393886 X:40602832-40602854 GCCTTTCTGTTTCCCTGTGCTGG - Intronic
1189883799 X:45519101-45519123 GCAGTTCAGCATCCATGTCCAGG - Intergenic
1190686235 X:52876301-52876323 GCCCTTCAGCCTCCTAATGCAGG + Intergenic
1190699333 X:52975146-52975168 GCCCTTCAGCCTCCTAATGCAGG - Intronic
1191720674 X:64225941-64225963 ATCCTTCAGAATCCCTGAGCAGG - Intronic
1191959150 X:66680345-66680367 GCCCTTCAGGAGCACTGGGCTGG - Intergenic
1196606211 X:117660325-117660347 CCACTTCAGCCTCCCAGTGCTGG + Intergenic
1199700253 X:150370599-150370621 GGGCTTCAGCAGCCCTGGGCTGG - Intronic