ID: 950012061

View in Genome Browser
Species Human (GRCh38)
Location 3:9731225-9731247
Sequence GGGGCTTGTGGGAGGGGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1730
Summary {0: 1, 1: 1, 2: 13, 3: 144, 4: 1571}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950012061_950012078 14 Left 950012061 3:9731225-9731247 CCCCGCCCCCTCCCACAAGCCCC 0: 1
1: 1
2: 13
3: 144
4: 1571
Right 950012078 3:9731262-9731284 TCTAGTCTCCAGCCCCGCCCCGG 0: 1
1: 0
2: 2
3: 16
4: 163
950012061_950012070 -9 Left 950012061 3:9731225-9731247 CCCCGCCCCCTCCCACAAGCCCC 0: 1
1: 1
2: 13
3: 144
4: 1571
Right 950012070 3:9731239-9731261 ACAAGCCCCGCCCCACAGACCGG 0: 1
1: 0
2: 1
3: 22
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950012061 Original CRISPR GGGGCTTGTGGGAGGGGGCG GGG (reversed) Intergenic
900094774 1:935910-935932 GGGGCCTGAGGGCGGGGTCGGGG + Intronic
900245103 1:1632927-1632949 GGGCCCCGGGGGAGGGGGCGCGG + Intronic
900256334 1:1700086-1700108 GGGCCCCGGGGGAGGGGGCGCGG + Intronic
900339442 1:2181095-2181117 GTGGCTTGGTGGAGGTGGCGGGG - Intronic
900344656 1:2205088-2205110 GGGGCTTGAGGGGCGGGGCGTGG - Intronic
900344674 1:2205125-2205147 GGGGATTGAGGGGTGGGGCGTGG - Intronic
900462622 1:2808841-2808863 GGTGCTGGTGGGAAGGGGGGCGG + Intergenic
900539473 1:3195723-3195745 AGGGCTTCTGCGTGGGGGCGTGG + Intronic
900596363 1:3481893-3481915 AGGGCTTAGGGGAGGAGGCGAGG + Intergenic
900610351 1:3542071-3542093 GGGGGTTGGGGGAGGCGGCCAGG - Intronic
900626465 1:3610909-3610931 GGGGAGAGTGGGAGGGGGGGAGG + Intronic
900685316 1:3944481-3944503 GGGGCATGTGGGAGGGACAGAGG - Intergenic
900766337 1:4508407-4508429 GGGGGTTGTGGGTGGGGGGAGGG + Intergenic
900950569 1:5856150-5856172 GGGGCTTGAGGGAAGGAGTGTGG - Intergenic
900979942 1:6040652-6040674 GGGGCCTGGGTGAGGGGGCAGGG - Intronic
900987149 1:6079703-6079725 GGGGCTGGAGGCAGGGAGCGGGG + Intronic
900992001 1:6102392-6102414 GAGACTTGGGGGAGGGGCCGAGG + Exonic
900997343 1:6129794-6129816 GGGGCCTGTTGGAGGTGGAGGGG - Intronic
901012366 1:6209048-6209070 GGGACTTGGGGGTGGGGGCGGGG + Intronic
901021940 1:6260377-6260399 GGGGATTGCGGGGGGGGGGGGGG - Intronic
901037011 1:6342302-6342324 GGGGCCTTTGGGAGGTGACGAGG - Intronic
901156125 1:7140406-7140428 AGGGCTTGGGGGAGGGGTGGAGG - Intronic
901215076 1:7550608-7550630 GGGCCAGGTGGGAGGGGGCCAGG - Intronic
901426813 1:9186951-9186973 GGTGTGTGTGGGGGGGGGCGGGG + Intergenic
901656659 1:10773390-10773412 GTGGGCTGGGGGAGGGGGCGGGG + Intronic
901791344 1:11654976-11654998 GGGGCGCTGGGGAGGGGGCGCGG + Intronic
901874560 1:12159906-12159928 GGGGCGGGGGGGCGGGGGCGGGG + Intergenic
901930955 1:12595846-12595868 GGGGCTGGGCGGAGGGGGTGAGG + Intronic
902055248 1:13595440-13595462 GGGTCTTGGGGGTGGGGGGGAGG - Intronic
902072129 1:13749298-13749320 GGCGGTTGTTGGCGGGGGCGGGG - Intronic
902083821 1:13840806-13840828 TGGGGTTGGGGGAGGGGGCAGGG + Intergenic
902120453 1:14160451-14160473 GGGGCTGGAAGGAGGGGGCTTGG + Intergenic
902196268 1:14800870-14800892 GGGGACTGTGGGAGGGGAAGTGG + Intronic
902375143 1:16026939-16026961 GGGGCGGGTGGTTGGGGGCGTGG + Intronic
902643092 1:17779221-17779243 AGGGGTTGTGGGAGGGAGAGGGG - Intronic
902686675 1:18081822-18081844 GGGGCTTGTGGGGTGGGGGGTGG + Intergenic
902798455 1:18814771-18814793 GGGGCTGGTGGGTTGGGGAGGGG - Intergenic
902843588 1:19092085-19092107 GGGGCTTGTGGCAGGGGAGCAGG + Intronic
902901071 1:19516562-19516584 GGGCCTGGTGGGAGGGTGAGTGG - Intergenic
902995813 1:20223803-20223825 GGGGTTGGTGGGGGGAGGCGGGG - Intergenic
903004171 1:20287700-20287722 AGGGCCTGTGGGTGGGGGTGAGG - Intergenic
903304244 1:22401485-22401507 GGGGCCGGTGGGTGGGGGCTCGG - Intergenic
903323253 1:22554982-22555004 GTGACTTGTGTGTGGGGGCGGGG - Intergenic
903325667 1:22567334-22567356 CTGGCTGGTGGGAGGGGGAGGGG - Intronic
903337879 1:22636891-22636913 AGGGCTTGGGGGAGGGTGAGAGG + Intronic
903413854 1:23168351-23168373 TGGGGTTGGGGGAGGGGGCGCGG - Intronic
903907223 1:26695976-26695998 GAGGCGAGGGGGAGGGGGCGGGG - Intergenic
904494516 1:30879103-30879125 GGGGCATGTGTGAGCAGGCGAGG + Intronic
904699793 1:32351534-32351556 GGGGCCTATGCGAAGGGGCGAGG - Intronic
904824944 1:33268281-33268303 GGGACTTGGAGGAGGGGGAGGGG + Intronic
905242510 1:36589951-36589973 GGGGCTGGTGGGAGAGGGTTGGG + Intergenic
905461531 1:38125914-38125936 GTGGAGTGTGGGAGGGGACGGGG + Intergenic
905465965 1:38153551-38153573 GGGATTTGGGGGAGGGGGAGGGG - Intergenic
905776147 1:40668479-40668501 GGGGGTTGTGGGCGGGGGGGGGG + Intergenic
905796467 1:40819053-40819075 GGGACTTGGGGGACGGGGCAAGG + Intronic
905974860 1:42167700-42167722 AGGGCAGGTGGGAGTGGGCGTGG + Intergenic
906097862 1:43236256-43236278 GGGGTGTGTGGCAGGGGGTGCGG + Intronic
906187390 1:43871895-43871917 GGGGTTTGTGGGAGGGAGGAGGG + Intronic
906210565 1:44010444-44010466 GAGCCTTGTGGGCGGGGGGGGGG + Intronic
906273780 1:44501153-44501175 TGTGCTTGGGGGAGGGGGTGGGG + Intronic
906279473 1:44543318-44543340 GGGGCTGGGGGGAGGGGAGGGGG + Intronic
906283448 1:44569709-44569731 GGGTCTGGTGGGAAGGGGTGTGG + Intronic
906711584 1:47934333-47934355 AGGGACTGTGGGAGGGGGTGTGG - Intronic
907050351 1:51326005-51326027 GGTGCTTGTGGGAGGGAAGGAGG - Intronic
907179055 1:52553524-52553546 GGGGCTCGCGGGCAGGGGCGGGG + Intergenic
907217438 1:52877116-52877138 GGGGCTGGGGGGAGAGGGGGAGG - Intronic
907239708 1:53074675-53074697 GGGGCTTGAGGCAGGGTGGGGGG + Intronic
907276814 1:53321399-53321421 GGGGTCTGTGGGAGGGTGTGGGG - Intronic
907506453 1:54922394-54922416 GGGGCCTGTTGGAGGGTGAGAGG - Intergenic
907729294 1:57050276-57050298 GTGGCTTGTGGCAGGTGGCTTGG - Intronic
907930002 1:58990526-58990548 GGGGGTGGTGGGCAGGGGCGGGG - Intergenic
908038892 1:60086109-60086131 GGGAAGTGTGGGAGGGGGTGAGG + Intergenic
908108861 1:60874903-60874925 GAGGCCAGAGGGAGGGGGCGGGG - Intronic
908544402 1:65148911-65148933 GGGACTCGGGGGAGGGGGCCAGG - Intronic
908827957 1:68151724-68151746 GGGGCTGGTGGGTGGTGGAGAGG + Intronic
909218111 1:72918040-72918062 GGGGCTGGAGGGAGGGGAGGGGG + Intergenic
909523756 1:76599450-76599472 GGGGCCTGTCGGAGGGTGGGGGG - Intronic
909585364 1:77282443-77282465 GGGGAAGGTGGGACGGGGCGCGG - Intronic
910096940 1:83533943-83533965 GGGGCCTGTTGGAGGGTGGGAGG - Intergenic
911111655 1:94194630-94194652 GGGGCTTTTGGGAGGTGACTAGG - Intronic
911260186 1:95676832-95676854 GGAGCTTGTGGGAGGAGGTTGGG + Intergenic
911348215 1:96721997-96722019 GGGGTGTGTGCGATGGGGCGGGG - Intronic
911444993 1:97981514-97981536 GGGGCCTGTTGGAGGGTGAGGGG - Intergenic
911852442 1:102836421-102836443 GGGGCTTGTGGCAGGGTGGGGGG + Intergenic
911995222 1:104758083-104758105 GGGGGATGGGGGAGGGGGTGGGG + Intergenic
912212585 1:107570993-107571015 GGGGCTGGCGGGCGGGGGGGTGG + Intergenic
912397249 1:109355643-109355665 TGGGTTTGTGGGGGGGGGGGCGG - Intronic
912430332 1:109625358-109625380 AGTGCTTGAGGCAGGGGGCGGGG - Exonic
912562712 1:110561913-110561935 GGGGCCTCTGGGAAAGGGCGAGG - Intergenic
912654854 1:111477114-111477136 GTGGGTTGAGGGAGGGGGAGAGG + Intronic
912659271 1:111513937-111513959 GGAGCTGGTGGGAGGGGCTGTGG + Intronic
912758126 1:112341963-112341985 GGGGCATGTGGTAGGAGGGGAGG + Intergenic
912906954 1:113717838-113717860 GTGGGTTGTGGGAGGGGCCCAGG - Intronic
913455503 1:119026479-119026501 TGGGGTTGGGGGAGGGGGCAGGG + Intergenic
913530751 1:119732749-119732771 GGGGCTGGAGGGAGGGGGTTGGG - Intronic
913937267 1:125066056-125066078 GCGGCTTGGGAGAGGGGCCGCGG - Intergenic
914200037 1:145476208-145476230 GGGGCTGGAGGGCGGGAGCGGGG + Intergenic
914479155 1:148049343-148049365 GGGGCTGGAGGGCGGGAGCGGGG + Intergenic
914676871 1:149912781-149912803 GGTGGTTGGGGGAGGGGGGGAGG - Intronic
914687207 1:149991213-149991235 GGGGTTGGTGGGAGGTGGGGAGG - Intronic
914919736 1:151838876-151838898 GGCGCTTGTGGGCGGGCCCGGGG + Exonic
915109286 1:153552911-153552933 GGGGCTTCAGGGAGGGCGGGAGG + Intergenic
915309507 1:155000205-155000227 GGGTTTCATGGGAGGGGGCGGGG + Intergenic
915309604 1:155000651-155000673 GGGGCGGGGGGCAGGGGGCGGGG - Intergenic
915325905 1:155081014-155081036 GTGACTAGGGGGAGGGGGCGCGG - Intronic
915458199 1:156053998-156054020 GGGGCCTCTGGGAGGGGGAAGGG + Intergenic
915509390 1:156378203-156378225 GGAGCGTGGGGGTGGGGGCGGGG + Intronic
915528492 1:156490276-156490298 GGCTGCTGTGGGAGGGGGCGGGG - Intronic
915571441 1:156747246-156747268 GGGGCGGGGGGGGGGGGGCGGGG - Intronic
915692837 1:157707304-157707326 GGGGCCTGTTGGAGGGTGGGGGG + Intergenic
915722279 1:157993877-157993899 GAGCCCTGGGGGAGGGGGCGCGG + Intronic
916058710 1:161084861-161084883 GGGGCTAGGGGGAGGGGTCCAGG + Intronic
916293069 1:163187680-163187702 GAGGCATGGGGGAGGGGGTGCGG - Intronic
916830432 1:168485391-168485413 GGGGGTGGTGGGGGGCGGCGTGG + Intergenic
916916639 1:169413858-169413880 GGGGCCTGTCGGAGGGTGGGGGG + Intronic
917242284 1:172961384-172961406 GGGGCCTGTCGGAGGGTGAGAGG - Intergenic
917490496 1:175494142-175494164 GAGGCCGGCGGGAGGGGGCGGGG - Intronic
917511919 1:175675837-175675859 GGGGCTTCTGGGAGGACGCTGGG + Intronic
917576924 1:176332994-176333016 TGGGCTTGGGGGAGGGGGTAGGG - Intergenic
918066521 1:181105360-181105382 CGGGCTGGAGGGCGGGGGCGGGG + Intergenic
918180348 1:182081754-182081776 GGGGGTGGTGGGGGGGGGTGGGG + Intergenic
918447782 1:184632218-184632240 GGGTCTGGTGGGTGGGGGGGGGG - Intergenic
918627232 1:186670145-186670167 GGGGCTTGTCGAAGGGTGGGGGG + Intergenic
918975317 1:191476369-191476391 GGGGCTTGTCGGAGGGTGGAGGG + Intergenic
919299467 1:195742029-195742051 GGGGGTGGGGGGAGGGGGGGCGG + Intergenic
919302439 1:195787995-195788017 GGGGCTTATTGGAGGGTGCAGGG - Intergenic
919368306 1:196694157-196694179 GGGGCTTGTTGGGGTGTGCGGGG - Intronic
919556332 1:199058567-199058589 GGGAATGGTGGGAGGGGTCGAGG + Intergenic
919686577 1:200488571-200488593 GTGGCCTGAGGGATGGGGCGAGG + Intergenic
919816355 1:201443118-201443140 AGGGGCTGGGGGAGGGGGCGTGG + Intergenic
920102422 1:203525684-203525706 GGGGCTTGGGGATGGGGGTGAGG + Intergenic
920172914 1:204082671-204082693 GGGGCTTGTGGGGCAGGGAGAGG + Intronic
920193619 1:204211728-204211750 GGGGATTGTGGGTGGGGAAGCGG + Intronic
920273435 1:204785030-204785052 GGGGCCTGTCGGTGGGGGCAAGG - Intergenic
920364499 1:205440896-205440918 GGGGCTTGATGGAGGGGCCCTGG + Intronic
920451055 1:206061474-206061496 GAGGGTGGTGGGAGGAGGCGGGG + Intronic
920572127 1:207025075-207025097 TGGGGTTGGGGGCGGGGGCGGGG + Intronic
920632974 1:207670189-207670211 GTGGCTTGGGGTAGGGGACGAGG - Intronic
920993880 1:210968008-210968030 TGGGGTGGTGGGAGGGGGCGGGG - Intronic
921217731 1:212951455-212951477 GGGGCGTGTGCGCGCGGGCGCGG - Exonic
921326228 1:213988268-213988290 GGGGCGAGTGGGAGAGGGAGAGG - Exonic
921334047 1:214068265-214068287 GGAGCCTGTGGGAGGGTGGGAGG + Intergenic
921449459 1:215287683-215287705 GAGGGTTGTGGGAGGTGGAGGGG + Intergenic
922806703 1:228394077-228394099 GGGGCTTCTGGGAGGTGCCTGGG - Exonic
922937198 1:229431956-229431978 GGGGCCTGGGGGCCGGGGCGAGG + Intronic
923325553 1:232877209-232877231 GTGGCCTGTGGGAGGGGGAATGG - Intergenic
923340611 1:233003991-233004013 GGGGCCTGTTGGAGGGTGAGGGG + Intronic
923525486 1:234769423-234769445 GGGGCATGTGGTAGGGAGAGAGG - Intergenic
923526838 1:234779087-234779109 GGGGCCGGTGGGGGGGTGCGGGG + Intergenic
924452521 1:244190944-244190966 GGGGGTGGGGGGGGGGGGCGGGG + Intergenic
924588608 1:245381729-245381751 GGGGCTGGTGGGAGGGAGAATGG - Intronic
924744250 1:246818003-246818025 GGGGGTTGGGGGAGGGGCAGCGG + Intergenic
924824807 1:247528185-247528207 GGGGCTTGGGGGTGGGGGAAGGG - Intronic
924945406 1:248843065-248843087 GGGGCCTTTAGGAAGGGGCGGGG + Intronic
1062800836 10:379191-379213 AGGGGTTGTGGGGGGGGGGGGGG - Intronic
1063275741 10:4565739-4565761 GGGGCGGGTGGGAGGAGGCGGGG + Intergenic
1063463581 10:6229409-6229431 GCGGCTTCTGGGAGTGGGCTGGG + Intronic
1063505581 10:6595205-6595227 TGGGCTTGGGGGAGGGGTTGAGG - Intergenic
1063593675 10:7413281-7413303 GGGGCTTGGGGTAGGGGTAGGGG + Intergenic
1064232792 10:13544248-13544270 GGTGCATGTGGGAAGGGGCATGG + Intergenic
1064235251 10:13567917-13567939 GGGGCCTGTCGGAGGGTGGGGGG + Intergenic
1064576943 10:16756174-16756196 GGGGCTGGAGGGAGGGGGAATGG + Intronic
1064639659 10:17402763-17402785 GGGGCTTGTTGTTGGGGTCGGGG + Intronic
1064711993 10:18137829-18137851 GGGAAGTGTGGGAGGGGGCACGG - Intergenic
1064767784 10:18692704-18692726 GGGGGTTGTGGGGGCAGGCGCGG - Intergenic
1064982127 10:21174715-21174737 GAGGCCCGTGGGAGCGGGCGCGG - Intergenic
1065013761 10:21442835-21442857 GGGGCTTGTGGGGTGGGGGGTGG - Intergenic
1065034255 10:21621616-21621638 TGGGATTGGGGGCGGGGGCGGGG - Intronic
1065354288 10:24824287-24824309 GGGGCTGGTTGGAGGGGAGGAGG - Intergenic
1065367932 10:24952907-24952929 GGGGCTTGGCGGCGGGGCCGGGG - Intergenic
1065874707 10:29987076-29987098 GGGAAAGGTGGGAGGGGGCGAGG - Intergenic
1066148788 10:32592701-32592723 GGGGCTTGTCGGGGGGTGTGGGG - Intronic
1066180612 10:32958015-32958037 CGGGCGTGGGGGTGGGGGCGGGG - Intronic
1066181084 10:32961398-32961420 GGGGCTGGGGGTCGGGGGCGGGG - Intronic
1066288191 10:33988974-33988996 GGGGCTTGTCAGAGGGTGGGGGG - Intergenic
1066656453 10:37702777-37702799 GGGGCATTTGGGAGGTGGTGAGG - Intergenic
1067049076 10:43001624-43001646 GGAGCCTGTGGGAGGTGGCGTGG - Intergenic
1067078991 10:43203213-43203235 GGGGCTGGAGGCATGGGGCGGGG - Intronic
1067217692 10:44316575-44316597 GGGGCTGGTAGGAAGGGCCGAGG - Intergenic
1067217716 10:44316650-44316672 GGGGCTGGTGGGAGGGGACAAGG - Intergenic
1067217744 10:44316726-44316748 AGGGCTGGTGGGAGGGGCAGAGG - Intergenic
1067217777 10:44316802-44316824 AGGGCTGGTGGGAGGGGCTGAGG - Intergenic
1067542412 10:47165663-47165685 GGGGCATGTGGGAAGGGCCCAGG - Intergenic
1067684080 10:48456908-48456930 GGTGCTTGTTGGAGGGGGGAAGG - Intronic
1067704425 10:48596436-48596458 GGGGCTGGCTGGAGGGGGCAGGG + Intronic
1068513403 10:57995226-57995248 GGGGCTTGTCGGAGGGGGTGGGG + Intergenic
1068621163 10:59184790-59184812 TGGGGTTGGGGGAGGGGGGGAGG - Intronic
1069151722 10:64969777-64969799 GGGGCCTGTGGGTGGGTGGGGGG + Intergenic
1069774257 10:70917717-70917739 GGGGCCAGAGAGAGGGGGCGGGG - Intergenic
1069820895 10:71227416-71227438 GGGAAATGTGGGAGGGGGTGAGG + Intronic
1070065231 10:73027437-73027459 GGGGCCTGTCGGAGGGTGGGGGG + Intronic
1070290207 10:75108967-75108989 GGGGCATGGGGGTGGGGACGTGG - Intronic
1070318995 10:75340152-75340174 GGGGCCGGGGGGAGGGGGCGGGG + Intergenic
1070683849 10:78467606-78467628 GGGGCTTGGTGGAGGAGGGGGGG + Intergenic
1070785904 10:79162147-79162169 GGGGCTGGCGGGAGGTGGCTGGG + Intronic
1071184296 10:83023079-83023101 GGGGCCTGTTGGAGGGTGGGGGG + Intergenic
1071519360 10:86319523-86319545 GGGGCCTGGGGCAGGGGGAGGGG - Intronic
1071601056 10:86958909-86958931 AGGCATTTTGGGAGGGGGCGAGG + Intronic
1071629219 10:87204396-87204418 GGGGGTGGTGGGAGGGGGGAAGG + Intergenic
1072019169 10:91381553-91381575 GGGGCTGGTGGGGGGTGGTGGGG - Intergenic
1072221831 10:93333501-93333523 AGGGGTGGTGGCAGGGGGCGGGG + Intronic
1072613648 10:97035413-97035435 GGAGCCTGGGGGATGGGGCGTGG - Intronic
1072667004 10:97401002-97401024 GGGGCCTCTGGGAGAGTGCGGGG - Intronic
1072791498 10:98321412-98321434 GGGGCTTGTGGGCCGTGGTGAGG - Intergenic
1073076383 10:100827743-100827765 GGGGGTCGTGGGATGGGGTGAGG - Exonic
1073135217 10:101216444-101216466 TGGGCCTCGGGGAGGGGGCGGGG - Intergenic
1073289997 10:102408821-102408843 GCGGCTTGTGGGAGGCACCGAGG - Intronic
1073428079 10:103468487-103468509 GAGGCATGTGGGATGGGGAGAGG - Intergenic
1073432303 10:103494343-103494365 GGCGCTCGCGGGTGGGGGCGAGG - Exonic
1073474816 10:103745938-103745960 TGGGCGTGTGGGAGAGGGAGTGG - Intronic
1073543181 10:104328627-104328649 GGGGAAAGTGGAAGGGGGCGGGG - Intronic
1073933741 10:108605499-108605521 GGGACTTGTCGGTGGGGGTGGGG - Intergenic
1074100708 10:110352881-110352903 GGAGCTTGTGGGGGTGGGAGGGG + Intergenic
1074361282 10:112825537-112825559 GGGGCCTGTGGGAGGATGCCTGG + Intergenic
1074502990 10:114043521-114043543 GGGGGCTGAGGGAGGGGACGGGG + Intergenic
1074801548 10:117005387-117005409 CGCGCTGGTGGGAGGGGGGGCGG + Exonic
1074831967 10:117255541-117255563 GGGCCCTGGGGGAGGGGGCATGG + Intronic
1074888613 10:117715797-117715819 GGGGCTTGTTGGGGGGTGAGGGG + Intergenic
1075608281 10:123831967-123831989 GGGGGTTGTGGGGGCGGGGGTGG + Intronic
1075747325 10:124736829-124736851 GCAGCTTCTAGGAGGGGGCGTGG - Intronic
1075753274 10:124791480-124791502 GGGGCTTGTGGGTGCGGGACAGG - Intronic
1075788987 10:125069885-125069907 GGGGTTTGTGTGGGGGGGGGAGG - Intronic
1075855303 10:125624774-125624796 GGGTTTTGTGAGAGGGGGCTCGG + Intronic
1075922704 10:126226184-126226206 GGTGGTGGGGGGAGGGGGCGGGG + Intronic
1076314625 10:129531771-129531793 GGGGCTGGTGGGGGTGGGGGGGG + Intronic
1076360731 10:129887042-129887064 GGGGGTTGTGGGCGGGGGGGGGG + Intronic
1076397495 10:130151523-130151545 GGGGCCTGTTGGAGGGTGGGGGG - Intronic
1076494620 10:130888973-130888995 GAGGTTTGGGGGAAGGGGCGGGG + Intergenic
1076567421 10:131408369-131408391 AGGACCTGTGGGAGGGGGCCAGG + Intergenic
1076668161 10:132104590-132104612 GGGGCTTGTGTGCCGGGGCAGGG - Intergenic
1076707101 10:132308003-132308025 GGGGCTTCTGGAAGGGGCGGGGG + Intronic
1076722551 10:132399045-132399067 GGGAGATGAGGGAGGGGGCGGGG - Intronic
1076724619 10:132407628-132407650 GTGGCTGGAGGGAGGGGGTGAGG - Intronic
1076799040 10:132812257-132812279 GGGGCTTTTGGCAGGAGGTGGGG - Intronic
1076804514 10:132848544-132848566 ATGGGTTGTGGGAGGGGGTGGGG + Intronic
1076830575 10:132992341-132992363 GGGGGCGGGGGGAGGGGGCGGGG + Intergenic
1076839854 10:133040611-133040633 GGGGCAGGTGGCAGGGGGGGGGG + Intergenic
1076871801 10:133198210-133198232 GGGCCATGCGGGAGGGGACGCGG + Intronic
1076897326 10:133319011-133319033 GGAGCCTGTGGGAGGAGGTGTGG + Intronic
1076905272 10:133358042-133358064 GGGGCTTGGGGGCCGGGGCGGGG + Intergenic
1076905290 10:133358080-133358102 GGGGCTTGGGGGCAGAGGCGGGG + Intergenic
1076948522 10:133666824-133666846 GGGGGTGGTGGGGGAGGGCGTGG - Intergenic
1076951480 10:133676732-133676754 GGGGGTGGTGGGGGAGGGCGTGG - Intergenic
1076952470 10:133680042-133680064 GGGGGTGGTGGGGGAGGGCGTGG - Intergenic
1076955426 10:133743003-133743025 GGGGGTGGTGGGGGAGGGCGTGG - Intergenic
1076956416 10:133746313-133746335 GGGGGTGGTGGGGGAGGGCGTGG - Intergenic
1076957404 10:133749622-133749644 GGGGGTGGTGGGGGAGGGCGTGG - Intergenic
1076959377 10:133756231-133756253 GGGGGTGGTGGGGGAGGGCGTGG - Intergenic
1076993901 11:289278-289300 GGGGCTGGGGGGACGGGCCGGGG - Intronic
1077027304 11:446586-446608 CTGGCTTGTTGGAGGGAGCGTGG - Intergenic
1077038631 11:507456-507478 GGGGCTTGGTGCCGGGGGCGGGG + Intergenic
1077077710 11:708921-708943 GGGGGTTGGGGGAGGGCGGGTGG - Intronic
1077121393 11:910591-910613 GGGGCGTGTGAGAGGGTGTGAGG - Intronic
1077142072 11:1029144-1029166 GGGGGCTCTGCGAGGGGGCGGGG + Exonic
1077166045 11:1139302-1139324 GGGGGTGGTGGGAGGAGGCGGGG + Intergenic
1077204710 11:1336783-1336805 GGGGCGTGGGGGCGGGGGCGGGG + Intergenic
1077247921 11:1548143-1548165 GGGGCTTGACGGAGGGAGTGGGG + Intergenic
1077297962 11:1834847-1834869 GGGGCTGCTGGGAGGTGGCTGGG + Intronic
1077310642 11:1887533-1887555 GGTGCTTGTGGAAGGGGGCCCGG + Exonic
1077311028 11:1889214-1889236 GCGGACTGTGGGAGGGGGCCGGG + Exonic
1077419798 11:2444883-2444905 GGGGCGTGCAGGCGGGGGCGGGG + Intronic
1077433296 11:2526547-2526569 GGAGCTTGGGGAAGGGGGTGGGG + Intronic
1077460945 11:2709225-2709247 GGGGCTGGGGGGTGGGGGTGGGG - Intronic
1077487337 11:2845188-2845210 GGGGCCTCTGGGAGGGGGACCGG - Intronic
1077889722 11:6410584-6410606 TGGGCATGTGGGAGGGTGTGAGG - Intronic
1078003133 11:7513671-7513693 GGGGCTCCCGGAAGGGGGCGCGG + Intronic
1078852780 11:15179555-15179577 GGGGCCTGTGGGAGGAGTGGGGG - Intronic
1079035197 11:17014426-17014448 GGGGTGGGGGGGAGGGGGCGGGG + Intronic
1079346102 11:19653879-19653901 GGGGAGTGTGGGAGGTGGAGTGG - Intronic
1079451240 11:20601439-20601461 GGAGCTCCCGGGAGGGGGCGAGG - Exonic
1079638071 11:22770136-22770158 GGGGCCTGTGGGAGTAGGGGAGG + Intronic
1080044747 11:27797191-27797213 GGGGCTTGTGGGAGAGGCAGTGG + Intergenic
1080466708 11:32504132-32504154 GGGGCATGGGGGAGGGAGGGAGG + Intergenic
1080513144 11:32995181-32995203 GGGGCTTGTTGGAGGGTGGGTGG - Intergenic
1080932590 11:36828235-36828257 GGGGCTTGTTGGCGGGTGGGGGG - Intergenic
1081047643 11:38296323-38296345 GACGCGTGGGGGAGGGGGCGTGG + Intergenic
1081480146 11:43478730-43478752 GGGGGTTGCGGGATGGGGCAGGG - Intronic
1081508022 11:43738377-43738399 GGGACCTGTTGGAGGGGGTGGGG - Intronic
1081758695 11:45562132-45562154 AGGGCTAGTGGGGCGGGGCGGGG + Intergenic
1081789963 11:45775550-45775572 GGGGCTTGGGGGAGAGGGGAAGG - Intergenic
1081831601 11:46120385-46120407 GGGGGCTGCGGGCGGGGGCGGGG - Intronic
1081870767 11:46381629-46381651 GGGGGTGGGGAGAGGGGGCGGGG + Intronic
1081875833 11:46407845-46407867 GGGGCTGGAGGTAGGGGGTGAGG + Intronic
1081994658 11:47355559-47355581 GGGCCCGGTGGGAGGGGGCCCGG + Intronic
1082009690 11:47441781-47441803 GGGGCTGGGGGCAGGGGGCAGGG - Intronic
1082740701 11:56907887-56907909 GGGGCCTGTTGGGGGGTGCGGGG - Intergenic
1082767356 11:57180298-57180320 GGGGCCTGTGGGAGTGCGAGGGG + Intergenic
1082828412 11:57597971-57597993 GGAGGTGGTGGGAGGGGGAGGGG - Intronic
1082986129 11:59172476-59172498 GGGGCGCGGGGCAGGGGGCGCGG + Exonic
1082997813 11:59266990-59267012 GGGGCCTGGGGGTGGGGGCAGGG - Intergenic
1083120634 11:60509631-60509653 TGGGCATGAGGGAGGGGGAGGGG - Intergenic
1083267628 11:61554076-61554098 GGGGATTGTGGGGAGGGGCTGGG + Intronic
1083290814 11:61688989-61689011 TGGACTTGTGGGTGGGGGCAAGG + Intronic
1083326565 11:61876072-61876094 GGGGCCAGTGGGAGGTGGGGAGG - Intronic
1083544404 11:63538043-63538065 GGGGTTTGAGGGAGGGGAAGAGG + Intronic
1083583233 11:63838757-63838779 CAGGGCTGTGGGAGGGGGCGTGG + Intergenic
1083655104 11:64225750-64225772 TGGACTGGTGGGAGGGGGTGGGG + Intronic
1083658802 11:64242574-64242596 GGGCCTTTTGGGAGTGGGTGGGG + Intronic
1083747317 11:64743429-64743451 TGGGCTCCCGGGAGGGGGCGAGG - Intronic
1083814987 11:65127736-65127758 GGGGCCTGGGGGGAGGGGCGGGG + Exonic
1083882823 11:65556961-65556983 GGGGCTTGGGGGAGGATGAGGGG + Intronic
1083901069 11:65643806-65643828 TGGGATTGTGGGGAGGGGCGGGG + Intronic
1084039237 11:66531825-66531847 GGGGCTCCTGGGTGGGGGTGGGG + Intronic
1084061454 11:66677971-66677993 GGGGCCTGTTGGTGGTGGCGCGG + Intergenic
1084257842 11:67955090-67955112 GGGGCTTGTGGCGGGGGTAGGGG - Intergenic
1084385183 11:68839347-68839369 GGGGCTTGGGGGAAGGGGCGGGG - Intronic
1084400574 11:68940669-68940691 GGGGCTTGAGAGACGCGGCGGGG - Intergenic
1084432703 11:69120366-69120388 GGGGCTGGTGTGAGGAGGTGGGG + Intergenic
1084612418 11:70212152-70212174 GGGGAGGGTGGGAGGGGGTGAGG - Intergenic
1084673289 11:70620116-70620138 AGGGCCTTTGGGAGGGGGCTAGG - Intronic
1084814923 11:71640147-71640169 GGGGCTTGTGGTGGGGGCAGGGG + Intergenic
1084857634 11:71999128-71999150 GGGGCTGGTGGCTGGGGGAGTGG + Exonic
1085561250 11:77474184-77474206 GGGGAGTGGGGGAGGGGGAGGGG - Intronic
1085681020 11:78574908-78574930 GAGGCGTGCGGGAGGGGGCGGGG + Intergenic
1086235743 11:84627926-84627948 GGGGCCTGTGGGAGGTGGTTGGG - Intronic
1086242393 11:84711403-84711425 GGGGGGTGGGGGAGGGGGTGGGG - Intronic
1086265507 11:84993251-84993273 GGGGCCTGTCGGAGGGTGGGGGG + Intronic
1086285612 11:85246541-85246563 GTGGCTGGAGGGAGGGGGTGAGG - Intronic
1086423130 11:86657457-86657479 GGGGCCTGTAGGAGGGGGTGTGG + Intronic
1086827707 11:91519457-91519479 GGGGGTGGGGGGCGGGGGCGGGG + Intergenic
1087149677 11:94847757-94847779 GGGGGGTGTTGGAGGGGGTGGGG + Intronic
1087564444 11:99836284-99836306 GGGGGTTGGGGGAGGGGGGAGGG - Intronic
1087719816 11:101650251-101650273 GGGGCCTGTCGGAGGGGTGGGGG + Intronic
1087782174 11:102312460-102312482 AGTGATTGTGGGAGGGGGAGGGG + Intergenic
1088259130 11:107928362-107928384 GGGGCCTCTGGACGGGGGCGGGG - Intergenic
1088984852 11:114896660-114896682 GGGGCTTGTGGGAGGTGTTTAGG + Intergenic
1089253059 11:117179044-117179066 GGGGCGGCCGGGAGGGGGCGGGG - Exonic
1089286522 11:117411200-117411222 GGGGCTAGAGGGAGGGGCGGGGG - Intronic
1089289784 11:117430666-117430688 GGGGCTGGGGCCAGGGGGCGGGG + Intronic
1089401102 11:118165124-118165146 TGGGCTCCTGGGAGGGGGCAGGG + Exonic
1089425532 11:118370958-118370980 GGGGCTAGTGGGAGGTGTCTGGG - Intronic
1089535559 11:119158769-119158791 GGGGCTTGGGGCAGGGGCCAGGG + Intronic
1089700207 11:120240079-120240101 GGGGCTCCTGCCAGGGGGCGTGG + Intronic
1089783985 11:120894978-120895000 GGGGCTAATGGGAGGGTGGGTGG + Intronic
1090372803 11:126268592-126268614 GGGGAGGGTGGGAGGAGGCGCGG + Intronic
1090412645 11:126519789-126519811 GGGGGTTGTGGGAGGAGAGGAGG - Intronic
1090425431 11:126603891-126603913 GGGGCTAGTGGGAGGAGGGGGGG - Intronic
1090733475 11:129591471-129591493 GGGGATGGTGGGAAGGGGAGGGG - Intergenic
1090873332 11:130767210-130767232 GGGGGTGGTGGGAGAGGGAGAGG + Intergenic
1091273079 11:134331808-134331830 GGGGCTGGTGGGCGGGGACGAGG - Intergenic
1091385604 12:92631-92653 GGGCCTTTAGGGAGGGGGCCCGG - Intronic
1091451629 12:575792-575814 GTGGCTTCTGGGTGGGGGAGAGG + Intronic
1091558564 12:1594087-1594109 GGCGCTGGGGGGAGGAGGCGCGG + Exonic
1092154586 12:6274054-6274076 GGGGCTGGTGGGGAGGGGTGTGG + Intergenic
1092172896 12:6384464-6384486 GGGCCTGGTAGGAGTGGGCGAGG + Intronic
1092493755 12:8971561-8971583 GGGGGTTGTGGGCGGGGTGGTGG - Intronic
1092502848 12:9065164-9065186 TGGGCTGATGGGCGGGGGCGGGG - Intergenic
1093523047 12:20072744-20072766 AGGGCTTGTTGGAGGTGGAGGGG + Intergenic
1093642304 12:21541843-21541865 GGGGAGTGGGGGAAGGGGCGTGG - Intronic
1093754068 12:22832936-22832958 AGGGCTTTTGGGAGGTGACGAGG + Intergenic
1093884793 12:24447318-24447340 GGGGCTTGTGGGGTTGGGAGAGG - Intergenic
1094176287 12:27545222-27545244 GGGGCCTGTTGGAGGGGTGGGGG + Intronic
1094311348 12:29087029-29087051 GGGGCCTGTGGTAGGGGCCCAGG - Intergenic
1094428237 12:30338179-30338201 TGGGGTTGGGGGAGGGGGCAGGG + Intergenic
1094838865 12:34334718-34334740 GGGCCTGGTGGGGGGGGGCCAGG - Intergenic
1095133978 12:38575569-38575591 TGGGGTTGGGGGAGGGGGGGAGG - Intergenic
1095797051 12:46231296-46231318 GGGGAAGGTGGGAGGGGGCAAGG + Intronic
1095893475 12:47257042-47257064 GGGAAGAGTGGGAGGGGGCGAGG + Intergenic
1096106494 12:48999308-48999330 GGGGCGGGTGGGAGGGTGGGGGG - Exonic
1096461722 12:51825374-51825396 GGGGCTGGTGAGAGGGAGCCTGG - Intergenic
1096677093 12:53231896-53231918 GGCGGCTGGGGGAGGGGGCGCGG - Intronic
1096695269 12:53344813-53344835 GGGGCGGGCGGCAGGGGGCGGGG + Intronic
1096983442 12:55742414-55742436 GGGGATTGGGGGTGGGGGAGAGG - Intergenic
1097217877 12:57428496-57428518 GGGGGGTGTGGTGGGGGGCGTGG + Intronic
1098738931 12:74146061-74146083 GGGGCTTGTTGGAGGGTGTGGGG - Intergenic
1099131307 12:78835667-78835689 GGGGCCTGTCGGAGGAGGCTGGG + Intergenic
1099483353 12:83196209-83196231 GAGGCTGGTGGGCGGGGGGGGGG + Intergenic
1099989843 12:89709641-89709663 GGGGCGCGCTGGAGGGGGCGGGG - Intergenic
1100119175 12:91348362-91348384 GGGGCATGAGGGAGAGGGCTTGG + Intergenic
1100145703 12:91674958-91674980 GGGGCCTGTGGGAAGGGGAGTGG - Intergenic
1100540039 12:95548881-95548903 TGGGGCTGTGGGAGGGGGCGGGG - Intronic
1101036316 12:100710673-100710695 GGGGCCTGTTGGTGGGGGAGGGG + Intergenic
1101432383 12:104637336-104637358 GGGGGTTGGGGGAGGGGGGAGGG + Intronic
1101444004 12:104724294-104724316 GGGGCTTGGGGGAGGGGAATGGG + Intronic
1101576039 12:105997285-105997307 GGGAAGAGTGGGAGGGGGCGAGG + Intergenic
1101842664 12:108339458-108339480 TGGGCTTGTGGGTGGCGGCGGGG + Intergenic
1101954892 12:109204626-109204648 GGGGCTGGTGGGAGTGGGGATGG - Intronic
1102047618 12:109839834-109839856 TGGGCTAAGGGGAGGGGGCGGGG - Intergenic
1102101301 12:110281067-110281089 GCGGCGCGCGGGAGGGGGCGGGG + Intronic
1102471389 12:113161781-113161803 GGGGCGGGGAGGAGGGGGCGGGG - Intronic
1102516034 12:113447388-113447410 GGGGATTGGGGGTGGGGGGGAGG + Intergenic
1102622696 12:114209324-114209346 GGGGCTTGTCGGGGGGTGCAGGG + Intergenic
1102781502 12:115569932-115569954 GGGGCTTGGGGGAGGAGCCAGGG + Intergenic
1103688710 12:122753050-122753072 GGCCCTTGTGGGCGGGGGTGTGG - Intronic
1103741212 12:123092833-123092855 GGGGCTCGGGGGAGAGGTCGAGG - Intronic
1103817540 12:123671020-123671042 AGGCCTTGTGGGCGGGGCCGGGG + Intergenic
1103991336 12:124801281-124801303 AGGGGCTGGGGGAGGGGGCGGGG + Intronic
1104008882 12:124915031-124915053 GGGGCTGAGGGGAGGGGCCGCGG - Exonic
1104412552 12:128571554-128571576 GGGGCTGCGGGGAGGGGGAGTGG - Intronic
1104463013 12:128970311-128970333 GGGGCTCAGGGGAGAGGGCGCGG - Intronic
1104588821 12:130068325-130068347 GGGGCTCGTGGCAGGAGGGGAGG + Intergenic
1104595048 12:130115248-130115270 GGGGCTTGCGGGAGGCGGCGTGG - Intergenic
1104624604 12:130340626-130340648 GGTGGTTGGGGGAGGGGGGGTGG + Intronic
1104709772 12:130977367-130977389 GGGGCTTTGGGGTGGGGGTGTGG + Intronic
1104761204 12:131298587-131298609 GGGGCATCTGGGGGGCGGCGGGG + Intergenic
1104798458 12:131536624-131536646 AGGGCGTGTGGAAGCGGGCGGGG - Intergenic
1104818571 12:131662205-131662227 GGGGCATCTGGGGGGCGGCGGGG - Intergenic
1104866992 12:131961563-131961585 AGGGCTGGTGGGCGGGGGTGGGG - Exonic
1104882781 12:132084177-132084199 GGGGCGGGGCGGAGGGGGCGGGG - Intergenic
1104882789 12:132084191-132084213 GGGACGTGGCGGAGGGGGCGGGG - Intergenic
1104885541 12:132104931-132104953 AGGGCTGGTGGGCGGGGGTGGGG - Exonic
1105028809 12:132868770-132868792 GGGGCTGGGGGGAGGGGACATGG + Intronic
1105335821 13:19467810-19467832 GGGGCTTGGGGGTGGGGAGGTGG - Intronic
1105384437 13:19916701-19916723 GGGGCTTGTCGGGGGGTGGGGGG + Intergenic
1105409644 13:20161100-20161122 GGGGCTGTTCGGAGGCGGCGGGG - Intergenic
1105496717 13:20936799-20936821 GGGGCTTTTGGGAGGGTTCTGGG + Intergenic
1106111163 13:26778391-26778413 GGGGCTGGTGGGAGGGGGAATGG - Intergenic
1106157280 13:27171155-27171177 GGGTCGTCGGGGAGGGGGCGCGG - Intronic
1106186930 13:27417888-27417910 GGGGCTTCTGGCAGGGGGTGAGG - Intergenic
1106933114 13:34688577-34688599 TGGGGTTGGGGGAGGGGGCAGGG + Intergenic
1107552578 13:41491077-41491099 GTGGAGTGGGGGAGGGGGCGCGG + Intergenic
1107555116 13:41510589-41510611 GGAGGTTGGGGGAGGGGGTGGGG + Intergenic
1107555694 13:41515525-41515547 AGGGCTTGTGGGTGGGGTCCAGG - Intergenic
1107613550 13:42141042-42141064 GGGGTTGGTGGGAGGGGGGAGGG - Intronic
1107838806 13:44435216-44435238 GGGGCCTGGGGGCGGGGACGCGG - Intronic
1108292709 13:48976577-48976599 AGGGCTCGGGGGCGGGGGCGGGG + Intronic
1109001296 13:56809753-56809775 GGGGCCTGTTGGAGGGTGGGGGG - Intergenic
1109496669 13:63180866-63180888 TGGGGTTGTGGGAGGGGGGAGGG - Intergenic
1110043139 13:70791739-70791761 GGTGCTTTTGGGAGGAAGCGAGG - Intergenic
1110063331 13:71068716-71068738 GGGGCCTGTTGGAGGGTGAGGGG - Intergenic
1110119628 13:71865871-71865893 CAGGCTGGTGGGAAGGGGCGCGG + Intronic
1110401843 13:75101060-75101082 GGGCCTGGTGGGAGGTGGCTGGG - Intergenic
1110648590 13:77918042-77918064 TGGGCTTGAGGAAGGGGGCCTGG - Intronic
1110884076 13:80610945-80610967 GGGGCGGGGGGGAGGGGGGGAGG - Intergenic
1111445859 13:88345486-88345508 GGGGATGGGCGGAGGGGGCGGGG + Intergenic
1111998525 13:95189047-95189069 GGGGCTTGTCGGTGGGTGGGGGG - Intronic
1112004783 13:95244956-95244978 TGGGCATGTGGGAAGGGGCCCGG - Intronic
1112271930 13:97976559-97976581 GGGGCTTGCGGGGGGCCGCGCGG - Intronic
1112449848 13:99498655-99498677 GGGTCTGGTGGGAGGGGCCGGGG - Intergenic
1112461397 13:99606558-99606580 GTGGCTGGCGGGACGGGGCGGGG + Intergenic
1112497071 13:99913795-99913817 GTGGCTTGTGGCCGGGTGCGTGG + Intergenic
1112537565 13:100275038-100275060 GGCCCTTGGGGGAGGGGGTGGGG + Intronic
1112846105 13:103646073-103646095 GGGGCTTGTTGGAGGGTGTCAGG + Intergenic
1113274103 13:108708994-108709016 GATGCCTGTGGGAGGGGGTGGGG - Intronic
1113417047 13:110136746-110136768 GGGGCCTGTGGGAGAGAGCTTGG - Intergenic
1113584529 13:111455783-111455805 GGGGCCTATGGGAGGGAGAGAGG + Intergenic
1113729973 13:112634380-112634402 GTGGCTTGTGGGAGAGGGGCTGG - Intergenic
1113745230 13:112739962-112739984 AGGGGCTGGGGGAGGGGGCGTGG + Intronic
1113768303 13:112894251-112894273 GGGGCCCGGGGGCGGGGGCGGGG - Intergenic
1113768395 13:112894464-112894486 GGGGGTGACGGGAGGGGGCGCGG + Intronic
1113789563 13:113020665-113020687 GGGGCTTGTGGGAGGGGAGGAGG - Intronic
1113804683 13:113106295-113106317 GGGGCATGGGGGATGGGGTGTGG + Intronic
1113813110 13:113154091-113154113 GGGGCGTGGGGGGCGGGGCGTGG + Intergenic
1113861463 13:113490376-113490398 GGGCCTTGGGGCAGGGGCCGGGG - Intronic
1113888668 13:113725166-113725188 GGGGCGCGTGGGAGGGCGCGAGG - Intronic
1113936223 13:113996387-113996409 GAGGCTCCTGGGAGGAGGCGAGG + Intronic
1113966415 13:114155827-114155849 TGGGCGTGGGGGAGGGGGGGTGG + Intergenic
1114042212 14:18689422-18689444 AGGGAGTGTGGGAGGGAGCGAGG + Intergenic
1114210773 14:20612549-20612571 GGGGCTTGGGGGTGGAGGAGCGG + Intergenic
1114259380 14:21025856-21025878 GGGGCGCGGGGGAGGGGCCGGGG + Intronic
1115221998 14:31067424-31067446 GGGGCCTGTGGTAGGGTGGGGGG - Intronic
1115488286 14:33934173-33934195 GGGGATGGTGGGAGGTGGGGTGG - Intronic
1115645139 14:35364054-35364076 GGGGCAGGTGGGATGGGGGGTGG + Intergenic
1116247250 14:42431722-42431744 GGGGCCTGTTGGAGGGGCAGCGG - Intergenic
1116325840 14:43533305-43533327 GGGGCTTGGGCGGGGAGGCGGGG - Intergenic
1116765699 14:49067758-49067780 GGGGCCTGTTGGAGGGTGGGGGG + Intergenic
1116782469 14:49251181-49251203 GGCACTTGTGGTAGGGGGTGAGG - Intergenic
1117264093 14:54067760-54067782 GGGGTTGGTGGGCGGGGGGGGGG - Intergenic
1117279201 14:54220619-54220641 GGGGCTGGAGGGAGGGGGTGGGG + Intergenic
1117290116 14:54324236-54324258 GGGAAGAGTGGGAGGGGGCGAGG + Intergenic
1117460036 14:55936251-55936273 GAGGCATGTGGGAAGGGGCATGG + Intergenic
1117527556 14:56624875-56624897 GGGGGTTGGGGGTGGGGGTGGGG + Intronic
1117548859 14:56814029-56814051 GGGGAGTGGGGGAGGGGGAGGGG + Intergenic
1117640360 14:57791953-57791975 GGGGCTTGTTGGAGGGTGGGGGG + Intronic
1117784108 14:59264823-59264845 GGGGCATGTGGCAGGAGGCAGGG - Intronic
1118142836 14:63103692-63103714 GGGGGAAGTGGGAGGGGGTGAGG - Intergenic
1118323844 14:64768679-64768701 GGGGCCTGGGGGAGGGGTTGAGG - Intronic
1118615562 14:67572392-67572414 GGGGATGGGGGCAGGGGGCGTGG + Intronic
1118750812 14:68806869-68806891 GGGACTGGTGGGAGGGAGGGTGG + Intergenic
1119119946 14:72065914-72065936 TGGGCTGGGGGGAGGGGGGGAGG - Intronic
1119172311 14:72544742-72544764 GGGGATGGAAGGAGGGGGCGAGG - Intronic
1119188836 14:72664617-72664639 GGGGCAGGTGGGAGGTGGTGAGG - Intronic
1119406383 14:74402131-74402153 GACGCATTTGGGAGGGGGCGGGG + Intergenic
1119456715 14:74762472-74762494 TGGGTGTGTGGGGGGGGGCGGGG - Intergenic
1119725727 14:76920767-76920789 GGGGGTTGGGGGAGGAGGAGGGG + Intergenic
1119741293 14:77015280-77015302 GTGGCTGGTGGGAGAGGGAGGGG + Intergenic
1119756570 14:77124114-77124136 GGGGCTGGGGTGAGGAGGCGTGG + Intronic
1119771072 14:77220986-77221008 GGCGAGAGTGGGAGGGGGCGTGG - Intronic
1121095807 14:91217287-91217309 GAAGGTTGTGGGAGAGGGCGTGG + Intronic
1121338964 14:93093816-93093838 GGGGCTTGTGGGATTGGAGGGGG - Intronic
1121359047 14:93239064-93239086 GGGGCATGTGAGAACGGGCGTGG + Exonic
1121473348 14:94173971-94173993 GGGGCTGGGGGGCGGGGGCTGGG - Intronic
1121774518 14:96582036-96582058 GGGGCATGCCAGAGGGGGCGTGG - Intergenic
1122125045 14:99574434-99574456 GGAGCATGTGGGAGGGTGAGGGG - Intronic
1122349508 14:101079179-101079201 GGAGCTTGGGGGTGGGGGTGGGG + Intergenic
1122632262 14:103112381-103112403 GCGGCTTGTGGCAGAGGGAGGGG + Intergenic
1122688824 14:103522173-103522195 GTGGCCTGGGGGAGGGGGCGCGG + Exonic
1122822543 14:104354803-104354825 GGGGCTGGGGGCAGGGGGCTGGG + Intergenic
1122822555 14:104354824-104354846 GGGGCTGGGGGCAGGGGGCTGGG + Intergenic
1122822571 14:104354852-104354874 GGGGCTGGGGGCAGGGGGCTGGG + Intergenic
1122972807 14:105159225-105159247 GGGGCTCGGGGGCGGGGCCGGGG - Intronic
1122985043 14:105208153-105208175 GGGGCTCGGGGGCTGGGGCGCGG - Intergenic
1123006912 14:105328217-105328239 GGGGGTTGGGGCAGGGGGTGTGG - Intronic
1123047690 14:105526745-105526767 GGGGACTGTGGGGTGGGGCGGGG + Intronic
1123207964 14:106731975-106731997 GGGGGTTGGGGGAGGGGGGAGGG - Intergenic
1202856465 14_GL000225v1_random:54438-54460 GGGGGTTGGGGGTGGGGGTGGGG - Intergenic
1202921535 14_KI270723v1_random:33445-33467 GGGGCGGGTGGGAGGGAGCTGGG + Intergenic
1123766627 15:23486285-23486307 TGGGGTTGGGGGAGGGGGGGAGG - Intergenic
1124385489 15:29204977-29204999 GGGGCCTGTGGGAGAGGGAATGG - Intronic
1124420166 15:29514226-29514248 GGGGCTGGAGGGAGGGGGAAAGG - Intronic
1125127636 15:36242709-36242731 GGGGCCTGTTGGAGGGTGCCAGG - Intergenic
1125333492 15:38604877-38604899 GGGGCATATGGGTGTGGGCGTGG + Intergenic
1125477089 15:40054825-40054847 GGGGCCTGGGGGAAGGGGAGAGG - Intergenic
1125511096 15:40292842-40292864 GCAGCTTCTGGGAGGGGGCCTGG - Intronic
1126359567 15:47832552-47832574 GGGCCTGTTGGGAAGGGGCGGGG + Intergenic
1126476914 15:49074928-49074950 GGGGCCTGTGGGAGGTGAGGGGG + Intergenic
1126615436 15:50574055-50574077 TGGGGGTGGGGGAGGGGGCGGGG + Intronic
1126666605 15:51081140-51081162 AGGGCTTGTGGGGGTGGGTGGGG + Intronic
1126681418 15:51205760-51205782 TGGGCTTGTGGGAGGAGAGGAGG - Intergenic
1126866986 15:52947618-52947640 GGGAAGAGTGGGAGGGGGCGAGG - Intergenic
1126919308 15:53503135-53503157 GGGGCCTGTTGCAGGGTGCGGGG + Intergenic
1127158060 15:56150026-56150048 GGGGGTTGCGGGGTGGGGCGGGG + Intronic
1127397233 15:58552537-58552559 GGGCCGTGGGTGAGGGGGCGGGG - Intronic
1127503845 15:59579434-59579456 GGGGCCTGTGGGAGGGGTGGGGG - Intergenic
1127751359 15:62048252-62048274 GGGGCCTGTTGGGGGGGGTGGGG - Intronic
1128060423 15:64732095-64732117 GGGGCTGGGGGGAGGGGCAGGGG - Intergenic
1128072413 15:64806213-64806235 TGTGCTTGTTGGATGGGGCGGGG - Intergenic
1128207845 15:65869178-65869200 TGGGTTTGTGGATGGGGGCGGGG - Intronic
1128374468 15:67065518-67065540 GGGGCGCGGGGGAGGAGGCGGGG + Intronic
1128454646 15:67825720-67825742 GGGGCTTGGGGGAGGAGAAGGGG - Intronic
1128550806 15:68596850-68596872 GTGGCCTGTGGGAAGGGGCGTGG - Intronic
1128683525 15:69667827-69667849 GGTGCTGGTGGGAGGGTGCTGGG + Intergenic
1128853036 15:70981333-70981355 GGGGCCTGTTGGAGGGTGGGGGG + Intronic
1129064463 15:72889463-72889485 GAGGTATGGGGGAGGGGGCGCGG - Intergenic
1129118012 15:73376042-73376064 GGGGCTTGTGGGAGGGAGGCTGG - Intergenic
1129268994 15:74409741-74409763 GGTGGTTATGGGAGGGGGTGGGG - Exonic
1129697032 15:77746603-77746625 GGGGCTGGGGGCTGGGGGCGAGG + Intronic
1129707602 15:77803584-77803606 GGGCCTAGTGGGAGGTGGCTGGG + Intronic
1129893976 15:79090255-79090277 CCGGCTTGGGGGAGGGCGCGCGG + Exonic
1129940860 15:79495442-79495464 GGGGCATGAGGGAGGGGGGTGGG + Intergenic
1130302841 15:82693184-82693206 GGGGCGGGGGGGTGGGGGCGGGG - Intronic
1130515071 15:84620095-84620117 GGGGCCTGTGGGGGAGGGGGAGG - Intronic
1130601008 15:85273115-85273137 GGGGGTGGGGGGTGGGGGCGGGG + Intergenic
1130668578 15:85890546-85890568 GGGGCTTGAGGCAGGGAGAGAGG - Intergenic
1130690967 15:86080924-86080946 TGGGCTTGTGGGGGCGGGGGGGG + Intergenic
1130720960 15:86385946-86385968 GGGGGATGGGGGAGGGGGAGAGG - Intronic
1130892505 15:88145074-88145096 GGAGCCTGTGGGCTGGGGCGTGG - Intronic
1131016751 15:89064007-89064029 GGGGCTTGGGGGAGGGGTAATGG - Intergenic
1131136201 15:89937965-89937987 GGGGGGTGTGGGGGGGGGTGTGG - Intergenic
1131201657 15:90402378-90402400 TGGGGTTGTGGGAGGAGGAGAGG + Intronic
1131219794 15:90573056-90573078 GGAGCTAGTGGGAGGTGGCATGG - Intronic
1132407347 15:101551877-101551899 GGGGCTTGTGGGAGTGCCCTAGG - Intergenic
1132588793 16:717406-717428 GGGGCTGGTAGGAGGGAGGGTGG + Exonic
1132599492 16:767550-767572 GGGGCGTGTGGGGGGGTGCGTGG + Intronic
1132614232 16:832305-832327 GGGGCTTGGGGGGAGGGGCGTGG + Intergenic
1132670017 16:1098717-1098739 GGGGCACGGGGGAGGGGGCCTGG - Intergenic
1132785974 16:1657109-1657131 GGGTCCTGTGGCAGGGGGCCAGG + Intronic
1132806342 16:1776853-1776875 AGGTCTTGTGGGAGGCTGCGAGG - Exonic
1132826984 16:1909986-1910008 GGGGCCTGGGGGAGTGGGTGGGG + Intergenic
1133020085 16:2963415-2963437 GGGCCCAGGGGGAGGGGGCGGGG + Intergenic
1133210997 16:4263522-4263544 GGGGCTTGTGGTGGGAGGCGTGG - Intronic
1134849922 16:17471005-17471027 GGGGCCTGGGGGAGGAGCCGAGG + Intergenic
1134876929 16:17708793-17708815 GGGGCCTGTGGGGGTGGGTGGGG - Intergenic
1135187371 16:20326963-20326985 GGGGGTTGGGGGCGGTGGCGAGG + Intronic
1135346228 16:21690956-21690978 GGGGGTGGGGGGAGGGGGTGGGG - Intronic
1135432691 16:22400015-22400037 GGTGCTTGGGGGAGGAGGAGAGG - Intronic
1135705428 16:24670891-24670913 GGGGCTGGCGGGAGTGGGGGAGG - Intergenic
1136181298 16:28554241-28554263 GGGGCTCGTGGGGGTGGGGGCGG + Intronic
1136233925 16:28903238-28903260 GAGGCTGGTGGGAGTGGGCTGGG + Intronic
1136410706 16:30075496-30075518 GGTGGTGGTGGGTGGGGGCGCGG + Intergenic
1136539995 16:30923787-30923809 CGCGCTTGGGGGAGGGGGAGAGG + Intronic
1136550254 16:30979205-30979227 GGGGCGTGGGGCAGGGGCCGGGG - Exonic
1136556508 16:31010516-31010538 GGGGCCTGCGGGCGGGGGCGGGG + Exonic
1137343318 16:47631630-47631652 GGGGCCTGTCGGAGGGTGGGAGG - Intronic
1137421153 16:48335205-48335227 AGGGCTTGGGGGAAGAGGCGGGG + Intronic
1137463543 16:48687578-48687600 GGGCCGTGTGGAAGGAGGCGTGG - Intergenic
1137465401 16:48703969-48703991 GGGGCTTGTTGGAGGGTGTCGGG + Intergenic
1137539772 16:49354274-49354296 GGGGCCTGTGGGAGGGGATGAGG + Intergenic
1137582239 16:49640580-49640602 GGGGCCAGGGGGTGGGGGCGGGG - Intronic
1138042332 16:53685696-53685718 GGGGCCTGTCGGAGGGTGAGGGG + Intronic
1138272681 16:55707287-55707309 TGGTCTTGTGGGAGGAGGGGAGG + Intergenic
1138328230 16:56192398-56192420 GGAGCTGGTGGCAGGGGGTGCGG - Intronic
1138828577 16:60351406-60351428 GGGGCTTGGGGTAGAGGGAGTGG + Intergenic
1139211012 16:65076680-65076702 GGGGCTTGTCGGGGGGTGGGGGG - Intronic
1139248371 16:65470716-65470738 GGGGCTTGTCGGGGGTGGCAGGG - Intergenic
1139420756 16:66848321-66848343 AGAGCTTTGGGGAGGGGGCGTGG + Intronic
1139460836 16:67121167-67121189 GGGACTTGTAGGAGTGGGCAGGG + Intronic
1139468843 16:67167625-67167647 GGGGCCTGTGGGGGAGGGCCTGG + Intronic
1139511492 16:67430823-67430845 CGGGCGTGTGGGTGGGGGCGCGG + Intronic
1139531006 16:67542756-67542778 GGGGCTTGTGGTAGGATGGGTGG - Exonic
1139797845 16:69497623-69497645 GGGGCTGGTGGGAGGAGGAGGGG - Intergenic
1140442543 16:74998975-74998997 GGGGGGAGGGGGAGGGGGCGCGG + Intronic
1140641512 16:76978657-76978679 GGGGCCTGTTGGAGGGTGGGAGG - Intergenic
1140754582 16:78056020-78056042 GTGGCTTGTGGGAGCAGGAGTGG + Intronic
1141429985 16:83966413-83966435 GGGGATTGTGGGAGGAGTCCTGG + Intergenic
1141454818 16:84134177-84134199 GAGGGTTGTGGGAGGGGTGGTGG - Intronic
1141503501 16:84460481-84460503 GGGGCTTCTGGAAGGTGCCGAGG + Intronic
1141593515 16:85083786-85083808 GAGGCAGGTGGCAGGGGGCGAGG + Intronic
1141615347 16:85206836-85206858 GGGGCTTGTGGAGGGGGCGGTGG - Intergenic
1141732745 16:85833777-85833799 GGGGCTTGTGGGAGAGGAATGGG + Intergenic
1141755432 16:85987750-85987772 GGGGGTGGTGGGGGGGGGGGAGG - Intergenic
1141888418 16:86909792-86909814 AGGGCTCGTGGGACGGGGCAAGG - Intergenic
1141941007 16:87276266-87276288 AGTGCTTGGGGGAGGGGGCAGGG - Intronic
1141971529 16:87487403-87487425 GGGCCTGGTGGGCAGGGGCGGGG - Intronic
1141991886 16:87615331-87615353 GGGGCCTCCGGAAGGGGGCGAGG - Intronic
1142085286 16:88176743-88176765 GGGGGTTGTGGCAGGGGCCGGGG - Intergenic
1142127038 16:88415355-88415377 GGGGCTTGGGGGAAGGGCCCTGG - Intergenic
1142133778 16:88442528-88442550 GGGGCTGGTGAGTGGGGGTGTGG + Intergenic
1142228682 16:88889333-88889355 GGGGGTGGTGGGAGGGAGGGAGG + Intronic
1142228705 16:88889402-88889424 GGGGCGGGAGGGAGGGAGCGAGG + Intronic
1142480316 17:214903-214925 GAGGCTAGAGGGAGGGGGCAGGG + Intronic
1142509665 17:385847-385869 GGTGCGGGTGGGGGGGGGCGGGG - Intronic
1142571604 17:878402-878424 GGGGTTTGGGGGTGGGGGAGGGG + Intronic
1142571620 17:878439-878461 GGGGTTTGCGGGCGGGGGTGGGG + Intronic
1142594051 17:1021048-1021070 AGGGCTTGTGGGAGGGGAGGTGG - Intronic
1142614249 17:1125571-1125593 GGGGCTGCTGGGAGGCGGGGAGG + Intronic
1142623771 17:1180026-1180048 GGGGCTTTGGTGCGGGGGCGGGG + Intronic
1142623779 17:1180045-1180067 GGGGCTTTGGTGCGGGGGCGGGG + Intronic
1142636352 17:1260155-1260177 GGGGGTCGCGGGAGGGGCCGAGG - Intergenic
1142681943 17:1555119-1555141 AGGGCCTGGTGGAGGGGGCGAGG + Intronic
1142861745 17:2766315-2766337 GGGGCCTTTGGGAGGGAGAGAGG + Intergenic
1143104199 17:4520222-4520244 GGGGCCGGTGGGTGGGGACGGGG + Intronic
1143149302 17:4797569-4797591 GGTGCTTGTGGGCAGGGGAGGGG + Exonic
1143270654 17:5672392-5672414 GGGGCTTGTGGGTGGCTGCCTGG + Intergenic
1143338236 17:6189602-6189624 GGGGCGTGTGCAGGGGGGCGAGG - Intergenic
1143434662 17:6914709-6914731 GGGGCGTGGTGGTGGGGGCGTGG - Intronic
1143446625 17:7013772-7013794 GGAGCAGGTGGGAGGTGGCGAGG + Intronic
1143477638 17:7211753-7211775 GGGGGTTGGGGGAGGGGGAGGGG + Intronic
1143513049 17:7406300-7406322 GGAGCTGGTGGGAGGAGGCCAGG + Intronic
1143515559 17:7417729-7417751 GGTGGCGGTGGGAGGGGGCGGGG - Exonic
1144407618 17:14967343-14967365 GGGGAAAGAGGGAGGGGGCGAGG - Intergenic
1144521620 17:15956317-15956339 GGAGAGTGTGGGAGGGGGAGGGG + Intronic
1144682881 17:17206734-17206756 GGTGTCTGTGGCAGGGGGCGTGG - Intronic
1144725389 17:17499377-17499399 GGGGCTGGTGGGGGGGGGGTGGG - Intergenic
1144752124 17:17656185-17656207 GGGGCTGGTGGGAGGTGTTGGGG - Intergenic
1144764026 17:17723335-17723357 GGGGCTTGGGGGGGGGGGTCTGG - Intronic
1144781208 17:17809575-17809597 GGGGCTCCTGGGGGTGGGCGGGG - Intronic
1144785743 17:17830700-17830722 GGGGCTTGTGGGAGGTGGGACGG - Intronic
1145031466 17:19507809-19507831 GGGGATTCTGGGAGGGAGCGAGG - Intronic
1145317369 17:21742963-21742985 GGGGCCTGAGGGTGGGGGCTGGG - Intergenic
1145737809 17:27245380-27245402 GGGGCTTGCAGGAAGGGGAGAGG - Intergenic
1145767165 17:27466633-27466655 GGGGTTTGGGGGAGAGGGCTGGG + Intronic
1146034085 17:29390819-29390841 GGGGGGTGGGGGGGGGGGCGAGG - Exonic
1146208237 17:30922553-30922575 GGGGCGTCTGGGAGCGGGCAGGG - Intronic
1146375753 17:32293161-32293183 GGGGCTGGAGGGAGGGGGTGGGG + Intronic
1146644865 17:34570727-34570749 GGGCCTGGTGGGAGGGGTCATGG - Intergenic
1146829289 17:36054186-36054208 AGGGAGTGTGGGAGGGGGTGAGG + Intergenic
1146956184 17:36937524-36937546 TGGGCCTGGGGGAGGGGGCGAGG - Exonic
1146956707 17:36940255-36940277 GGGGGTGGGGGGCGGGGGCGGGG - Intronic
1146958098 17:36948938-36948960 GAGGCGCGCGGGAGGGGGCGGGG - Exonic
1147166362 17:38595707-38595729 GGGGCTTGTGGCCTGGGGAGAGG - Intronic
1147189598 17:38730813-38730835 GGGTCTTGTGCGAGGAGGAGGGG - Intronic
1147192810 17:38747551-38747573 GGTGGTTCGGGGAGGGGGCGGGG + Intronic
1147241790 17:39095363-39095385 GGGGTTGGGGGGGGGGGGCGGGG - Intronic
1147387562 17:40091103-40091125 GGGGATTGGGGCAGGGGGTGGGG + Intronic
1147400392 17:40177433-40177455 GGGGACTGGAGGAGGGGGCGCGG + Intronic
1147459052 17:40556993-40557015 GGGCCATGGGGGTGGGGGCGAGG + Intronic
1147608048 17:41785459-41785481 GGGGCCTGAGGTAGGGGCCGGGG - Intronic
1147648897 17:42050768-42050790 GGGGCTGGGGGGTGGGGCCGGGG - Intronic
1147655932 17:42091047-42091069 GGGGCTTGGGGGTAGGGGCTGGG + Intergenic
1147914418 17:43878062-43878084 TGGGCTTTGGGGAGGGGGAGTGG - Intronic
1147937167 17:44018765-44018787 GGGACTTGTGTCAGGGGGAGGGG + Intronic
1147975015 17:44242380-44242402 GGGCGTGGTGGTAGGGGGCGTGG - Intergenic
1148029259 17:44608538-44608560 AGGCCTTGGGGGAGGGGGCCAGG - Intergenic
1148075998 17:44935471-44935493 GGGGCTTGAGGGAGGAGGGAAGG - Intronic
1148212979 17:45819438-45819460 GGGGGTGGTGGGATGGGGTGGGG - Intronic
1148549840 17:48543862-48543884 GCGGCTTTGGGGTGGGGGCGGGG - Intronic
1148558652 17:48593433-48593455 GGGGCTCCTGGGCGGGCGCGGGG + Exonic
1148647018 17:49225045-49225067 GGGGCAAGCGAGAGGGGGCGCGG + Exonic
1148774601 17:50088379-50088401 GGGGCTCGGGGAAGGGGGCCCGG - Intronic
1148853330 17:50565369-50565391 TAGGCTTGTGGGGTGGGGCGGGG + Intronic
1149108050 17:52993022-52993044 GGAACGTGTGGGAGGGGGTGAGG - Intergenic
1149611245 17:57959094-57959116 GGGGCTTGAGAGAGGGAGTGGGG - Intergenic
1149682330 17:58514883-58514905 GGAACTTAGGGGAGGGGGCGCGG - Intronic
1149853047 17:60052840-60052862 GGGGCTGGTGAGGGGCGGCGGGG + Intronic
1149993951 17:61397293-61397315 GGGGCTGGAGGGGGAGGGCGCGG - Intergenic
1150060482 17:62065063-62065085 GGGCCGTGGGGGAGGGGGCCGGG - Intronic
1150217722 17:63479605-63479627 AGGCCTGGTGGGAGGGGGCTGGG - Intergenic
1150486891 17:65550285-65550307 GGGGGTTGGGGGAAGGGGCATGG - Intronic
1150698496 17:67426597-67426619 GGGGCCTGTTGGAGGGTGGGGGG + Intronic
1151013720 17:70531011-70531033 GGGGCTGGAGGGTGGGGGGGTGG + Intergenic
1151145153 17:72033644-72033666 GGGGCATGAGGTGGGGGGCGGGG + Intergenic
1151190845 17:72396759-72396781 GGGGTTTGTGGGGGTGGGGGTGG - Intergenic
1151198999 17:72453987-72454009 GGGGCCTGTGGGGGGGTGGGGGG - Intergenic
1151226393 17:72651323-72651345 GGGGCTCCTGGGAGGGGGGTGGG - Intronic
1151296915 17:73192846-73192868 GGGGCGGGCGCGAGGGGGCGGGG - Intronic
1151349912 17:73525570-73525592 GCAGCCTGTGGGAGGCGGCGAGG + Intronic
1151525968 17:74668389-74668411 GGGGGGTGTGGGGGGGGGGGCGG - Intergenic
1151533717 17:74725192-74725214 GGAGCTTGTGGGTGGGGGGCTGG - Intronic
1151560742 17:74868191-74868213 GGGGCTTGAGGGAGGTGGTTTGG - Intronic
1151575840 17:74952223-74952245 GGGGGTTGTGGGCGGGGCCGGGG - Intronic
1151657602 17:75502993-75503015 CGGGCAGGTGGGAGGGGGAGTGG + Exonic
1151896707 17:76985682-76985704 GGAGCTGGAGGGAGGGGGAGTGG + Intergenic
1151974872 17:77479013-77479035 GAGGCTTGGGGGATGGGGCTGGG + Intronic
1151992128 17:77582126-77582148 GGGGCTTCTGGGTGGGGGTGGGG + Intergenic
1152167536 17:78720085-78720107 GGGGCTGGGGAGAGGGGGAGTGG + Intronic
1152185627 17:78854909-78854931 GGAGCATGTGGGCGGGGGGGGGG + Exonic
1152226498 17:79095237-79095259 GGGGCTTGCGGGGGGCGGTGGGG + Intronic
1152245368 17:79182522-79182544 GGGCGTTGGGGGAGGGGACGGGG - Intronic
1152294784 17:79460488-79460510 GGGGCTTGAGGCTGAGGGCGTGG - Intronic
1152306373 17:79523120-79523142 GGGGCTTGTGGTGGGGGGGCGGG + Intergenic
1152380960 17:79942010-79942032 GGGGCTTTGGGGGCGGGGCGGGG + Intronic
1152416843 17:80168217-80168239 GGGGCCTATGGTAGGGGGAGTGG - Intergenic
1152426415 17:80220750-80220772 CGGCCTTGTGGGCGGGGCCGGGG + Intronic
1152511791 17:80794924-80794946 GGGGCTAGCGGGAGGGGCCTGGG + Intronic
1152513991 17:80811529-80811551 AGGCCTTGTTGGAGAGGGCGTGG - Intronic
1152513999 17:80811579-80811601 AGGCCTTGTTGGAGAGGGCGTGG - Intronic
1152514010 17:80811629-80811651 AGGCCTTGTTGGAGAGGGCGTGG - Intronic
1152514021 17:80811679-80811701 AGGCCTTGTTGGAGAGGGCGTGG - Intronic
1152514063 17:80811875-80811897 AGGCCTTGTTGGAGAGGGCGTGG - Intronic
1152654799 17:81514581-81514603 GGGTCGTGGGGGCGGGGGCGAGG + Intronic
1152659361 17:81535309-81535331 GGGGCTGGTGGGGGTGGGGGTGG - Intronic
1152678490 17:81653628-81653650 GTGGATTGTGGGCCGGGGCGAGG - Intronic
1152714266 17:81891151-81891173 GGGGGTGGTGGGCGGGAGCGAGG - Intronic
1152721679 17:81926844-81926866 TGGGGATGTGGGAGGGGGCCAGG - Intronic
1152742020 17:82022623-82022645 GCAGCTGGTAGGAGGGGGCGTGG - Intronic
1152853056 17:82648733-82648755 GGGGCGGGGAGGAGGGGGCGGGG + Intergenic
1152917801 17:83051148-83051170 GGGGCAGGTGTGCGGGGGCGGGG + Intronic
1152917828 17:83051260-83051282 GGGGCAGGTGCGCGGGGGCGGGG + Intronic
1152920415 17:83063872-83063894 GGGGATGCGGGGAGGGGGCGTGG - Intergenic
1152945804 17:83196798-83196820 GGGGCTTGGGTGAGGGAGCGAGG + Intergenic
1153138965 18:1950112-1950134 GGGGCTTGTTGGGGGGTGGGGGG - Intergenic
1153666395 18:7370583-7370605 GCTGCTGATGGGAGGGGGCGGGG + Intergenic
1153782071 18:8503814-8503836 GGGGCTTTTGGGAGGTGATGAGG + Intergenic
1153851851 18:9102586-9102608 GGGGCTGACGGGAGGGAGCGAGG - Intergenic
1153881074 18:9422230-9422252 GGGGCGGGTGGGAGGTGGGGAGG + Intergenic
1154341909 18:13510523-13510545 GGGAATGTTGGGAGGGGGCGAGG + Intronic
1154485864 18:14871033-14871055 GGGGTGTGTGGGTGGGGGTGTGG - Intergenic
1154940863 18:21111670-21111692 GGAGCTTCTGGGAGGGGCTGCGG + Exonic
1155355091 18:24944188-24944210 GGGGGTTGAGGGAGGTGGAGAGG + Intergenic
1155987645 18:32247221-32247243 GGGGAGAGTGGGAGGGGGTGAGG - Intronic
1156040375 18:32814128-32814150 GGGAGTTGTGGGAGTGGGAGTGG - Intergenic
1156669227 18:39447505-39447527 GGGGCCTGTCGGTGGGGGTGAGG + Intergenic
1157359694 18:46965577-46965599 GGGGCGGGGGGGGGGGGGCGGGG - Intronic
1157606407 18:48928756-48928778 GGGGGTTTTGGGAGGTGGTGTGG - Intronic
1157794235 18:50560000-50560022 GGGCCCAGTGGGCGGGGGCGGGG + Intergenic
1158258908 18:55587216-55587238 GGGGGTTGGGGGTGGGGACGTGG + Intronic
1158658783 18:59365916-59365938 GGGGCCTGTCGGTGGGGGTGGGG - Intergenic
1158871672 18:61694101-61694123 AGGGCATGTGGGAAGGGGTGTGG + Intergenic
1158887867 18:61845910-61845932 GGGCTTTGTGTGGGGGGGCGTGG + Intronic
1158932919 18:62338653-62338675 GGAGCTTGAGGGAGGGGGAATGG + Intronic
1159179674 18:64886292-64886314 GGGGCCGGTGGGGGGGTGCGGGG - Intergenic
1159215937 18:65390648-65390670 GGGGCCTGTGGGAGGTGGAGGGG + Intergenic
1159957484 18:74530116-74530138 GGGGCTTCTGGGTGGGGATGGGG - Intergenic
1160158251 18:76450334-76450356 GGGGAGTGGGGGAGGGGGAGGGG - Intronic
1160590825 18:79943928-79943950 GGGGCCTGGGAGAGGGGGAGTGG - Intronic
1160660195 19:294579-294601 GGAGCTCGTGGGAGGAGACGGGG - Intergenic
1160691298 19:461581-461603 GGGGGTGGGGGGGGGGGGCGGGG + Intergenic
1160734482 19:656027-656049 AGGGCCTGGGGGAGGGGACGGGG + Intronic
1160765976 19:808268-808290 GGGCCTTGTGGGGGTGCGCGGGG + Intronic
1160777303 19:862123-862145 GGGGCCTGTATGAGGGGGCGGGG + Intronic
1160786458 19:902126-902148 GGGGCCTGTGGGCCGGGGCAGGG + Exonic
1160808123 19:1001360-1001382 GAGGCCTCTGGGAGGGGACGGGG - Intronic
1160808527 19:1002997-1003019 GGGGCTGGGGGGAGGTGGAGGGG + Intronic
1160895866 19:1401536-1401558 GGGGCTTGTGGGCCGGGGGCGGG + Exonic
1160911190 19:1474525-1474547 GTGGCTTGTGGGAGGAGCCCGGG + Exonic
1160922927 19:1529087-1529109 GGGACTAGGGGGAGGGGGCCGGG - Intronic
1160927694 19:1555016-1555038 GGGGCAGGGGGGCGGGGGCGAGG - Exonic
1160946821 19:1647600-1647622 GGAGCCTGCGGGAGGGGGTGTGG - Intronic
1161113067 19:2480331-2480353 GAGGCTTGGGGGAGGTGGGGAGG + Intergenic
1161233347 19:3186416-3186438 GGGGGCTGTGGGAGCGAGCGCGG - Intronic
1161343277 19:3754101-3754123 GGGGCCTGTGGGTGGCGGCGTGG + Exonic
1161358664 19:3833951-3833973 GGGGCAGGGGGCAGGGGGCGTGG + Intronic
1161364348 19:3869423-3869445 GGGGCTTGTGGCATGGGTGGGGG - Intergenic
1161473388 19:4472442-4472464 GGGGCCGGTGGGGGGGGGGGGGG + Intronic
1161567437 19:5011568-5011590 GGGGCTTGTGGCCGTGGGAGAGG + Intronic
1161584647 19:5098664-5098686 GGGGCCTCTGGGAGGCGACGAGG + Intronic
1161597347 19:5157401-5157423 TGGACTCTTGGGAGGGGGCGTGG - Intergenic
1161612454 19:5250801-5250823 GGGGGTTGGGAGTGGGGGCGAGG + Intronic
1161622364 19:5304943-5304965 GGGGCTGGTGAGGGGGGGTGGGG + Intronic
1161638675 19:5405838-5405860 GGGGCATGTGGCTGGGGGCCAGG + Intergenic
1161649945 19:5478203-5478225 GGGGCTGGAGGGGAGGGGCGGGG + Intergenic
1161752862 19:6110335-6110357 GGGGAGTGTGGGGGGCGGCGGGG - Intronic
1161816305 19:6502002-6502024 GGGCCTTGGGGGAAGGGTCGCGG - Intronic
1161850519 19:6735854-6735876 GGGGCTGGAGGGAGGGGGTAGGG - Intronic
1161978216 19:7617688-7617710 GGGGCTGGTGGGTGGGTGGGTGG + Intronic
1162064587 19:8117319-8117341 GGGGCTGGGGGGAGGGGTCCAGG + Intronic
1162460608 19:10811951-10811973 GGGGCTTGTGTGTGGGGCTGTGG - Intronic
1162796118 19:13088432-13088454 GGCGGGGGTGGGAGGGGGCGGGG + Intronic
1162813492 19:13179220-13179242 GGGGCTGCTGGGAGGGGGAATGG - Intergenic
1162964902 19:14151047-14151069 GGGGGGTGCGGGAGGGGGTGGGG + Exonic
1163051732 19:14689773-14689795 GGGGCCTGTGCGCGGGGGCGGGG - Intronic
1163099098 19:15082768-15082790 GGAGCGGGGGGGAGGGGGCGGGG + Intergenic
1163116002 19:15188942-15188964 GGGTCCTGAGGCAGGGGGCGGGG - Intronic
1163117503 19:15197450-15197472 GGGCCCTGTGTGTGGGGGCGGGG - Intronic
1163210762 19:15838465-15838487 GGGGATTGGGGGTGGGGGTGGGG + Intergenic
1163419667 19:17206911-17206933 GGGGGTTCTGGGAGGGGGCCAGG + Intronic
1163469664 19:17488957-17488979 GGGAATGGTGGGTGGGGGCGGGG + Intronic
1163553516 19:17979529-17979551 GGGGGGTGGGGGAGGGGGCGTGG + Intronic
1163633877 19:18429647-18429669 TGTGTTTGCGGGAGGGGGCGGGG + Intronic
1163696374 19:18765546-18765568 GGGGCAGGTGGGAGGGGGAAAGG + Intronic
1163721019 19:18898382-18898404 GGGGCTAGTGGGTGGGTGGGTGG - Intergenic
1164137442 19:22427605-22427627 GGGGCTTGAGGGAGGGCTGGTGG - Intronic
1164177023 19:22784151-22784173 GCGGCTTGTGGGATGTGGCGGGG - Intergenic
1164321065 19:24147669-24147691 GTGGCTTGGGGGAGGGGGAAGGG - Intergenic
1164594613 19:29525334-29525356 GAGGTTTCCGGGAGGGGGCGGGG - Intergenic
1164681362 19:30135882-30135904 GGGGGTTGCGGGTGGGGGCTTGG - Intergenic
1164739455 19:30565680-30565702 TGGGGATGTGGGAGGGGGTGAGG - Intronic
1165012622 19:32859785-32859807 GTGGCTTGTGGGAAGGGGTAAGG - Intronic
1165078965 19:33296905-33296927 GGGGCGTGGGGGAGGGGGAGAGG + Intergenic
1165172361 19:33903163-33903185 GGGGCGGGGGGGAAGGGGCGGGG + Intergenic
1165287023 19:34851017-34851039 GGGGCTTGGGGGCGGGGGCAGGG + Intergenic
1165311613 19:35031965-35031987 GGGGCTTGTGGGCTGTGGAGAGG + Intronic
1165323866 19:35102785-35102807 GGGGCAGGTGGGAGGGGACAAGG - Intergenic
1165326578 19:35117663-35117685 GGGGGTTGGGGGAGCTGGCGTGG - Intronic
1165331082 19:35141424-35141446 GGGGCTTGGGGGACGGGGCGGGG - Intronic
1165776711 19:38408886-38408908 GGGACTGGTGGTCGGGGGCGGGG + Exonic
1165816886 19:38647938-38647960 GGGGCTTTTCTGAGGGGGCCCGG + Intronic
1165830980 19:38730022-38730044 GGGGCTGGTGGGATGGGGTGCGG - Exonic
1165925250 19:39322045-39322067 GGGGTTTGAGGGAAGGGGTGGGG - Intergenic
1166055438 19:40285354-40285376 GGGGCTGGGGGGAGGGGGCGGGG - Exonic
1166136178 19:40778442-40778464 GCGGCCTGTGGGAATGGGCGGGG + Intronic
1166213043 19:41319671-41319693 GGGGCTGGTGGGTTGGGGTGCGG - Exonic
1166304260 19:41928603-41928625 GCGGCGCGGGGGAGGGGGCGGGG + Intronic
1166536064 19:43575519-43575541 AGGGAGAGTGGGAGGGGGCGGGG + Exonic
1166688565 19:44809862-44809884 GGGGCTGGGGGGTGGGGGTGGGG + Intronic
1166709349 19:44926892-44926914 GGGGATCGTGGGAGGGAGGGAGG + Intergenic
1166751082 19:45164261-45164283 GAGGCTGGTGGGTGGGGTCGGGG + Intronic
1166835949 19:45668172-45668194 CGGGGTGATGGGAGGGGGCGGGG - Intergenic
1166858020 19:45792803-45792825 GCGGCTTCCGGGAGGGGGCCCGG - Intergenic
1167041061 19:47022597-47022619 GGGGCATGGAGGAGGGGGCGGGG + Intronic
1167116393 19:47491521-47491543 GAGGGCAGTGGGAGGGGGCGTGG - Intronic
1167152149 19:47716540-47716562 GCTGCCTGTGGGAGGGGGAGAGG - Exonic
1167170596 19:47828716-47828738 GGGGCTTTGGGGTGGGGGAGAGG + Intronic
1167266531 19:48485585-48485607 GGGGCTGGGGGGCGGGGGCCCGG + Exonic
1167666138 19:50823669-50823691 GGGGGATGTGGGAGGGGGAACGG - Intronic
1167671291 19:50855195-50855217 GGGGTAAGTGGGAGGGAGCGGGG - Intronic
1167743853 19:51339931-51339953 GGGGCTAGAGGAAAGGGGCGGGG - Intronic
1168065168 19:53915156-53915178 GTGGCCTGTGTGAGGGGGCGTGG + Intronic
1168111914 19:54197358-54197380 GGGGTTTGTGGAAGAGGGCCTGG + Intergenic
1168186298 19:54702124-54702146 GGGGCCTGTCGGGGGGGGGGTGG + Intergenic
1168263770 19:55209916-55209938 GGGGCTTGTGGGAGACGGAGAGG - Intergenic
1168411284 19:56141639-56141661 GGCGCCTGGGGGAGGGGGAGGGG + Intronic
925034814 2:677060-677082 GGGCCCTGTGGGAGGGGGCCGGG - Intronic
925464159 2:4091011-4091033 TAGGCTTGTCGGAGGGGGGGGGG + Intergenic
925698679 2:6611017-6611039 GGGGCCTGTTGGAGGGTGGGGGG - Intergenic
925922145 2:8645318-8645340 GGTGCTTGTCGGAGGGGCTGGGG - Intergenic
926728511 2:16016657-16016679 GGGGGTTGGGGGAGGGGACAGGG - Intergenic
926878909 2:17518615-17518637 GGGGCGCGTGGGTGGGGGCAGGG - Intergenic
927149659 2:20188347-20188369 GGTGGCTGTGGGAGGGGGCTGGG - Intergenic
927508476 2:23629571-23629593 GGGGCTTGGAGGAAGGGGCTGGG + Intronic
927596655 2:24403212-24403234 GGGGCTGGGGGGAGGGCGGGCGG - Intergenic
927713976 2:25341291-25341313 GGGGAGCGGGGGAGGGGGCGGGG - Intronic
927768571 2:25837079-25837101 GGGGGTGGGGGGGGGGGGCGTGG + Intronic
927844755 2:26465643-26465665 GGGGCATGGGGCAGAGGGCGGGG - Intronic
927861475 2:26562710-26562732 GGCGCTAGTGGAAGGGGGAGGGG - Intronic
927884807 2:26711862-26711884 GGGGCTGGGGGGAGGGAGCAGGG + Intronic
927904292 2:26846559-26846581 TGGGCTTCAGGGAGGTGGCGTGG - Intergenic
928162215 2:28938980-28939002 GGGGGTTTTGGGAGGTGGCCTGG + Intronic
928175872 2:29033973-29033995 GGGGCTGGGAGGAGGGGGTGTGG + Intronic
928180491 2:29065162-29065184 CAGGCTTGTGGGAGAGGGCTGGG - Intronic
928193371 2:29194340-29194362 GGGGCTGGGGGGAGGAGGAGAGG + Intronic
928427516 2:31191537-31191559 AGGTCTTGTGGGAGGGGACACGG - Intronic
928801502 2:35099476-35099498 GGGGCCTGTAGGAGGGTGGGAGG - Intergenic
928858493 2:35828003-35828025 GTGGCTGGGGGGAGGGGGCAGGG + Intergenic
929258987 2:39843810-39843832 GGAGATTGTGGGAGGAGGCTAGG + Intergenic
929339817 2:40801697-40801719 TGGGGTGGGGGGAGGGGGCGGGG - Intergenic
929578481 2:43067652-43067674 AGGTGTTGGGGGAGGGGGCGGGG - Intergenic
929816387 2:45236302-45236324 GGGGCATGTGGTAGGGGTAGGGG + Intergenic
929967010 2:46543371-46543393 GGGGCGGGTGGGAGAGGGGGTGG - Intronic
930864473 2:56108952-56108974 GGGGCATGTGGAAGGGGCAGTGG + Intergenic
931015042 2:57967213-57967235 GGGGCCTGTCGGCGGGTGCGGGG + Intronic
931427462 2:62184221-62184243 TGGGCCTGTGGGAGGAGGGGTGG + Intergenic
931440677 2:62288041-62288063 GGGGCTGGTGGCAGGGAGCCAGG + Intergenic
931542966 2:63350279-63350301 GGGGCATGTCGGAGGGTGCAGGG + Intronic
931569130 2:63649774-63649796 GGGGCTTGTGGGGAGGGGTCTGG + Intronic
931614771 2:64144462-64144484 GGGGCCTGAGGGAGGGGACCGGG + Intergenic
931817307 2:65917303-65917325 AGGGCTTGTGGGTGTGGGTGTGG + Intergenic
932288217 2:70554065-70554087 GGGGTTTGGGGTAAGGGGCGGGG + Intronic
932498038 2:72157017-72157039 GGGGCAGGTGGTAGGGAGCGAGG + Intergenic
932567708 2:72920030-72920052 GGGGCTCGGAGGAGAGGGCGGGG + Intronic
932752604 2:74380806-74380828 CAGCCTTGTGGGAGGGGGCTAGG - Intronic
932795017 2:74686866-74686888 GGGGCCTGTTGGAGGGTGGGGGG + Intergenic
932961387 2:76416013-76416035 GGGGTTTGTGGGAGGAGTTGAGG - Intergenic
933728182 2:85437979-85438001 GGGGCTGGGGGCGGGGGGCGGGG + Intergenic
933858598 2:86441963-86441985 GCGGCCGGTGGGAGGGGGCCGGG - Intronic
933862090 2:86479920-86479942 GGGGCTGGTGAAAGGGTGCGGGG + Intronic
934522006 2:95025607-95025629 GGGGCGTGGGGCGGGGGGCGGGG + Intergenic
934624668 2:95836211-95836233 GGGGCCTGGGGGAGAGGGTGGGG - Intergenic
934651862 2:96097054-96097076 GGGGCTTGGGGGAGGGGAAGTGG + Intergenic
934769063 2:96896389-96896411 GGGGTTTGTGTGTGGGGGAGAGG - Intronic
934971834 2:98770348-98770370 GGGGGTGGGGGGGGGGGGCGGGG - Intergenic
935321302 2:101891855-101891877 GGGGCTTGGGAGATGGGGTGGGG + Intronic
935332724 2:101988792-101988814 GGGTCTCGTGGGAGGGGGGTTGG + Intergenic
935488966 2:103694034-103694056 GGGGCTGTTGGGAAGGGGTGGGG - Intergenic
935625044 2:105165298-105165320 GGGGATGGTGGGAGGGGGGATGG - Intergenic
935717683 2:105953190-105953212 GGGGCTTTTGGAAGGGGACTTGG + Intergenic
935832744 2:107017458-107017480 GGGGCTGGTGGGGGGGCGAGTGG - Intergenic
935855432 2:107268057-107268079 GGGGCTTTTGGGAGGTGGTGAGG - Intergenic
935988820 2:108700634-108700656 GGGGCTTGTGGAGTGGGGAGTGG + Intergenic
936117672 2:109714966-109714988 GGGGGGTGGGGGTGGGGGCGGGG + Intergenic
936600524 2:113890329-113890351 GGGGCTTACGGGCGGGGGTGGGG + Intronic
936719998 2:115239754-115239776 GGGGCCTGTCGGAGGGTGGGGGG - Intronic
936962421 2:118089184-118089206 GTGGATTATGGGAGTGGGCGCGG + Intronic
937264356 2:120606702-120606724 AGGGCATGAGGGAGGGGGTGAGG + Intergenic
937284391 2:120741069-120741091 TGGGCTTGGGGGAGGTGGGGCGG + Intronic
937419421 2:121741689-121741711 GGGGCCTGTGGGAGGTGATGAGG - Intronic
937904791 2:127047824-127047846 GGGGCTTGGGTGAAGGGGCTTGG - Intergenic
937906346 2:127054706-127054728 GGGGCTGCTGGGAGGGGTCAGGG - Intronic
937913894 2:127089629-127089651 GGGGCAGGTGGGTGGGGCCGGGG - Intronic
938097101 2:128471228-128471250 GTGGCGTGTGGGAGGAGGCTGGG + Intergenic
938097109 2:128471262-128471284 GTGGCGTGTGGGAGGAGGCTGGG + Intergenic
938097203 2:128471620-128471642 GTGGCGTGTGGGAGGAGGCTGGG + Intergenic
938097211 2:128471654-128471676 GTGGCGTGTGGGAGGAGGCTGGG + Intergenic
938097250 2:128471820-128471842 GTGGCGTGTGGGAGGAGGCTGGG + Intergenic
938268001 2:129943109-129943131 AGGGAGTGTGGGAGGGGGTGAGG - Intergenic
938540501 2:132280499-132280521 GGGGCTTGGGGGGGGCAGCGGGG + Intergenic
938797707 2:134732118-134732140 GGGAAGGGTGGGAGGGGGCGAGG - Intergenic
939380525 2:141429643-141429665 GGGGCCTGTTGGAGGGCGGGAGG - Intronic
939480620 2:142743074-142743096 TGGGATTGTGGGAGGGGGGAAGG - Intergenic
939534988 2:143416819-143416841 GGGGCGTGGGGGTGGGGGGGTGG - Intronic
939545529 2:143547911-143547933 GGGGATTGTGGGTGGGGGGATGG - Intronic
939630743 2:144524181-144524203 GGGGTGTGTGGGGGGGGGAGTGG - Intronic
939655413 2:144818277-144818299 GGGGCCTGTCGGAGGGTGGGAGG + Intergenic
940369921 2:152889768-152889790 GGGGCTTGTTGTGGGGAGCGGGG - Intergenic
940775178 2:157876636-157876658 GGGGCTCCTCGGAGGCGGCGGGG + Intergenic
941808725 2:169734449-169734471 CGGGCGCGGGGGAGGGGGCGAGG + Intronic
941846013 2:170133895-170133917 GGGGCCTGTGGGGGGTGGTGGGG + Intergenic
941951552 2:171161031-171161053 GGGGCTGGGGGGTGGGGGCATGG + Intronic
942301622 2:174568055-174568077 GGAGGTGGTGGGAGGGGGCCTGG + Exonic
942346094 2:175004825-175004847 GGGGCTCGGGGGCGGGGGCCTGG - Intronic
943090960 2:183374511-183374533 GGGGTGTGTGGGGGGGGGTGGGG + Intergenic
943333702 2:186589761-186589783 GAGGCGTGGGGGCGGGGGCGGGG - Intergenic
943552751 2:189360771-189360793 GGGGCCTGTTGGAGGGGTGGGGG - Intergenic
943757198 2:191569146-191569168 GGGCTCTGTGGGAGGGGGAGAGG + Intergenic
943768869 2:191693580-191693602 GGGGGTTGTAGCGGGGGGCGGGG - Intronic
944288408 2:197977276-197977298 GGGGGTTAGGTGAGGGGGCGGGG - Intronic
944677930 2:202049595-202049617 GGGTTTTGTGGGAGTGGGAGTGG - Intergenic
945094871 2:206209532-206209554 GGGGCATGTGGGAGGGCTAGGGG - Intronic
945857176 2:215082696-215082718 GGGGCTTGTGTGAGGTGGAATGG - Intronic
946226245 2:218265537-218265559 GGGGTTTGTGGGAGGGGCCTGGG - Intronic
946471966 2:219968993-219969015 GGGGCGTGTGGGAGGTGAGGGGG - Intergenic
946669871 2:222091256-222091278 AGGGCTTCAGGGAGGCGGCGAGG - Intergenic
946865232 2:224036470-224036492 GGGGCCTGTGGTGGGGGGCGGGG + Intronic
946929817 2:224660549-224660571 GGGGGTTGGGGGACCGGGCGTGG - Intergenic
947016781 2:225629835-225629857 GGGCCTAGTGGGAGGGGTCTGGG - Intronic
947399124 2:229714589-229714611 GGGGCCTGCGGGGCGGGGCGGGG + Intergenic
947444126 2:230150391-230150413 GGGGTTGGGGGGAGGGGGAGTGG + Intergenic
947535810 2:230939929-230939951 GGGGTGTGTTGGCGGGGGCGGGG + Intronic
947672101 2:231944214-231944236 TGTGTTTGGGGGAGGGGGCGAGG + Intergenic
947718386 2:232352931-232352953 GGAGCTGGGGGAAGGGGGCGAGG - Intergenic
947953177 2:234165364-234165386 GGGGCTTGGGGGGTGGGGGGTGG - Intergenic
948204999 2:236158977-236158999 AAGGCTTGTGGGAGGGGACGAGG + Intergenic
948255915 2:236567913-236567935 CGGGGCTGTGGGAGGGCGCGAGG + Intronic
948408358 2:237739948-237739970 GGGGCTTGTGGGAATGGAGGAGG + Intronic
948467346 2:238158813-238158835 GGGGAGTGGGGGAGGGGGCACGG - Intergenic
948536645 2:238652003-238652025 GGGGCTGGTGGGAGGTGTCTGGG - Intergenic
948553536 2:238791882-238791904 GGTGGTGGTGGGGGGGGGCGGGG + Intergenic
948801242 2:240434636-240434658 GGGTCTGTAGGGAGGGGGCGAGG - Intergenic
948805980 2:240453564-240453586 GGGGCTTGTCGCAGCGGGTGCGG - Intronic
948932244 2:241139488-241139510 GGTGTTTGTGGGAGCGGGCGGGG - Intronic
948982283 2:241500534-241500556 CTGGCCTGTGGGAGTGGGCGGGG - Intronic
949004279 2:241636807-241636829 GGGGCGCGGGGGAGCGGGCGTGG - Intronic
949027659 2:241774011-241774033 AGGGCCTGTGGGGAGGGGCGAGG - Intergenic
1168754946 20:309996-310018 GGGGCTTGGAGGAGGAGGGGTGG - Intergenic
1168830832 20:844513-844535 GGGGCAGGAGGGAGGGGGTGTGG + Intronic
1169078520 20:2778453-2778475 GGGACTTGGGGGAGGGAGTGAGG - Intergenic
1169164105 20:3407661-3407683 GTGCCGGGTGGGAGGGGGCGCGG + Intergenic
1169164209 20:3408001-3408023 GGGGCTGGTCGGGCGGGGCGGGG - Intergenic
1169224201 20:3846363-3846385 TGGGCCTGTGGGAGTGGGAGCGG - Intergenic
1169228852 20:3873553-3873575 GGGGCCTGTGGGAGGTGGTTAGG + Exonic
1169321589 20:4637298-4637320 GGAGCTTGTGGGGGGGTGGGGGG + Intergenic
1169414171 20:5401791-5401813 GGGGCTGGTGGGGGGGGGGTGGG - Intergenic
1169506129 20:6213327-6213349 GGGGGTGGTGGTAGGGGGAGAGG + Intergenic
1169530336 20:6478214-6478236 GGGGCGTGATGGGGGGGGCGGGG - Intergenic
1169721931 20:8687487-8687509 GGGACTTGGGGCAGGGGGTGAGG - Intronic
1170305050 20:14929428-14929450 GGGGTATGTGGGAAGGGCCGTGG + Intronic
1170732802 20:18988954-18988976 GAGGCGGGAGGGAGGGGGCGAGG + Intergenic
1171310353 20:24140320-24140342 GGGGCTTGTGGGAATGGGAGTGG + Intergenic
1171865253 20:30484487-30484509 GGGGCTTGTTGGGGGCGGGGAGG - Intergenic
1172100755 20:32483179-32483201 CGGGGCTGAGGGAGGGGGCGCGG - Intronic
1172118149 20:32583797-32583819 GTGGCGTGGGGGAGGGGGCGGGG - Intronic
1172118415 20:32584501-32584523 GGGGCAGGCGGGCGGGGGCGGGG - Intronic
1172182112 20:33009877-33009899 GGGGCTTGCAGGATGGGGTGGGG - Intronic
1172277182 20:33686112-33686134 GGGGCCGGTGGGAGCCGGCGGGG + Exonic
1172281377 20:33710440-33710462 GGGGGTGATGGAAGGGGGCGTGG - Intronic
1172295919 20:33811291-33811313 GGGGCCTGTGGGAGGTGGCGCGG + Exonic
1172468606 20:35175004-35175026 GGGCCTGGCGGGTGGGGGCGGGG + Intronic
1172592584 20:36128055-36128077 GGAGCATGTGGGGGTGGGCGGGG + Intronic
1172761221 20:37323810-37323832 GGGGAGGGTGGGAGGGGGAGAGG + Intergenic
1172798975 20:37563312-37563334 GGGAGTTGGGGGAGGGGGCCTGG + Intergenic
1173279726 20:41617966-41617988 GGGCCTGGCGGGCGGGGGCGGGG - Intronic
1173279904 20:41618620-41618642 GGGGCACGAGGCAGGGGGCGGGG - Intergenic
1173570439 20:44072134-44072156 TGGGGTTGGGGGAGGGGGCGTGG - Intergenic
1173593948 20:44247178-44247200 GGCAGTTGGGGGAGGGGGCGAGG - Intronic
1173605367 20:44327355-44327377 GGGGCTTGGGGGATGGGGGTGGG - Intergenic
1173671216 20:44800261-44800283 GTGGCTTGTGGGAGTGGGACTGG + Intronic
1173718873 20:45235915-45235937 GGGGCTTGTTTGAGTGGGTGGGG + Intergenic
1173772204 20:45670496-45670518 GGGGCAGGGGGGAGGGGGGGTGG - Intergenic
1174087336 20:48018637-48018659 GGGCCTTGTGGGAGGTGATGAGG - Intergenic
1174128952 20:48328333-48328355 GGGCCTTGTGGGAGGTGATGAGG + Intergenic
1174134848 20:48372487-48372509 GGGGCTGGGGGGCGGGGGCGAGG - Intergenic
1174165769 20:48582575-48582597 GGACCTTGTGGGAGGGAGAGGGG - Intergenic
1174235624 20:49088731-49088753 GGGCCTTGAGGGATGGAGCGGGG + Intronic
1174465093 20:50711179-50711201 GGGGCTTGAGGGAGTGGCAGAGG + Intergenic
1174484221 20:50851336-50851358 GGGGCTGGTAGGTGGGGGCTGGG - Intronic
1174575344 20:51533142-51533164 GGGGCGAGTGGCAGGAGGCGAGG - Intronic
1174612197 20:51807142-51807164 GGGGCTGGAGGGAGGGAGAGTGG + Intergenic
1174741068 20:53014813-53014835 GGGGCTTCAGGGAGGTGGAGGGG - Intronic
1174937063 20:54882319-54882341 GGGGCCTGTGGTTGGGTGCGGGG - Intergenic
1174998578 20:55600497-55600519 GAGGCGTGTGGGAAGGGGCTTGG - Intergenic
1175173099 20:57093335-57093357 GAGGCTGGTGGGAGGGTGGGTGG + Intergenic
1175293163 20:57891601-57891623 GTGGCTTGTGGGAGGCGGGAAGG + Intergenic
1175303969 20:57963347-57963369 AGGGCTTGGGGGAGGGGGAACGG + Intergenic
1175590416 20:60185609-60185631 GGGGCCTGTTGTGGGGGGCGGGG - Intergenic
1175639320 20:60614217-60614239 GGGGCTGGTGACAGGGGACGTGG - Intergenic
1175715242 20:61251196-61251218 GGGGGTTCTGGGAGGGAGAGAGG + Intergenic
1175761992 20:61567512-61567534 GGGGCTTTTGGAAGGGGCCCAGG - Intronic
1175799965 20:61796057-61796079 TGGGCTTGAGGGAGGGGGAGGGG - Intronic
1175825831 20:61936265-61936287 GGGGGGTGTGGGAGAGGGCAAGG - Intronic
1175825880 20:61936379-61936401 GGGGTGTGGGGGAGGGGGTGTGG - Intronic
1175828758 20:61950945-61950967 AGGGCTGGTGGGAGGGAGGGTGG - Intergenic
1175870667 20:62208088-62208110 GGGTGTTGAGGGTGGGGGCGGGG + Intergenic
1175874053 20:62221083-62221105 AGCGCCTGTGGGAGGGGACGGGG + Intergenic
1175921047 20:62450849-62450871 GGGGGTTCTGGGAGGGGTGGGGG - Intergenic
1175992536 20:62796814-62796836 AGGGCGCGTGGGAGGGGGCGGGG - Intronic
1176000894 20:62830726-62830748 GGGGACTGTGGTAGGGGGTGGGG - Intronic
1176000912 20:62830766-62830788 GGGGATTGTGGTAGGGGGTGGGG - Intronic
1176040483 20:63062926-63062948 GGGGGCTGGGGGAGGAGGCGTGG - Intergenic
1176042940 20:63075086-63075108 GAGGCTTGAGGGAGGGGGGATGG - Intergenic
1176080742 20:63272201-63272223 GGCCCTGGTGGGAGGCGGCGGGG - Intronic
1176087569 20:63305023-63305045 GGAGCCTGTGGGAGTGGGCAGGG + Intronic
1176095995 20:63344892-63344914 GGGGGATGTGGGAGGGGCCAGGG + Exonic
1176125539 20:63472996-63473018 GGGGAGTGGGGGAGGGGGAGGGG + Intergenic
1176132436 20:63502021-63502043 GGGGGCTCTGGGAGGGGTCGAGG - Intergenic
1176216108 20:63948596-63948618 GGGGCGTGTGTGAGAGGGAGGGG + Intronic
1176216118 20:63948635-63948657 GGGGCGTGTGTGAGAGGGAGGGG + Intronic
1176216123 20:63948654-63948676 GGGGCGTGTGTGAGAGGGAGGGG + Intronic
1176233345 20:64042773-64042795 GGGTCGTGGGGGACGGGGCGGGG + Intronic
1176233365 20:64042814-64042836 GGGTCGTGGGGGACGGGGCGGGG + Intronic
1176233386 20:64042856-64042878 GGGTCGTGGGGGACGGGGCGGGG + Intronic
1176233397 20:64042877-64042899 GGGTCGTGGGGGACGGGGCGGGG + Intronic
1176233418 20:64042919-64042941 GGGTCGTGGGGGACGGGGCGGGG + Intronic
1176233446 20:64042981-64043003 GGGTCGTGGGGGACGGGGCGGGG + Intronic
1176236968 20:64057888-64057910 GGGGCTTGGGGGTGGGGTGGTGG + Intronic
1176255645 20:64151327-64151349 GGGGCTCCTGGCAGGGAGCGGGG + Intergenic
1176576579 21:8443336-8443358 GAGGCGTGGGGGGGGGGGCGGGG - Intergenic
1177068917 21:16477462-16477484 GGGGATTGTGGGTAGAGGCGGGG - Intergenic
1177423391 21:20891337-20891359 GGGGCTTGTTTGAGAGAGCGAGG + Intergenic
1177453716 21:21306822-21306844 GGGGGTTGGGGGAGGAGGTGGGG - Intronic
1177648361 21:23928709-23928731 GGGGCCTGTCGGAGGGTGGGGGG + Intergenic
1178178460 21:30132190-30132212 GGGGCTTGATGGAGGGTGAGTGG - Intergenic
1178550464 21:33533911-33533933 GGGGGTGGTGGTGGGGGGCGGGG + Intronic
1178879881 21:36441019-36441041 TGGGCCTGTGGGAGGGTGAGGGG - Intergenic
1178951495 21:36989799-36989821 GGGGCCCGTGGGAGGGGGACAGG + Intronic
1179048717 21:37870215-37870237 GGGGCCGGGGGGTGGGGGCGGGG - Intronic
1179305083 21:40146252-40146274 TGGGCTTGACGGAGGGGGGGAGG + Intronic
1179376326 21:40852842-40852864 GGGGCATGTGGGGAGGGACGGGG + Intergenic
1179522479 21:41954046-41954068 GGTGCCCGAGGGAGGGGGCGCGG + Intergenic
1179586151 21:42375357-42375379 GGAGAAAGTGGGAGGGGGCGGGG - Intronic
1179663525 21:42893431-42893453 GGGGATGGGGTGAGGGGGCGCGG + Intronic
1179675067 21:42975186-42975208 GGGGCTGCTCGGAGGGTGCGGGG + Intronic
1179734233 21:43383159-43383181 GAGGCTCGGGGGAGGGGGGGCGG - Intergenic
1179910480 21:44444766-44444788 GGGGCTGGCGGGAGGGTGAGCGG + Intergenic
1179920680 21:44505569-44505591 GGGGCTGGGGGGGGGGGGGGGGG - Intronic
1179925980 21:44534161-44534183 GGAGCTGGTGTGAGGGGGCGGGG + Intronic
1179925994 21:44534200-44534222 GGGGCTTGTGTGAGGGGGCGGGG + Intronic
1179926022 21:44534276-44534298 GGGGCTTGTGTGAGGGGGCAGGG + Intronic
1179926077 21:44534432-44534454 AGGGTTGGTGTGAGGGGGCGGGG + Intronic
1180085390 21:45505790-45505812 GGGGCTTGGCGGGGAGGGCGGGG - Intronic
1180095491 21:45554053-45554075 GGGGGGATTGGGAGGGGGCGCGG - Intergenic
1180095598 21:45554275-45554297 GGGGAGATTGGGAGGGGGCGCGG - Intergenic
1180095637 21:45554356-45554378 GGGGGGATTGGGAGGGGGCGCGG - Intergenic
1180181469 21:46120413-46120435 GGGGGTTGGGGAAGGGGGCCTGG - Intronic
1180201845 21:46229088-46229110 GGGGCTGGTGGGTGGGGAGGTGG + Intergenic
1180201859 21:46229115-46229137 GGGGCTGGTGGGTGGGGAGGTGG + Intergenic
1180599110 22:17002668-17002690 GGGGCCTGTTGTTGGGGGCGAGG + Intronic
1180599668 22:17007859-17007881 GGGGCGTGGGGGAGGCGGCCTGG - Intronic
1180618153 22:17141992-17142014 GAAGGTTGTGGGAGGGGGCCAGG + Intronic
1180989067 22:19923197-19923219 TGGGCATGTGGGAGAGGGGGTGG - Intronic
1181166726 22:20987885-20987907 GGGGCTTGTGGAAGGAGTCCTGG + Intronic
1181593966 22:23902453-23902475 GGGGCATTTGGGAGGTGGCAGGG + Intergenic
1181668575 22:24414807-24414829 GGGTCATGTGGGAGGGGCCCTGG - Exonic
1181737797 22:24895307-24895329 GGAGTGGGTGGGAGGGGGCGAGG - Intronic
1181779263 22:25181072-25181094 GAGGATTGGAGGAGGGGGCGGGG - Intronic
1182047419 22:27286261-27286283 GGGGATTGTGGTAGGGGAAGTGG - Intergenic
1182197587 22:28534912-28534934 TGGGGTTGGGGGAGGGGGCAGGG + Intronic
1182295039 22:29307367-29307389 GAGGCTTCTTGGAGGAGGCGGGG + Intronic
1182556967 22:31134389-31134411 GGGGCTGGAGGAAGGGGGCCTGG + Exonic
1182559749 22:31150413-31150435 GGGACTTGGGGGTGGGGGTGGGG - Intergenic
1182624563 22:31636398-31636420 GGGGCTTGTGGCAAGGGCTGAGG - Intronic
1182685887 22:32121468-32121490 GGGACTTGTGGCGGGGGGAGAGG - Intergenic
1183197733 22:36364987-36365009 GGGGCTGGTGGGGGTGGGGGTGG - Intronic
1183358156 22:37370348-37370370 GGGGCTTCAGGGAGAGGGTGGGG - Exonic
1183360389 22:37380172-37380194 GCGGCGTGTGGGAGGGGTTGAGG + Intronic
1183408143 22:37640329-37640351 TGGGCTGGGGGGAGGGGGAGGGG - Intronic
1183601110 22:38841175-38841197 GGGGCCTCTGGGAGGGGCTGGGG - Intronic
1183740138 22:39664617-39664639 TCGGCTTCGGGGAGGGGGCGGGG - Intronic
1183990518 22:41594380-41594402 GGGGGGTGGGGGTGGGGGCGGGG + Intergenic
1184120423 22:42446285-42446307 GTGGCCTGTGGGAGGGAGCTGGG - Intergenic
1184132131 22:42523182-42523204 GTGGCCTGTGGGAGGGAGCTGGG - Intergenic
1184136608 22:42553743-42553765 GGGCCTGGCGGGTGGGGGCGCGG + Intronic
1184136654 22:42553855-42553877 GGGCCTTCTGAGTGGGGGCGGGG + Intronic
1184347647 22:43923595-43923617 GGGGATTGGGGGCGGGGGCTGGG - Intergenic
1184379808 22:44138249-44138271 GGGGCTTGTGGGAAGTGCCTCGG + Intronic
1184391876 22:44207488-44207510 GGGACTTGTGGGGAGGGGTGAGG + Exonic
1184403111 22:44285500-44285522 GGGGCTTGTGGCAGCGGGCCTGG + Exonic
1184406134 22:44301902-44301924 GGGGCTTGGGGGAGGGGGATGGG + Intronic
1184573038 22:45338971-45338993 AGGGCTGGTGGCAGGGGGTGGGG + Intronic
1184685353 22:46094364-46094386 GGTGCTTGTGGGCAGGGGCAGGG + Intronic
1184764489 22:46564430-46564452 GGGGCTGGTGGGCGGGGCAGTGG - Intergenic
1184768623 22:46585688-46585710 GGAGCTTGTGGGAGGTGGAAAGG + Intronic
1184888441 22:47363760-47363782 GGGGTTTGCGGGGGGGGGGGGGG + Intergenic
1184911557 22:47538631-47538653 GGGGCCTGTGGTAGGGGGAGTGG + Intergenic
1185086160 22:48742182-48742204 GGGGCCTGTGGGGTGGGGCAGGG - Intronic
1185086175 22:48742225-48742247 GGGGCCTGTGGGGTGGGGCAGGG - Intronic
1185115442 22:48932323-48932345 GGGGCCTGTTGGAGGGGGGAGGG - Intergenic
1185116759 22:48942288-48942310 GGGCCTTGTGGGAGGAGGTGTGG - Intergenic
1185202800 22:49518410-49518432 GGTGCCTGTAGGACGGGGCGGGG + Intronic
1185259574 22:49854011-49854033 GGGGCTCGCGGCAGGCGGCGGGG - Intronic
1185320634 22:50198799-50198821 GGGGCTTATAGGAGGGGCCGAGG + Exonic
1185419727 22:50728673-50728695 GGGGCTGGTGGGTGGAGGCCAGG + Intergenic
1203254629 22_KI270733v1_random:132393-132415 GAGGCGTGGGGGGGGGGGCGGGG - Intergenic
1203262685 22_KI270733v1_random:177472-177494 GAGGCGTGGGGGGGGGGGCGGGG - Intergenic
949511218 3:4768768-4768790 AGGGCCTGGGGGTGGGGGCGTGG + Intronic
949559227 3:5187472-5187494 GGGGCTTGGGAGTTGGGGCGGGG + Intergenic
949930813 3:9077122-9077144 GGGGCTTGTCGGAGGGGGAGGGG - Intronic
949987883 3:9553886-9553908 CGGGCGTGCGGGACGGGGCGGGG + Intergenic
950012061 3:9731225-9731247 GGGGCTTGTGGGAGGGGGCGGGG - Intergenic
950176217 3:10876733-10876755 GGGGCGGGGGGGGGGGGGCGGGG - Intronic
950484870 3:13267086-13267108 GGGGCCTCTGGGAGGTGGTGAGG + Intergenic
950591869 3:13942000-13942022 GGGAAGAGTGGGAGGGGGCGGGG - Intronic
950969976 3:17176639-17176661 GGGGCCTGTTGGAGGGTGAGGGG + Intronic
950978952 3:17280884-17280906 GGGGCTTCAGGGTGGGGGAGTGG + Intronic
951078628 3:18425486-18425508 CGGGATTGGGGGAGGGGGCGGGG + Intronic
951253930 3:20427294-20427316 GGGGCCTGTTGGTGGGGTCGGGG - Intergenic
951498359 3:23355229-23355251 GGGGGTTGGGGGAGGGGGGAGGG + Intronic
951517588 3:23578764-23578786 GGGGCCTGTCAGAGGGGGCAGGG + Intronic
952460617 3:33521875-33521897 GGGGCTGGTGGAGGGGGGAGTGG - Intronic
952873872 3:37925457-37925479 GGGGCTTGTTGGAGGCTGTGGGG + Intronic
953409973 3:42685378-42685400 GGGGCTTATGGGACGGGGGTGGG - Intergenic
953567828 3:44048217-44048239 GAGGCTTGTGGCGGGGGTCGAGG + Intergenic
953610265 3:44441999-44442021 GGTGATTGTGGGTGGGGGGGTGG - Exonic
953657057 3:44862203-44862225 GGGGCTCTTGGGGTGGGGCGGGG + Intronic
953756441 3:45650490-45650512 GGGGCCTGTTGGGGGGGGTGGGG - Intronic
953881540 3:46693735-46693757 GGGGCTGGGCGAAGGGGGCGGGG - Intergenic
953947867 3:47164373-47164395 GCGGGTTGCGGGAGGGGTCGCGG - Intergenic
953982056 3:47417978-47418000 CGGGGTGGTGGGAGGGGGTGCGG + Intronic
954376139 3:50195113-50195135 GGGACTTGTGGGGTGGGGCGGGG - Intronic
954539664 3:51385195-51385217 GTGGCATGTGGGAGGGCGCCGGG + Exonic
954753695 3:52827709-52827731 GCCTCTTGTGGGAGGGAGCGGGG - Intronic
954806803 3:53225300-53225322 GGGACTTGGGGGAGGTGGGGCGG + Intronic
955119204 3:56038922-56038944 GGGGCCTGTGGTAGGTGGTGGGG + Intronic
955235628 3:57136615-57136637 GGGGGTTGGGGGCGGGGGAGGGG - Intronic
955397678 3:58568887-58568909 GGGGCATCTGGGAGGTGGCAGGG - Intronic
955893568 3:63675461-63675483 GGGGCTTTTGGGAGGTGACTAGG + Intronic
956172427 3:66443334-66443356 GGGGGATGAGTGAGGGGGCGGGG + Intronic
956179108 3:66501044-66501066 GGGGCTTGGGGGACCGGCCGGGG - Intronic
957072768 3:75579578-75579600 GGGGCTTGTGGTGGGGGTAGGGG - Intergenic
957931698 3:86886781-86886803 GGGGCCTGTCGGAGGGTGGGGGG + Intergenic
958175602 3:89991931-89991953 GGGCCTTGTGGGAGGTGACTGGG + Intergenic
958621552 3:96569457-96569479 GGGGCTTGTTGGGGGGTGGGGGG - Intergenic
958649664 3:96922805-96922827 GGGGCCTGTGGGACAGGGCTTGG - Intronic
958718800 3:97820940-97820962 AGGGCTTCTGGGAGGCAGCGTGG + Intergenic
958809821 3:98848123-98848145 GGGGCTTTTGGGAGGGTGGGAGG - Intronic
958954023 3:100447438-100447460 GGGGCCTGTTGGAGGGTGGGAGG + Intronic
959351625 3:105272196-105272218 GGGGCTTTTGGGAGGTGACTAGG + Intergenic
959991723 3:112638717-112638739 GGGGCCTGTGGGAGGGTGAGGGG + Exonic
960251823 3:115463799-115463821 GGGGGTGGGGGGAGGGGGGGAGG + Intergenic
960344664 3:116518073-116518095 GGGGCTTGTTGGTGGGGGTTGGG - Intronic
960513455 3:118577454-118577476 GGGACTTGTGAGAGAGGGAGGGG + Intergenic
960550787 3:118973940-118973962 GGGGCTTGTCAGAGGGGCCGGGG + Intronic
960681742 3:120255293-120255315 GGGGCTTGTCGGAGGGGGTGTGG + Intronic
961361235 3:126369012-126369034 GGGGCTAGTGGGAGGGGGAATGG - Intergenic
961378591 3:126482850-126482872 GGGGAATGGGGGAGGAGGCGTGG - Intronic
961516711 3:127442565-127442587 GGTGCTTGGGGCAGGGGGCCTGG - Intergenic
961873070 3:130002406-130002428 GGGGCTTGTGGCGGGGGTAGGGG - Intergenic
961919196 3:130408270-130408292 GGGGGTGGTGGCAGGGGGTGGGG + Intronic
961925979 3:130481198-130481220 GGGGCTTGTCGGGGGGTGGGGGG - Intronic
962148840 3:132870892-132870914 GGGGGCTGAGGGAGGGGGTGAGG + Intergenic
962150531 3:132888482-132888504 GGGGCTTGTCGGCAGGGGTGGGG + Intergenic
962879277 3:139560969-139560991 GGAGCTTGTTGGAGGAGGTGTGG + Exonic
963522531 3:146373161-146373183 GGGTTGTGTGGGAGGGGGTGAGG - Intergenic
963675192 3:148301996-148302018 GGGGCTTGTTGGGGGGTGGGCGG - Intergenic
964234025 3:154504160-154504182 AGGGCCTGTCGGAGGGGGTGGGG + Intergenic
964417756 3:156466138-156466160 TGGGACTGTGGGAGGGGGTGAGG - Intronic
964712668 3:159687752-159687774 GGGGCTTGTCGGAGAGTGAGGGG - Intronic
964878780 3:161400388-161400410 GGGGCCTGTCGGAGGGGGTTGGG + Intergenic
965558497 3:170040013-170040035 GGGGCCTGTCGGAGGGTGGGGGG + Intronic
965600224 3:170447036-170447058 GGGGGTTGGGGGAGGGGGGAGGG + Intronic
965602537 3:170469322-170469344 GGGGAGTGTGGGAGGGAGGGGGG - Intronic
966221826 3:177558931-177558953 GGGAAGGGTGGGAGGGGGCGAGG - Intergenic
966229418 3:177634956-177634978 GGAAATGGTGGGAGGGGGCGAGG - Intergenic
966263525 3:178009180-178009202 GAGGCCTGTCGGAGGGGCCGGGG + Intergenic
966317222 3:178661139-178661161 GGGGCCTGTCGGAGGGTGGGGGG - Intronic
966365762 3:179185792-179185814 AGGGCTTGTGGGAAGGGGTGTGG + Intronic
966488380 3:180497910-180497932 GGGGCCTGTAGGAGGGTGGGAGG - Intergenic
967054335 3:185815753-185815775 GGTGCTGGTGGGAGGGAGAGAGG - Intronic
967392425 3:188970075-188970097 GGGGCCTGTTGGAGGGTGGGGGG - Intronic
967396030 3:189009947-189009969 GGGGCCTGTGGGAGGGCAAGGGG - Intronic
967402840 3:189083075-189083097 GGGGGCTGTGGGTGGGGGCTGGG + Intronic
967487615 3:190052243-190052265 GGGGCTTGTCGGGGGGTGAGGGG - Intronic
967859297 3:194139679-194139701 GAGGCTGGCGGGAGGGGCCGGGG - Intergenic
968090564 3:195895964-195895986 GGGGCCTCGGGGCGGGGGCGTGG - Intronic
968310685 3:197681036-197681058 GGGGATGGGGGGAGGGGACGGGG + Intronic
968379728 4:80985-81007 GGGGCCTGTCAGAGGGGGTGGGG - Intronic
968460379 4:721751-721773 GGGGCCTGTGGGAGGTGGATGGG + Intronic
968515006 4:1012103-1012125 GGGGCGCGGGGGCGGGGGCGGGG - Intronic
968613843 4:1568677-1568699 GGGGTGGGTGGGAGGCGGCGCGG - Intergenic
968613854 4:1568702-1568724 GGGGTGGGTGGGAGGCGGCGCGG - Intergenic
968613887 4:1568779-1568801 GGCGCGGGTGGGAGGCGGCGCGG - Intergenic
968698051 4:2042249-2042271 GGGGCCCGCGGGAGGGGACGGGG + Intronic
968716710 4:2165411-2165433 GGGGCTGGTGGGAGGGAGGGAGG + Intronic
968759106 4:2432970-2432992 GGGGCCTGGGGGTGGGGGCAAGG - Intronic
968816135 4:2822917-2822939 GGGCCCTGTGGGAGGTGGCAAGG - Exonic
968915634 4:3496000-3496022 GGGCCTCGTGGGTGGGGGCTGGG - Intronic
968975974 4:3822235-3822257 GGGGCGTGTAGGAGGTTGCGGGG - Intergenic
969182954 4:5456044-5456066 GGGGGTTGGGGCAGGGGGAGCGG + Intronic
969277438 4:6146224-6146246 GGGGCTGGGGGGAGGTTGCGGGG + Intronic
969340083 4:6535066-6535088 GGGGCTGGTGGGGTGGGGCCAGG + Intronic
969361042 4:6664067-6664089 GGGCCTGGAGCGAGGGGGCGCGG + Intergenic
969441592 4:7220258-7220280 AAGGCTTGGGGGAGGGGGTGGGG + Intronic
969477076 4:7427847-7427869 GGGCCTGGTGCGGGGGGGCGGGG - Intronic
969737580 4:9001436-9001458 GGGGCTTGTGGCGGGGGCAGGGG + Intergenic
969952117 4:10848302-10848324 GGGGCCTGTTGGAGGGTGTGGGG - Intergenic
970320208 4:14867903-14867925 AGGGCTGTGGGGAGGGGGCGGGG - Intergenic
970411574 4:15813600-15813622 GGGGCCTGTCGGCGGGGGTGGGG - Intronic
970456190 4:16226479-16226501 GAGGCTGGAGGGAGGCGGCGGGG - Exonic
970510496 4:16777167-16777189 GTTGCCTGTGGGAGGGGGCTAGG - Intronic
971215938 4:24662255-24662277 GGGGCGGGGGGGGGGGGGCGGGG - Intergenic
971427971 4:26534412-26534434 CTGCCTTGTGGGAGGGGGCATGG - Intergenic
972184504 4:36512626-36512648 GGCGGTTGTGGGGGGGGGCGGGG + Intergenic
972437047 4:39044767-39044789 GGGCCTGGCGGGAGGGGGCGGGG + Intergenic
972698993 4:41475702-41475724 GGGGCCTGTTGGAGGGTGGGGGG + Intronic
972868626 4:43267922-43267944 GAGGCTTGTCGTAGGGGGTGGGG - Intergenic
972984834 4:44750607-44750629 GGGGCCTGTCGGAAGGGGCTGGG - Intergenic
973815401 4:54614631-54614653 GGGGCTTGTGAGAGAGGGAGAGG + Intergenic
973831561 4:54764767-54764789 GGGACTAGTGGGTGGGGGCAGGG + Intergenic
973857384 4:55026679-55026701 GGGGCCTGTGGGAGGGTGGCGGG + Intergenic
973911203 4:55582747-55582769 TGGGCTTGGGGGAGGGGGGAGGG - Intronic
974015763 4:56647529-56647551 GGGGCTTTTGGGAGGTGACCAGG - Intergenic
974196933 4:58586957-58586979 GGGAAGTGTGGGAGGGGGTGAGG + Intergenic
974992626 4:69113660-69113682 GGGGAGGGTGGGAGGGGGTGAGG - Intronic
975006529 4:69295723-69295745 TGGGAGTGTGGGAGGGGGTGAGG - Intronic
975185291 4:71394923-71394945 GGGAAGTGTGGGAGGGGGTGAGG + Intronic
975360221 4:73460948-73460970 GGGGGATGGGGGAGGGGGAGGGG - Intergenic
976188039 4:82462632-82462654 GGGGGTTGGGGGAGGGGGGGAGG - Intergenic
976226477 4:82798595-82798617 GGAGCTCGAGGGTGGGGGCGGGG + Exonic
976552058 4:86408054-86408076 GGGGCTTGTCGGGGGGTGGGGGG - Intronic
976845940 4:89489699-89489721 GGGTGGTGTGGGAGGGGGTGTGG + Intergenic
976983261 4:91259593-91259615 GGGGCCTGTTGGAGGGTGGGGGG - Intronic
976991408 4:91371277-91371299 GGGGCTTGGGGTTGGGGGCACGG - Intronic
977083842 4:92569124-92569146 GGGGCCTGTTGGAGGGTGTGGGG - Intronic
977619304 4:99118634-99118656 GAGCATTGTGGGAGGGGGAGCGG + Intergenic
977752293 4:100623970-100623992 GGGGCTTGTCGGGGGGTGGGGGG - Intronic
977829204 4:101570464-101570486 GGGAAGTGTGGGAGGGGGTGAGG + Intronic
978614742 4:110583258-110583280 GGGGCTTGAGGCTGGGGGAGAGG + Intergenic
978829385 4:113066175-113066197 GGGGCTGGGGGGAGGAGGGGAGG - Intronic
979000425 4:115210350-115210372 GGGGCCTGTCGGAGGGTGGGGGG + Intergenic
979536161 4:121823301-121823323 TGGGCTTTTGGAAGGGGGCCAGG - Intronic
980329603 4:131393369-131393391 TGGGATGGTGGGAGGGGGTGGGG - Intergenic
980930206 4:139177242-139177264 GGGGGTGGAGGGAGGGGGCCGGG - Intergenic
981144411 4:141308572-141308594 TGGGGTTGGGGGAGGGGGCAGGG - Intergenic
981705259 4:147652667-147652689 GGGTCTGGTGGGATGGGGTGGGG - Intronic
981750452 4:148088703-148088725 GGGGCCTGTTGGAGGGTGGGGGG + Intronic
983484249 4:168315578-168315600 GGGGCTTGTCGGAGGGTTGGGGG - Intronic
983586069 4:169356142-169356164 GGGGCCTGTGGGAGGGGGTTGGG + Intergenic
983922912 4:173366397-173366419 GGGGCTTTTAGGAGGTGGTGAGG - Intergenic
984438639 4:179736850-179736872 GGGGCTTGTGGTGGGGTGGGAGG - Intergenic
984946431 4:184972198-184972220 GGGGCTGGAGGGAGGGAGAGAGG - Intergenic
985217509 4:187669963-187669985 GGGCAGAGTGGGAGGGGGCGAGG - Intergenic
985236124 4:187876647-187876669 GGGGCTTGTTGTGGGGTGCGGGG - Intergenic
985452963 4:190070920-190070942 GGGGGTGGTGGGGGAGGGCGTGG - Intergenic
985453952 4:190074213-190074235 GGGGGTGGTGGGGGAGGGCGTGG - Intergenic
985454940 4:190077506-190077528 GGGGGTGGTGGGGGAGGGCGTGG - Intergenic
985456911 4:190084097-190084119 GGGGGTGGTGGGGGAGGGCGTGG - Intergenic
985457899 4:190087393-190087415 GGGGGTGGTGGGGGAGGGCGTGG - Intergenic
985458887 4:190090690-190090712 GGGGGTGGTGGGGGAGGGCGTGG - Intergenic
985463139 4:190173453-190173475 GGGGGTGGTGGGGGAGGGCGTGG - Intergenic
985472998 5:57760-57782 GGGGTTTCTGGGAGGAGGCAGGG - Intergenic
985539642 5:482037-482059 GGGGCTGGGGGGCGGGGGGGGGG - Intronic
985544135 5:500711-500733 GGGGCTGGTGGGTGTGGACGGGG + Intronic
985544169 5:500824-500846 GGGGCTGGTGGGTGTGGACGGGG + Intronic
985670202 5:1203029-1203051 GGGCCCTGGGGGAGGGGGCGAGG - Intronic
985758806 5:1734354-1734376 GGGGCTGGTGTGATGGGGTGGGG + Intergenic
985762171 5:1754910-1754932 GGGGCCTTTGGGAGGGGACGAGG + Intergenic
985783073 5:1881052-1881074 CGGGCCGGTGGGGGGGGGCGGGG + Intronic
985784749 5:1887741-1887763 GGGGCTTGGGAGAGGGGCAGGGG - Intergenic
985965400 5:3335693-3335715 GGGGTGTGTGGGAGGGTGGGAGG - Intergenic
986160482 5:5223492-5223514 GGGGATGGTGGGAGGGGGCAAGG + Intronic
987087590 5:14484760-14484782 GGGGCTTGGGGGTGGGGAAGTGG - Intronic
987089289 5:14497118-14497140 GGGGCTGGTGGGTGGGAGGGAGG - Intronic
987500820 5:18707609-18707631 GGGGCTTGTTGGGGGGTGAGGGG - Intergenic
988700148 5:33665752-33665774 GGGGCTTATGTGATGGGGAGAGG + Intronic
988722439 5:33892147-33892169 GGGGCATGCGGGAGGCGGAGGGG - Exonic
988777552 5:34490834-34490856 GGGGGGTGTTGGCGGGGGCGGGG + Intergenic
989188914 5:38650614-38650636 CGGGCTTGGGGGAGGGGGAGGGG + Intergenic
989314406 5:40060441-40060463 GGGGGTGGGGGGAGGGGGGGAGG + Intergenic
989681701 5:44037210-44037232 GGGGCCTGTCGGAGGGGGTGGGG - Intergenic
989761286 5:45019777-45019799 GGGGCCTGTCGATGGGGGCGGGG + Intergenic
990167071 5:53006051-53006073 GGGGCCTGTCGGTGGGGGCGAGG + Intronic
990207640 5:53446839-53446861 GGGGCTGGGGGGAGGGGCGGCGG + Intergenic
990277643 5:54215085-54215107 GGGGCTTGGGGGTGGGGAGGAGG + Intronic
990888737 5:60624897-60624919 GGGGCCTGTGTGGGGGGTCGGGG - Intronic
990978419 5:61579493-61579515 GGGGCTTGTTTAAGGGGGCATGG + Intergenic
991532117 5:67627113-67627135 GGGGCCTGTTGGTGGGGGTGGGG - Intergenic
991539854 5:67715519-67715541 GGGGGCTGTCGGTGGGGGCGGGG + Intergenic
991584204 5:68186160-68186182 GGGGCTGGCGGCAGGGAGCGTGG - Intergenic
992171448 5:74105814-74105836 GGTGGTTGGGGGAGGGGGGGCGG - Intergenic
992321860 5:75621157-75621179 TTGGCTTGGGGGAGGGGGCAGGG + Intronic
992403895 5:76437528-76437550 GGGGCCTGTGGGAGGGGAGCGGG - Intronic
992567212 5:78009775-78009797 GGGGGGTGGGGGAGGGGGAGAGG + Intronic
992674516 5:79092329-79092351 GGGGATTGAGGGAGGTGGGGAGG - Intronic
992970292 5:82049399-82049421 GGGGGTGGGGGGAGGGGGGGAGG + Intronic
993449873 5:88060301-88060323 GGGGTAGGTGGGAGGGGGTGAGG + Intergenic
993457376 5:88141750-88141772 GGGGGGTGGGGGCGGGGGCGGGG - Intergenic
993901140 5:93584908-93584930 GGGGGGAGGGGGAGGGGGCGGGG - Exonic
993945353 5:94111541-94111563 GGGGCAGGCGGGAGGAGGCGTGG + Exonic
993972377 5:94435288-94435310 GGGGCCTGTTGGAGGGTGGGGGG - Intronic
994524227 5:100882984-100883006 AGGGATTGTGGGAGGGGTGGGGG - Intronic
994670378 5:102755502-102755524 GGGGGTGGGGGGATGGGGCGGGG + Intronic
995524493 5:113039707-113039729 GTGGGTTGGGGGGGGGGGCGCGG - Intronic
995759142 5:115544912-115544934 GGGGCGACGGGGAGGGGGCGGGG + Intergenic
995991207 5:118241857-118241879 GGGGTGTGTGGCAGGGGGCAAGG - Intergenic
996108750 5:119539432-119539454 TGGGGTTGGGGGAGGGGGGGAGG + Intronic
996284894 5:121778211-121778233 GGGAAAGGTGGGAGGGGGCGAGG - Intergenic
996882903 5:128321446-128321468 GGGGCCTGTCGGAGGGTGAGGGG - Intronic
996900712 5:128538671-128538693 GGGGCCGGCTGGAGGGGGCGAGG + Intronic
996958030 5:129209062-129209084 GGGGCCTGTGGTAGGGTGGGGGG - Intergenic
997185422 5:131876996-131877018 TGGGGTGGGGGGAGGGGGCGAGG + Intronic
997630438 5:135364229-135364251 AGGGCCTGTGGGAGGGTGTGGGG + Intronic
997690170 5:135822959-135822981 GGGACTTGGAGGAGGGGGCCTGG + Intergenic
998732042 5:145089590-145089612 GGGGCTTGTGGGGGTGTGGGGGG + Intergenic
998836086 5:146203879-146203901 GGGGCGTGGGGGAGGGGAGGTGG + Intronic
998983951 5:147734489-147734511 GGGGCCTGTTGGAGGGTGGGGGG + Intronic
999093600 5:148958605-148958627 GTGGTTTGTGGGAGGGAGGGGGG + Intronic
999279448 5:150355460-150355482 GGGGCGGGTGGTAGGTGGCGGGG - Intergenic
999436048 5:151564254-151564276 AGGGCCTGTGTGAGAGGGCGTGG + Intronic
999804277 5:155067411-155067433 GGGTCCTGAGGGAGTGGGCGCGG + Intergenic
999868603 5:155728194-155728216 GGGGCTGGAGGGAGGGAGCGAGG - Intergenic
1000052693 5:157575896-157575918 GGGGCTGGAGGGAGGGGCCGGGG + Intergenic
1000570854 5:162912204-162912226 GGGGATTGAGGGAGGAGGAGAGG - Intergenic
1000859863 5:166444688-166444710 GGGGCCTGTCAGAGGGGGTGGGG - Intergenic
1001094770 5:168767707-168767729 GGTGGTGGTGGGAGGGGTCGGGG + Intronic
1001290640 5:170456298-170456320 GGGGCCTGTCGGAGGGTGGGGGG + Intronic
1001587677 5:172844546-172844568 TGGGCTCGTGGGAGGTGGCCTGG + Intronic
1001759014 5:174192409-174192431 GGTGCTTGTGGCACGGGTCGCGG - Intronic
1002091719 5:176810300-176810322 GGGGCTTGGGGTGGTGGGCGTGG - Intergenic
1002158284 5:177300053-177300075 GGGGCGGGGGGGGGGGGGCGCGG - Exonic
1002237514 5:177812678-177812700 GGGGTTTGTGGGTGAGGGTGTGG - Intergenic
1002569306 5:180130978-180131000 GGGGCATGAGGGAGAGGGCGGGG - Intronic
1002660902 5:180790682-180790704 GGGGCGCCTGGGAGCGGGCGGGG + Exonic
1002858594 6:1059404-1059426 GGGGCTTGGGGGAGGGGAGCGGG + Intergenic
1002897435 6:1388012-1388034 GGGGTATGTGGGAGGGGGGTGGG - Intergenic
1002948763 6:1787925-1787947 GCGGCTAGTGGGAGGTGGCATGG + Intronic
1002951870 6:1821362-1821384 GCGGCTGGTGGGTGGGGACGGGG + Intronic
1003071786 6:2950708-2950730 GGGGATTGTTGGATGGGGTGTGG - Intronic
1003218407 6:4135711-4135733 GGGGCTCGGGGGTGGGGCCGGGG + Intergenic
1003218466 6:4135876-4135898 GGGGCTCGGGGGTGGGGCCGGGG + Intergenic
1003688577 6:8328846-8328868 GGGGCCTGTTGGAGGTGGGGTGG + Intergenic
1003902059 6:10663537-10663559 GGGGCCTGTTGGAGGGGTTGGGG - Intergenic
1004181193 6:13381779-13381801 AGGGCTTGGGGGAGGAGGAGGGG - Intronic
1004182042 6:13389602-13389624 GGGGCCTGTTGGGGGGTGCGGGG + Intronic
1004356621 6:14934797-14934819 GGGGTTTGTGGGAGGTGTGGTGG - Intergenic
1004513816 6:16305492-16305514 GGGGGTTGGGGGTGGGGGAGAGG - Exonic
1004806123 6:19205520-19205542 GGGGCATGTGGGCTGGTGCGCGG + Intergenic
1005583097 6:27251580-27251602 GGGGATTGGGGGCGGGGGCCTGG + Intronic
1005583105 6:27251594-27251616 GGGGCCTGGGGGCGGGGGCCTGG + Intronic
1005962907 6:30706026-30706048 GGGGCTTTTGGGGTGGGGCTGGG + Exonic
1005990121 6:30897300-30897322 GGGGCAGGGGGGTGGGGGCGCGG + Intronic
1006009627 6:31031656-31031678 GGGAAGAGTGGGAGGGGGCGAGG - Intronic
1006026248 6:31148834-31148856 GGGGCTGGGGGGAGGGGGGGCGG + Intronic
1006167273 6:32072280-32072302 GGGGCTGGTGGGAGGGGAGCTGG + Intronic
1006303723 6:33207251-33207273 GGGGATTAGGGGAGGGGGCCAGG + Intergenic
1006335840 6:33420241-33420263 AGGCCTGGGGGGAGGGGGCGGGG - Exonic
1006365654 6:33613613-33613635 GGGGCATGGGGGTGGGGGTGAGG + Intergenic
1006377309 6:33678580-33678602 GGGGATGGGGGGTGGGGGCGGGG + Intronic
1006393468 6:33772285-33772307 GGGGCTGGTGGGCTGGGGCATGG - Exonic
1006414071 6:33893063-33893085 GGGGCCGGGGCGAGGGGGCGGGG + Intergenic
1006441677 6:34057266-34057288 GGGGCGTCTGGGAGGAGGAGGGG - Intronic
1006498139 6:34438977-34438999 GGAGGTTGTGGGAGGCGGGGGGG - Intergenic
1006595923 6:35192462-35192484 GGGGGTGATGGGAGGAGGCGAGG + Intergenic
1006615285 6:35321808-35321830 GGGGCTTGAGGGAGGAAGGGAGG - Intergenic
1007174868 6:39888810-39888832 GGGGCTGTTGGGAAGGGGCGTGG - Intronic
1007327236 6:41072271-41072293 GGGTCCTATGGGAGGGTGCGGGG + Intronic
1007367646 6:41406193-41406215 TGGGCTTGAGGGTGGGGGTGGGG + Intergenic
1007521027 6:42452039-42452061 GAGGGTTAAGGGAGGGGGCGAGG - Exonic
1007630380 6:43269975-43269997 GGGGCAGGTGGGGGGGGGTGGGG + Intronic
1007633469 6:43285187-43285209 GGGCCTGGTGCGAGGGGGAGGGG - Exonic
1007721544 6:43888247-43888269 GGGGATAGTGGGAGGGGACCAGG - Intergenic
1007855669 6:44853731-44853753 GGGGCTTCTGGTGGGGGGAGTGG + Intronic
1008368260 6:50707060-50707082 GGAGATGGTGGGTGGGGGCGAGG + Intergenic
1009245121 6:61227910-61227932 GGGGCCTGTCGGGGGGGGGGTGG + Intergenic
1009269279 6:61598091-61598113 GGGTCTTGTGGCAGGGAGTGGGG - Intergenic
1009275367 6:61671987-61672009 TGGGGTTGGGGGAGGGGGCAGGG - Intergenic
1009783207 6:68296879-68296901 GGGGCTTGTGGGGAGGAGTGAGG + Intergenic
1009905605 6:69867234-69867256 GCGGCTTCTGGGGGGCGGCGCGG + Intronic
1009994118 6:70880075-70880097 GGGGCGTGGGGGTGGGGGTGGGG + Intronic
1010289173 6:74115576-74115598 AGGGCTGGTGGGAGGGGTGGAGG + Intergenic
1010297024 6:74210255-74210277 TGGGGTTGGGGGAGGGGGCAGGG + Intergenic
1011264725 6:85503515-85503537 GGGGCCTGTGGTTGGGGGCCAGG + Intergenic
1011297742 6:85841595-85841617 GGGGCCTGTTGGAGGGTGGGGGG - Intergenic
1011300944 6:85873066-85873088 GGGGCTTGTCAGAGGGTGTGGGG - Intergenic
1011350494 6:86417877-86417899 GGGGCTTTGGGAAGGGGGCAGGG - Intergenic
1011368829 6:86610369-86610391 GGGGCCTGTGGGGGGTGGAGTGG + Intergenic
1011415754 6:87118722-87118744 GGGGGTTGGGGGAAAGGGCGGGG - Intergenic
1012149025 6:95722105-95722127 GGGCCTTTTTGGAGGTGGCGGGG + Intergenic
1012355337 6:98307558-98307580 GGGGCCTATTGGAGGGGGGGAGG - Intergenic
1012479779 6:99653688-99653710 GGGGCTTGTAGTAGGGTGGGGGG - Intergenic
1012550961 6:100464572-100464594 GGGGCTGCTGGGCGGGCGCGGGG + Intronic
1012870312 6:104665190-104665212 GGGAAGTGTGGGAGGGGGAGAGG + Intergenic
1012952042 6:105528596-105528618 GAGGCTTGTGGGAGGGAGAAGGG + Intergenic
1013957726 6:115859926-115859948 GGGGCTTGTTGGTGGGTGGGAGG + Intergenic
1014140697 6:117938842-117938864 GGGGCCTGAGGGCGGGGGAGGGG - Intronic
1014367747 6:120565144-120565166 GGGGCCTGTTGGAGGAGGAGTGG + Intergenic
1014379381 6:120721028-120721050 GGGGCCTATCGGAGGGGGTGGGG - Intergenic
1014797158 6:125738683-125738705 GGGGGTGGGGGGAGGGGGAGTGG + Intergenic
1015084050 6:129265704-129265726 GGGGCCTGTCGGAGGGTGGGGGG + Intronic
1016122158 6:140357598-140357620 GGAGGATGTGGGAGGGGGCATGG - Intergenic
1016201967 6:141421386-141421408 TGGGGTTGGGGGAGGGGGGGAGG - Intergenic
1016614154 6:146028020-146028042 GGGGGCTATGGGAGCGGGCGAGG - Intronic
1016877298 6:148877510-148877532 GGGGGTTGTGTGTGGGGGCAGGG + Intronic
1017090872 6:150757854-150757876 GGGCCTGTTGGGAGGGGGTGAGG - Intronic
1017164003 6:151391064-151391086 GGGTTTTGTGGGAGGGGGAGGGG - Intronic
1017972759 6:159327401-159327423 GAGACTGGTGGGAGGGGGTGTGG - Intergenic
1018006957 6:159631239-159631261 GGGGCTTGTGGGTGGGGTGGGGG + Intergenic
1018876686 6:167827367-167827389 TGGGCCTGGGGGAGGGGGAGGGG - Intronic
1019061323 6:169260134-169260156 GGGGATAGGGGGAGGGGGCTTGG - Intergenic
1019104927 6:169660186-169660208 GGGTCTTGGGGGAGGGGGTGGGG + Intronic
1019173747 6:170149326-170149348 AAGGCTTGTGGTGGGGGGCGAGG - Intergenic
1019338168 7:494770-494792 GGGGCTTCTGTGAGGGAACGGGG + Intergenic
1019381683 7:727376-727398 GGGGGTTGTGAGAGGGGCCGCGG - Intronic
1019390354 7:783342-783364 GGTGAGTGTGGCAGGGGGCGTGG + Intronic
1019605255 7:1907012-1907034 GGGGCTTGGGGGCGGGGCAGTGG - Intronic
1019609656 7:1930249-1930271 GGGGACTGTGCGAGGGGACGTGG - Intronic
1019611951 7:1941136-1941158 GGGACTTGCAGGAGGGGTCGGGG + Intronic
1019707272 7:2502686-2502708 GTGGCTCGTGGGAGGGGGCCTGG - Intergenic
1020007987 7:4792375-4792397 GGGGATTGGGGGCGGGGCCGAGG - Intronic
1020035188 7:4959745-4959767 GGGACTTGGGGGTGGGGGAGCGG + Intergenic
1020080343 7:5283160-5283182 CGGGCGGGCGGGAGGGGGCGGGG - Intronic
1020083068 7:5296756-5296778 GGGGCCTGTGGGTGGGGGCAGGG + Intronic
1020083085 7:5296794-5296816 GGGGCCTGTGGGTGGGGGCAGGG + Intronic
1020104397 7:5415144-5415166 GGAGCTGGTGGGAGGGGATGTGG - Intronic
1020261117 7:6531267-6531289 GGGGCTACCTGGAGGGGGCGGGG - Intronic
1020278288 7:6637463-6637485 GGGGCCGGTGGGCGGCGGCGCGG + Intronic
1020431860 7:8123400-8123422 GTGGATTGTGAGAGGGGGTGAGG + Intronic
1020457265 7:8388069-8388091 AGGGCATGAGGGAGGGGGCTAGG - Intergenic
1020462576 7:8441926-8441948 GGGGTCTGTGGGGGTGGGCGGGG + Intronic
1020510271 7:9047734-9047756 GGATCTGGTGGGAGGGGGGGTGG + Intergenic
1021740316 7:23680120-23680142 GAGGCGGGCGGGAGGGGGCGCGG + Exonic
1021747046 7:23751959-23751981 GGGGCTTGGGGGAGGGGGAGGGG + Intronic
1021969375 7:25951403-25951425 GGCGCGTGGGGGCGGGGGCGGGG + Intergenic
1022088145 7:27088437-27088459 GGGGCTGCGGGGAGCGGGCGGGG - Intergenic
1022383752 7:29884012-29884034 GGGTGGGGTGGGAGGGGGCGGGG - Exonic
1022410727 7:30136430-30136452 GGGCCTTGTGGGCGGAGGTGGGG + Intronic
1022423657 7:30247076-30247098 GGTGCTGGTGGCAGGGGGTGTGG + Intergenic
1022517264 7:30983986-30984008 GGGGTCTGGGGCAGGGGGCGGGG - Intronic
1022648267 7:32251618-32251640 AGGGGTTGTGTGAGGGGGCAGGG - Intronic
1022686427 7:32601561-32601583 GGGGCCTGTCGGAGGGTGGGAGG + Intergenic
1023177643 7:37448822-37448844 GGGGCGAGCGGGAGCGGGCGAGG - Exonic
1023527462 7:41119539-41119561 GGGAAGAGTGGGAGGGGGCGAGG - Intergenic
1023842377 7:44104626-44104648 GGGGCTCCGGGGAGGGCGCGGGG - Exonic
1023972114 7:44999656-44999678 GGGGCCGGCGGGAGGGGACGCGG - Intronic
1024103769 7:46059871-46059893 GGGGCTTGCGGGCTGGGGCCTGG - Intergenic
1024260934 7:47573363-47573385 CGGGCTGGTGGGAGGCAGCGTGG - Intronic
1024306933 7:47937254-47937276 GGGGGTGGGGGGGGGGGGCGCGG + Intronic
1024394316 7:48848275-48848297 GGCGGTTGCGGGAGGGAGCGGGG - Intergenic
1024400950 7:48924370-48924392 GGCGGTTGCGGGAGGGAGCGGGG + Intergenic
1024744859 7:52394292-52394314 GGGGAAAGAGGGAGGGGGCGAGG - Intergenic
1024856471 7:53786185-53786207 TGGGCTTGGGGGAGGGGGAAGGG + Intergenic
1024872612 7:53983526-53983548 GGGGGGTGGGGGAGGGGGTGTGG + Intergenic
1024885257 7:54134903-54134925 GGGGCCTATGGGAGGGTGGGGGG - Intergenic
1025113891 7:56241462-56241484 GGGGCTTGTTGGAGGGGCGGGGG - Intergenic
1025581308 7:62721835-62721857 GGGGGTGGGGGGAGGGGGCAGGG + Intergenic
1026500733 7:70941396-70941418 GGGGCCTGTGGGAGGGTGGAGGG + Intergenic
1026641472 7:72129924-72129946 GGGCCTGGTGGGAGGGGTCTCGG + Intronic
1026894133 7:74000285-74000307 GCGGCGGGTGGGGGGGGGCGGGG + Intergenic
1026927074 7:74201851-74201873 GAGGCTTGTGGGGGGAGGTGGGG - Intronic
1027230092 7:76267528-76267550 GTGGCATGGGGGCGGGGGCGGGG + Intronic
1027349848 7:77300283-77300305 GGGAAGAGTGGGAGGGGGCGAGG - Intronic
1028078066 7:86539111-86539133 GGGGCCTGGGGGAGGAGGAGAGG + Intergenic
1028510357 7:91618881-91618903 GGGGTTTCTGGGAGGGGGCATGG - Intergenic
1028802010 7:94977102-94977124 GGGGCTTGTGGGAGTAAGAGGGG + Intronic
1028883749 7:95909238-95909260 GGGGGTGGGGGGGGGGGGCGGGG + Intronic
1028884861 7:95920245-95920267 GGGGTTTGTGGGTGTGGGGGAGG - Intronic
1029005984 7:97210210-97210232 GGGGCCTGTTGGAGGGGGTGGGG - Intergenic
1029146861 7:98452580-98452602 GAGGGTGGTGGGAGGGGGCAGGG - Intergenic
1029177239 7:98673577-98673599 GGGTCTTGTGGGAGGTGTCTGGG - Intergenic
1029191045 7:98772579-98772601 GGGGCCTGTGGGATGGAGCTTGG - Intergenic
1029194270 7:98793777-98793799 GGGGGTTGTGGCAGTGGGTGAGG - Intergenic
1029374196 7:100168192-100168214 GGGGCTTGTTGGAGGGGCCGTGG - Intronic
1029375907 7:100176982-100177004 GGGGGTGGGGGGCGGGGGCGGGG - Intronic
1029450892 7:100641338-100641360 GGGGCGTGGGGGAGGGGCAGGGG + Intronic
1029599221 7:101553938-101553960 GCGGCTTCTGGGAGGAGGAGGGG + Intronic
1029644377 7:101844186-101844208 TGGGGTTGGGGGCGGGGGCGGGG - Intronic
1029675198 7:102063935-102063957 GGTGGTGGTGGGAGGGGCCGCGG + Intronic
1029708154 7:102286265-102286287 AGGGCTGCAGGGAGGGGGCGTGG + Intronic
1030033472 7:105388991-105389013 GGGGCCGGCGGGTGGGGGCGGGG - Intronic
1030382437 7:108827869-108827891 GGGGCTTGGGGGAGGGGCAAAGG - Intergenic
1030728274 7:112952773-112952795 GGGGCCTGTTGGAGGGTGCTGGG - Intergenic
1030742435 7:113125951-113125973 AGGACTTGTGGGTGGGTGCGGGG - Intergenic
1031101583 7:117486875-117486897 GGGGTGGGGGGGAGGGGGCGGGG + Intronic
1031699589 7:124906478-124906500 GGGGCTTGTCGTAGGGTGGGGGG + Intronic
1031709885 7:125032252-125032274 GGGGCTTGTGGGAGGTGGGCAGG - Intergenic
1032077447 7:128842717-128842739 GGTGGGTCTGGGAGGGGGCGGGG + Intronic
1032168778 7:129566900-129566922 GGGGATGGTGGGGGGGGGGGGGG - Intergenic
1032181032 7:129677989-129678011 GGGGAAGGGGGGAGGGGGCGGGG + Intronic
1032888957 7:136172769-136172791 GGGGCCTGTCGGAGGGTGAGGGG + Intergenic
1033064978 7:138145787-138145809 GGGGCTGGTGGAGGGGGGCGTGG + Intergenic
1033253021 7:139777354-139777376 GGGGCGTGTGCGAGGGTGGGCGG - Intronic
1033493727 7:141871851-141871873 GGGGCCTGTAGGAGGGTGGGGGG + Intergenic
1033756892 7:144403594-144403616 GGGGGTTCGGGGAGGGGGGGAGG - Intronic
1034324704 7:150220202-150220224 GGGGCTTGTGCGGGGGCGTGGGG - Intergenic
1034376632 7:150650621-150650643 GGGAAATGTGGGAGGGGGCGAGG - Intergenic
1034400256 7:150857310-150857332 GGGGCTTGTGGGAGGAGAAGAGG - Exonic
1034417181 7:150971353-150971375 GCGGCTGTTGGGAGGGGGTGGGG - Intronic
1034549141 7:151809266-151809288 GGGGTGTGTGGGAAGGGGCCGGG - Intronic
1034618115 7:152436138-152436160 GCGGCTCGGGGGAGGGGCCGCGG - Intergenic
1034675546 7:152890378-152890400 GGGCCTGGTGGGAGGGTGGGAGG + Intergenic
1034768488 7:153749029-153749051 GGGGCTTGTGCGGGGGCGTGGGG + Intergenic
1034884216 7:154785586-154785608 GGGACTTGTAGGAAAGGGCGGGG - Intronic
1035274761 7:157741117-157741139 GGAGCCTGTGGAAGGAGGCGTGG - Intronic
1035384017 7:158458526-158458548 GGGGCTGTTGGGTGGGGGCGTGG - Intronic
1035400836 7:158564589-158564611 GGGGCTTGGGGGCTGGGGCCAGG - Intronic
1035529265 8:338036-338058 GGGGCTTTTGGGAGGTGATGAGG + Intergenic
1035602140 8:902933-902955 TGGGCAGGTGGGTGGGGGCGGGG + Intergenic
1035634488 8:1133998-1134020 GGGGCCTGTGGGAGGTGGAGGGG - Intergenic
1035656616 8:1312527-1312549 GGGGCTTGGGGGAGAGGGAACGG + Intergenic
1035662046 8:1355780-1355802 GGGGGTTGTGGGAGGAGACAGGG - Intergenic
1035677745 8:1467245-1467267 GGGGCTGGGGGGAGGGACCGTGG - Intergenic
1035683831 8:1508421-1508443 GGGGTTTGCGGGGGGGGGTGGGG - Intronic
1036021529 8:4852264-4852286 GGGCCTTGTGGGAGGTGCTGGGG + Intronic
1037033909 8:14142707-14142729 GGGCCTGGTGGGAGGTGACGAGG + Intronic
1037288760 8:17328555-17328577 GGGGCCTGTTGGCGGGGGTGGGG + Intronic
1037482072 8:19314104-19314126 GGGGCTTGCAGGGGGTGGCGGGG + Intronic
1037659694 8:20916175-20916197 GGGGCATGGGGGAGGAGGCAGGG - Intergenic
1037805408 8:22055800-22055822 GGGGCTTGAGGGAAGAGGCCAGG - Intronic
1037839233 8:22232191-22232213 CGGGCTGGTGGGAGGGGGAAAGG + Exonic
1037930610 8:22878059-22878081 GGGGGGTGTGGGAGGAGGTGGGG - Intronic
1038002359 8:23403120-23403142 TGGGCTGGTGAGAAGGGGCGCGG + Intronic
1038055410 8:23853294-23853316 GCGGGTGGTGGGAGGGGGTGGGG - Intronic
1038292148 8:26259520-26259542 GGGGCATTTGGGAGGGAGCCAGG + Intergenic
1038509561 8:28118875-28118897 GGGGCGTGGGGGGCGGGGCGGGG - Intronic
1038575553 8:28701313-28701335 GGGGATTGTGGGAGGCGCGGGGG - Exonic
1038610447 8:29055856-29055878 GGGGAGTGTGGGATGGGGTGGGG + Intronic
1039429821 8:37517084-37517106 GGGGGTGGTGGCAGGGGGCTTGG - Intergenic
1039902293 8:41761875-41761897 TGGGGTTGTGGGTGGGGGCTGGG - Intronic
1040279569 8:46032123-46032145 GGAGCTTCTGGGAGGGTGCCAGG - Intergenic
1040932211 8:52747187-52747209 GGCCCTTGTGGGAGGGGGCAAGG - Intergenic
1041206755 8:55507503-55507525 GGGGCCTGTTGTAGGGTGCGGGG - Intronic
1041364648 8:57089138-57089160 GGGGCCTGTTGGAGGGGTGGGGG - Intergenic
1041708882 8:60875341-60875363 GGGCTTTGTGGGAGGGGATGTGG + Intergenic
1041755369 8:61307827-61307849 TGGGAGTGTGGGAGGGGGAGGGG - Intronic
1041903521 8:63007845-63007867 GGGGCCTGTGGGGGGAGGCGGGG + Intergenic
1042253002 8:66775162-66775184 GGGGCCTGCCGCAGGGGGCGGGG + Exonic
1042307730 8:67348860-67348882 TGGGGGTGTGGGAGTGGGCGGGG + Intergenic
1042843103 8:73144459-73144481 GGGTCCTGTTGGTGGGGGCGGGG + Intergenic
1044228149 8:89742853-89742875 GGCAATTGTGGGAGGGGGTGAGG + Intergenic
1044591448 8:93917274-93917296 GGGGGCTGGGGGCGGGGGCGGGG + Intronic
1045064224 8:98431302-98431324 GAGGCTTGTGGGAGGCTGGGAGG + Exonic
1045154991 8:99458057-99458079 GGGGTTGGGGGGAGGGGGGGGGG - Intronic
1045277730 8:100722292-100722314 GGGGCTCGGGCGAAGGGGCGGGG + Exonic
1045369328 8:101505626-101505648 GGGGCTTGTGGGAGGGTTGAGGG + Intronic
1045745721 8:105418873-105418895 GGGGCTTGAGGTTGGGGGTGGGG + Intronic
1045868174 8:106893134-106893156 GGGGCCTGTAGGAGGGTGGGGGG - Intergenic
1045996657 8:108370352-108370374 GAGGCATGTGAGAAGGGGCGTGG - Intronic
1046568386 8:115930685-115930707 GGGGGTTGGGGGGGGGGGTGGGG + Intergenic
1047097375 8:121639866-121639888 GGGGCCTGTGGGAGCTGGGGTGG - Intronic
1047150077 8:122250274-122250296 TGGGGTGGTGGGAGGGGGCAGGG + Intergenic
1047530614 8:125670970-125670992 GGGAAGTGTGGGAGGGGGTGAGG - Intergenic
1047669712 8:127132158-127132180 GGGGCCTGTCGGAGGGTGGGGGG + Intergenic
1048375486 8:133818947-133818969 GGGGCGGGGGGCAGGGGGCGGGG + Intergenic
1048415381 8:134222456-134222478 GGGGAGGGTGGGAGGGGGTGAGG + Intergenic
1048484224 8:134832139-134832161 GGGGCGGGGGGCAGGGGGCGCGG + Intergenic
1048906593 8:139095087-139095109 GGGGATTTTGAGAGGGGGTGTGG - Intergenic
1049233236 8:141494990-141495012 GGGAGATGTGGGTGGGGGCGTGG + Intergenic
1049250180 8:141584014-141584036 GGGGCCTATGGGAGGGGAGGGGG + Intergenic
1049306259 8:141905872-141905894 GGGGCGTGGGGGCGGGGGAGGGG + Intergenic
1049323634 8:142010613-142010635 GTGGGTAGTGGGAGGGAGCGAGG - Intergenic
1049396355 8:142402960-142402982 GGGGCTTGCGGGAGGCCGGGCGG - Intronic
1049510072 8:143022817-143022839 GTGGCCTGTGGGAGGGGCAGGGG + Intronic
1049541396 8:143210761-143210783 GGGGCTTGAGGGAGGCTGCGTGG + Intergenic
1049542409 8:143214587-143214609 GGGGCTCCTGGGAGGGGGGTGGG - Intergenic
1049564725 8:143332059-143332081 GGGGGGTGTTGGAGGGGGTGGGG + Intronic
1049718446 8:144104600-144104622 GGGCTCTGTGGAAGGGGGCGAGG + Exonic
1049719741 8:144110296-144110318 GGGCCTTGTCGGAGGGGAGGGGG - Intronic
1049785080 8:144446657-144446679 GAGGCTTGAGGGAGGGAGTGGGG + Intergenic
1049867871 8:144950632-144950654 GGGGGTTGTGGGAGCGCGGGGGG - Intronic
1050417181 9:5429954-5429976 GTGGGTTGTGGCAGGGGGAGAGG - Intronic
1050678009 9:8078404-8078426 GGGGCCTGTCAGTGGGGGCGAGG + Intergenic
1051079585 9:13279283-13279305 GGCGCTTGGGGGTGGGGGTGGGG - Intronic
1051339792 9:16100839-16100861 GGGGCAGATGGGAGGGGGCCTGG + Intergenic
1051669925 9:19499304-19499326 GGGGCCTGTCGGAGGGGTGGGGG - Intergenic
1051785993 9:20744159-20744181 GGTGGTTGTGGGAGGAGGAGGGG + Intronic
1052386706 9:27831263-27831285 GGGGCCTGTGGGAGTGGCAGGGG - Intergenic
1052757065 9:32551986-32552008 GAGGCGTGGGGGAGGGAGCGGGG + Intronic
1052781206 9:32783373-32783395 GGGGCTGCTGGGAGCGGCCGGGG - Intergenic
1052823864 9:33161325-33161347 GGGGCTTGGGGGTGGGGGACAGG - Intronic
1052835203 9:33245331-33245353 GGGACTTGGGTGAGGGGGCTGGG - Intronic
1053123825 9:35563902-35563924 GGGGCTAGAGGAAGGAGGCGGGG + Intergenic
1053156209 9:35781396-35781418 GGGGGTGGGGGGAGGGGGTGGGG + Intergenic
1053269511 9:36740389-36740411 GGGCCTGGAGGGAGGGGGCATGG - Intergenic
1053413446 9:37930408-37930430 GGGGGATGTGGCAGGGGGAGGGG + Intronic
1053438438 9:38093956-38093978 GGGGCATGTGGGAGAGCGCTGGG + Intergenic
1053443869 9:38136751-38136773 TGGGCTTGGGTGAGGGGGTGGGG - Intergenic
1054260919 9:62864468-62864490 GGGGGTTGGGGGCGGTGGCGGGG - Intergenic
1054731473 9:68705781-68705803 GGGTCTAGTGGGAAGGGGCCGGG - Intronic
1054792134 9:69266180-69266202 GGGCCTTGTGAGAGGGAGCCTGG + Intergenic
1055479884 9:76699040-76699062 GGGGATGGAGGGAGGGGGTGGGG - Intronic
1055497367 9:76868831-76868853 GGGGGGTGGGGGGGGGGGCGGGG + Intronic
1055819144 9:80240764-80240786 GGGGCCTGTTGGTGGGGGCGAGG + Intergenic
1056188819 9:84164857-84164879 GGGGCTTGTAGGAGGTGACTGGG + Intergenic
1056257864 9:84818784-84818806 GGGCCTGGTGGGAAGGGGTGTGG + Intronic
1056406844 9:86282787-86282809 GGAGCGGGCGGGAGGGGGCGAGG + Intergenic
1056470491 9:86900895-86900917 GGGGCTTGAGGGAGGGGGAAAGG + Intergenic
1056500189 9:87201268-87201290 GGTCCTTGGGGGAGGGGGAGTGG - Intergenic
1056666914 9:88588488-88588510 GGGGCCTGTGGGAGGGGATGAGG + Intergenic
1056674907 9:88667147-88667169 GGAGCCTGTCAGAGGGGGCGTGG - Intergenic
1056752966 9:89364939-89364961 GGGGGTTTTGGGCGGGGGGGAGG + Intronic
1057397053 9:94689665-94689687 GGGGCTGGTGGGAAGGCGGGAGG - Intergenic
1057420176 9:94905883-94905905 GGGGCTGGGGGGAGGGGGCCGGG + Intronic
1057476953 9:95411278-95411300 GGTGGCTGTGGGAGTGGGCGGGG + Intergenic
1057489701 9:95511302-95511324 GGAGATTGAGGGAGGGAGCGGGG - Intronic
1057991997 9:99780402-99780424 GGGAAGAGTGGGAGGGGGCGAGG - Intergenic
1058139509 9:101342522-101342544 GGGGAGAGTGGGAGGGGGAGGGG + Intergenic
1058968893 9:110062245-110062267 GGGGCCTCTTGGAGGGGGTGGGG - Intronic
1059022683 9:110593683-110593705 GGGGCCCGTGGGAGGGTGGGGGG - Intergenic
1059142811 9:111870213-111870235 GGGGCTTTTGGGAGGTGATGAGG + Intergenic
1059244052 9:112834492-112834514 GAGGCGTGGGGGAAGGGGCGTGG + Intronic
1059248927 9:112871020-112871042 GGGAGATGTGGGAAGGGGCGTGG + Exonic
1059283130 9:113151341-113151363 GCGGCTTGAGAGTGGGGGCGCGG + Intronic
1059285977 9:113171990-113172012 GGGGGTTGGGGGACGGGGGGAGG - Intronic
1059654561 9:116345837-116345859 GGGGCTTGGGGGAGTGGGACAGG + Intronic
1059768217 9:117403749-117403771 GGGTGTTGTGGGAGCAGGCGGGG - Intronic
1059803235 9:117772140-117772162 GGGGCCTGTAGGAGGGTGGGGGG + Intergenic
1060280622 9:122213555-122213577 GGGCCTGCGGGGAGGGGGCGCGG - Intronic
1060636072 9:125200590-125200612 GGGGCTGGAGGGTAGGGGCGAGG + Exonic
1060823353 9:126673772-126673794 AGGGGTGGTGGGAGGGGCCGGGG + Intronic
1060934320 9:127506734-127506756 GTGCCTTGTGGGTGGAGGCGGGG - Exonic
1061194919 9:129102368-129102390 GGGGCTTGTAGGTGTGGGTGGGG + Intronic
1061201720 9:129141942-129141964 GGGGCCTGGGGGAGAGGGGGTGG + Intronic
1061264798 9:129498570-129498592 TGGGCATGTGGGAGCGGGAGAGG + Intergenic
1061680638 9:132241115-132241137 GGGCCTAGTGGGACGGGGCAGGG + Intronic
1061757805 9:132827530-132827552 GGGGCTGGCGGGAGGGTGGGGGG - Intronic
1061920101 9:133778018-133778040 GGGGCTTGGTAGAGGGGCCGAGG + Intronic
1062031777 9:134365091-134365113 GGTGCTGGCAGGAGGGGGCGGGG + Intronic
1062032698 9:134369160-134369182 GGGGCTTGTGTGTGTGTGCGTGG + Intronic
1062069842 9:134549697-134549719 GGGGTTTGTGGGAGAAGGCAGGG + Intergenic
1062111159 9:134782769-134782791 TGGCCGTGTGGGAGGGGGTGGGG + Intronic
1062150818 9:135018264-135018286 GTGGCTTGGGGGAGGGCCCGTGG - Intergenic
1062526181 9:136978866-136978888 GGGGATTGGGCGTGGGGGCGGGG + Intronic
1062568817 9:137175193-137175215 GGGGCCAGGGGGCGGGGGCGAGG - Intronic
1062590704 9:137273232-137273254 GGGGCCTGAGGGTGGGGGCGGGG + Exonic
1062625040 9:137438745-137438767 GGGCCCTGTGGGAGGGGGGCGGG + Intronic
1062681595 9:137784967-137784989 CAGGCTTGTGGGAGGGGGTGAGG + Intronic
1062728819 9:138096982-138097004 AGGGCTTGTGGGAGGGTGTGTGG + Intronic
1202777432 9_KI270717v1_random:3574-3596 GGGGCTTGTCGGGGGGTGGGAGG - Intergenic
1203471030 Un_GL000220v1:115538-115560 GAGGCGTGGGGGGGGGGGCGGGG - Intergenic
1203478851 Un_GL000220v1:159510-159532 GAGGCGTGGGGGGGGGGGCGGGG - Intergenic
1185631268 X:1517410-1517432 GGTGTTTGTGGGATGGGGCGGGG - Intronic
1185778992 X:2829391-2829413 GAGGCTTGGGGAGGGGGGCGCGG + Intronic
1185937449 X:4274947-4274969 GGGAAGAGTGGGAGGGGGCGAGG - Intergenic
1185938499 X:4285924-4285946 GGGGCTTTTTGGAGGTGGAGAGG + Intergenic
1186036805 X:5431901-5431923 GTGGATTGTGGGAGGGGTGGGGG - Intergenic
1186208190 X:7221955-7221977 GGGGCTTTTGGGAGGTGAAGAGG + Intronic
1186313001 X:8340562-8340584 GGGCCTGGTGGGAGGGGACTGGG - Intergenic
1186548701 X:10479473-10479495 GGGAGTTGTGGGAGTGGGGGTGG - Intronic
1186914034 X:14200831-14200853 GGGGGTTGGGGGAGGGGGGAGGG - Intergenic
1186949904 X:14612813-14612835 GGGGCCTGTCGGAGGGTGGGGGG + Intronic
1187067347 X:15854395-15854417 GGCGCTTTCGGGAGGGGCCGGGG - Intronic
1187124367 X:16440016-16440038 GGGGCCTGTTGGCGGGGGCGGGG - Intergenic
1187127637 X:16469124-16469146 GGGTCTTGTGGGACAGGGCATGG + Intergenic
1187194827 X:17072818-17072840 GGGGTTTGTAGGAGGGAGGGAGG + Intronic
1187925057 X:24242341-24242363 GGGGCTAGTGGGAGTGGGATAGG - Intergenic
1188236810 X:27741405-27741427 GGGGCATGGGGGTGGGGGCAGGG - Intronic
1188318070 X:28700705-28700727 GGGGCCTGTCGGAGGGTGGGAGG - Intronic
1188584275 X:31753156-31753178 GGGGTGTGAGGGAGGTGGCGAGG + Intronic
1189010547 X:37042646-37042668 AGGGCGTGTGGGATGGGGTGGGG - Intergenic
1189035860 X:37492909-37492931 AGGGCATGTGGGATGGGGTGGGG + Intronic
1189182602 X:39018093-39018115 GGGGTTTGGGGGAGGGTGGGTGG - Intergenic
1189977792 X:46479739-46479761 GGGGCTTGTCGGGGGGTGGGGGG - Intronic
1190280259 X:48924533-48924555 GGGGCTTGTGGGCTGTGGCGAGG - Intronic
1190580953 X:51893063-51893085 GGAGCTTGTGGGGGCGGGCAGGG + Intronic
1190735048 X:53250579-53250601 GGGGCTGGTGGCAGGGGCCCTGG + Exonic
1191672813 X:63764801-63764823 GGGGCTTGTTGGTGGGGCTGGGG + Intronic
1191777968 X:64838416-64838438 GGGAAGAGTGGGAGGGGGCGAGG - Intergenic
1192211203 X:69129052-69129074 GGGGCTTGAGGGTGGGGTCCAGG - Intergenic
1192274512 X:69616023-69616045 GCCGCTTGAGGGATGGGGCGGGG + Intergenic
1192511045 X:71720584-71720606 CGGGATTGTGGGAAGGGGCACGG - Intergenic
1192515652 X:71760969-71760991 CGGGATTGTGGGAAGGGGCACGG + Intergenic
1192528860 X:71869723-71869745 CGGGATTGTGGGAAGGGGCATGG + Intergenic
1192555954 X:72089443-72089465 AGGGCTTGTAGGAGGTGGCTGGG + Intergenic
1192656958 X:73002899-73002921 GCGGCGTGTGGTGGGGGGCGGGG - Intergenic
1192665162 X:73080102-73080124 GCGGCGTGTGGTGGGGGGCGGGG + Intergenic
1192679421 X:73236334-73236356 ATGGCTTGTGGTATGGGGCGGGG - Intergenic
1192717085 X:73655059-73655081 GGGGCTTGTCAGAGGGTGGGAGG - Intronic
1192722615 X:73715595-73715617 TGGGAGTGTGGGAGGGGGAGGGG - Intergenic
1192947147 X:75976629-75976651 GGGAAGAGTGGGAGGGGGCGAGG - Intergenic
1193003798 X:76592655-76592677 GGGGCCTGTTGGAGGGTGGGGGG - Intergenic
1193292360 X:79790110-79790132 GAGGCATGTCGGTGGGGGCGTGG - Intergenic
1193370166 X:80686264-80686286 GGGGGTTGGGGGAGGGGGGAGGG + Intronic
1193445076 X:81591542-81591564 TGGGGTGGTGGGAGGGGGCAGGG - Intergenic
1193786034 X:85760677-85760699 AGGGCTGTTGGGAGGGGGCACGG - Intergenic
1193934158 X:87595161-87595183 TGGGGTTGGGGGAGGGGGCAGGG - Intronic
1193959508 X:87907050-87907072 GGGGCCTGTTGGTGGGGGCGAGG + Intergenic
1194125865 X:90015746-90015768 GGGCCTTGTGGGAGGTGTTGGGG - Intergenic
1194316486 X:92383477-92383499 GGGGCCTGTTGGAGGGTGTGGGG - Intronic
1194930916 X:99886476-99886498 GGGGCTTGTGGAGGGGGGGGGGG + Intergenic
1194977383 X:100408860-100408882 CGGGCTGGAGGGAGGGGGCTCGG - Exonic
1194989515 X:100531338-100531360 GGGGCCTGTTGGAGGGGTAGCGG - Intergenic
1195247764 X:103011121-103011143 GGGGCCTGTTGGAGGGTGGGGGG - Intergenic
1195270175 X:103221029-103221051 GGTGGTTGGGGAAGGGGGCGGGG - Intergenic
1195298795 X:103507039-103507061 GGGGCTTGTTGGGGGGTGGGGGG - Intronic
1195512380 X:105731801-105731823 GGGGCTTGGGGGAGGAAGAGAGG + Intronic
1195713912 X:107799139-107799161 GGGACTTGTTGGTGGGGGTGGGG + Intergenic
1195877899 X:109561471-109561493 GGGCCTGGTGGGAGGTGTCGGGG + Intergenic
1196078261 X:111601480-111601502 GGGGCCTGTGGGGGGTGGGGTGG + Intergenic
1196132559 X:112172995-112173017 GGGGCCTGTTGGGGGGGTCGGGG + Intergenic
1196185388 X:112739843-112739865 GGGGTATGGGGGAGGGGGCTTGG + Intergenic
1196185406 X:112739910-112739932 GGTGTTTGGGGGAGGGGGAGTGG + Intergenic
1196332216 X:114485696-114485718 GGGGCCTGTCGGAGGGTGGGCGG - Intergenic
1196423523 X:115546255-115546277 GGGAGTTGAGGGAGGGGGTGAGG + Intergenic
1196871431 X:120116279-120116301 AGGGGTTGTGGGTGGGGGTGAGG + Intergenic
1197537090 X:127703869-127703891 GGGGCTTGTGGGGGGGAGGTGGG - Intergenic
1197540891 X:127759316-127759338 GGGGCTTGTCGGGGGGTGGGGGG - Intergenic
1197707657 X:129646245-129646267 GGGGCTTGGGGGAGGTGGATAGG + Exonic
1198175590 X:134151365-134151387 GGGGCTAGTGGGAGGTGTCTGGG - Intergenic
1198177885 X:134173372-134173394 GGGGGTTGGGGGGGTGGGCGGGG + Intergenic
1198241962 X:134796332-134796354 GAGGCTTGGGGACGGGGGCGGGG + Intronic
1198440640 X:136659865-136659887 TGGCCTTGTTGGAGGGGGCCAGG + Exonic
1198717681 X:139577890-139577912 GGGAAGTGTGGGAGGGGGCGAGG - Intergenic
1199226214 X:145377850-145377872 GGGGCTTGTGGGAGGTGATTAGG + Intergenic
1199684386 X:150253779-150253801 TGGGCTTGGGGGAGGGGAAGAGG - Intergenic
1199716171 X:150508657-150508679 GGGGCTGGTGGGAGTGGGGCGGG - Intronic
1199865320 X:151842914-151842936 GGGCCTTGTGGGAGGTGTTGGGG + Intergenic
1200379751 X:155822322-155822344 GGGGATGGAGGGAGGGGGAGAGG + Intergenic
1200624662 Y:5496797-5496819 GGGGCCTGTTGGAGGGTGTGGGG - Intronic
1200687319 Y:6268058-6268080 GGGTTTTGTGGGAAGGGGCCTGG - Intergenic
1200786366 Y:7263921-7263943 GGAGCCTGTCGGTGGGGGCGGGG - Intergenic
1200829455 Y:7676968-7676990 GGGGCTGGTGGCAGGGCCCGAGG - Intergenic
1200884292 Y:8253023-8253045 GGAGCCTGGGGGAGGGGTCGAGG + Intergenic
1200886805 Y:8279566-8279588 GGGGCGAGTGGGGCGGGGCGGGG + Intergenic
1201047954 Y:9906652-9906674 GGGTTTTGTGGGAAGGGGCCTGG + Intergenic
1201057770 Y:10012806-10012828 GGGGCTGGTGGTAGGGGGTACGG - Intergenic
1201176013 Y:11308526-11308548 GGGGCTGGTGGGTGGGGGTGGGG - Intergenic
1201250510 Y:12053019-12053041 GGTGCTTTTGGGAGGTGGTGAGG - Intergenic
1201374373 Y:13300421-13300443 GGGGCTTGGGGCAGGGGGCGGGG + Intronic
1201565590 Y:15362318-15362340 GGGGCTTGTGGGAGCCCGCATGG - Intergenic
1201931169 Y:19350427-19350449 GGGGCTTGTGGGATAGGGGAGGG + Intergenic
1202085533 Y:21132962-21132984 GGGTCTTGTGGGAGGGGTTTGGG - Intergenic