ID: 950018922

View in Genome Browser
Species Human (GRCh38)
Location 3:9772696-9772718
Sequence AACTGTTGCCAGGAGAATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 182}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950018916_950018922 -9 Left 950018916 3:9772682-9772704 CCCTTGGCCTCCAAAACTGTTGC 0: 1
1: 0
2: 8
3: 238
4: 2171
Right 950018922 3:9772696-9772718 AACTGTTGCCAGGAGAATTAGGG 0: 1
1: 0
2: 2
3: 13
4: 182
950018917_950018922 -10 Left 950018917 3:9772683-9772705 CCTTGGCCTCCAAAACTGTTGCC 0: 1
1: 0
2: 20
3: 751
4: 15275
Right 950018922 3:9772696-9772718 AACTGTTGCCAGGAGAATTAGGG 0: 1
1: 0
2: 2
3: 13
4: 182
950018915_950018922 -8 Left 950018915 3:9772681-9772703 CCCCTTGGCCTCCAAAACTGTTG 0: 1
1: 5
2: 171
3: 1818
4: 3875
Right 950018922 3:9772696-9772718 AACTGTTGCCAGGAGAATTAGGG 0: 1
1: 0
2: 2
3: 13
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950018922 Original CRISPR AACTGTTGCCAGGAGAATTA GGG Intronic
906868409 1:49448517-49448539 CACTGTGGCCAGGAGAAGTAGGG + Intronic
907027973 1:51140868-51140890 AACTCTAGCCAGAACAATTAGGG - Intronic
910266808 1:85346524-85346546 AACTGGGGCCAGGGGAATCAGGG + Intronic
910453277 1:87369035-87369057 AAATGTGGCCAAGAGAATTCAGG - Intergenic
912590501 1:110814184-110814206 TACTGTGGCAAGTAGAATTATGG + Intergenic
917177242 1:172249433-172249455 AACTCTTGCCAAGTGAATTCAGG + Intronic
917253255 1:173086215-173086237 CACTGTTGGCAGGAGAATGGAGG + Intergenic
918599094 1:186332145-186332167 AACTTTTACCAGTAGAGTTAAGG - Intronic
918703283 1:187631933-187631955 AACTTTGGCCAGAAGACTTAGGG - Intergenic
919315172 1:195963119-195963141 GTCTGTGGCCAGGAGCATTAGGG + Intergenic
922275178 1:224070924-224070946 TACTGTTTCCAGGAGATTAAAGG + Intergenic
924430162 1:243989774-243989796 ATCTGTTGCCAGGAAGATTGGGG + Intergenic
1063256629 10:4335130-4335152 AAAACATGCCAGGAGAATTATGG - Intergenic
1063378419 10:5568854-5568876 CATTGTTCCCAGGAGAAATATGG + Intergenic
1063431638 10:5995892-5995914 ATCTGTTGCCAGGAGTAAAATGG - Intergenic
1069151870 10:64972376-64972398 AGCTTTTGTTAGGAGAATTATGG - Intergenic
1071025700 10:81110428-81110450 AACTCTTGAAAGCAGAATTATGG - Intergenic
1072257941 10:93638702-93638724 AAATGATGCCAGGATAATTTTGG - Intronic
1072574932 10:96690771-96690793 AACTGTGGCCAGGAGATTAGAGG - Intronic
1073846491 10:107561662-107561684 GACTGTTGCCAACAGAACTAAGG + Intergenic
1073894530 10:108139606-108139628 AAATGTTGCCAGTAGAAACAGGG + Intergenic
1075229256 10:120658993-120659015 AAATCTTTCTAGGAGAATTACGG - Intergenic
1076228376 10:128799473-128799495 AACTGGTGGCAGGAGAAACATGG - Intergenic
1077645340 11:3918656-3918678 CACTGTGGCCAGGAGAATACTGG + Intronic
1078256145 11:9660686-9660708 GATTCTTGCCAAGAGAATTAAGG + Intergenic
1078628038 11:12976380-12976402 AAAAGTTGCCAGGAGAAGAAGGG - Intergenic
1080567567 11:33525888-33525910 TTATGTTCCCAGGAGAATTATGG - Intergenic
1080868767 11:36218107-36218129 AAGAGCTGCCAGGATAATTATGG + Intronic
1081192158 11:40117176-40117198 AAATGTTGCTATGAGAATAAAGG + Intronic
1081591360 11:44425465-44425487 ACCTGTTGGCAGGAGAAGAAGGG - Intergenic
1082211577 11:49509257-49509279 AACTGTTGAAATGAGAACTAAGG - Intergenic
1083266149 11:61547778-61547800 AACTGAGGCCAGGAGAGGTAGGG - Intronic
1086638071 11:89115821-89115843 AACTGTTGAAATGAGAACTAAGG + Intergenic
1088913013 11:114206268-114206290 AACTGTTGCAAGGGGCTTTAGGG + Intronic
1090756453 11:129795953-129795975 AACTCATACCAGGAGAATTGGGG - Intergenic
1092773895 12:11924514-11924536 AAGAATTGCCAGGAGAATTCTGG + Intergenic
1093277582 12:17148787-17148809 TTATGTTCCCAGGAGAATTATGG - Intergenic
1095132580 12:38561455-38561477 AACAGTTCCCAGAAAAATTAGGG + Intergenic
1095594229 12:43940478-43940500 AACTGTGACAGGGAGAATTATGG - Intronic
1096309707 12:50509873-50509895 ATCTGATGCTAGGAGTATTAAGG + Intronic
1096725853 12:53561941-53561963 AAATGTTGTCAGGGGAATGAAGG + Intronic
1099597491 12:84685990-84686012 AGTTGTTACCAGGAGATTTAAGG - Intergenic
1100756398 12:97755895-97755917 AACTGATGTTAGGAGAATGATGG + Intergenic
1102451646 12:113046276-113046298 CCCTTTAGCCAGGAGAATTATGG + Intergenic
1102794327 12:115675422-115675444 AGCTGATGCCAGGAGAGCTAAGG - Intergenic
1106465229 13:30007865-30007887 AACTGTTTCCAGCAATATTATGG - Intergenic
1107720255 13:43241024-43241046 GACTGTTCCCAGAAGAATTTTGG - Intronic
1109566476 13:64121914-64121936 AACTCTTTCGAGGAGATTTATGG + Intergenic
1112036591 13:95502446-95502468 AACTGTTGCCAGGACGTTTATGG + Intronic
1112284399 13:98091306-98091328 AGCTGTGGCCAGGAGAAGTCTGG - Intergenic
1113444417 13:110354808-110354830 AACTCTTGCCAGGAGGTTTTGGG + Intronic
1121503481 14:94458731-94458753 AGCTGTTCCCAGGAGAATTATGG + Intergenic
1123204821 14:106702016-106702038 AGCTGTTGCCAGGATGACTATGG - Intergenic
1123209823 14:106748457-106748479 AGCTGTTGCCAGGATGACTATGG - Intergenic
1124506294 15:30277683-30277705 AATTGTTGTCAGAAGAATTGTGG - Intergenic
1124737262 15:32260953-32260975 AATTGTTGTCAGAAGAATTGTGG + Intergenic
1124881215 15:33644579-33644601 GCCTGTTGACAGGAGACTTAGGG - Intronic
1124910546 15:33915947-33915969 TTATGTTCCCAGGAGAATTATGG - Intronic
1125078890 15:35653491-35653513 AAATGTTGCTATGAGAGTTATGG + Intergenic
1126537978 15:49788669-49788691 AAATGTTACCAGGATAAATAAGG - Intergenic
1132229231 15:100169513-100169535 AACTGAGGCCAGGAGAAGTTGGG + Intronic
1133345517 16:5067453-5067475 CACTGTTGCATTGAGAATTAAGG + Intronic
1133539676 16:6737256-6737278 AACTTTTGTCAGAAGAAATACGG - Intronic
1138280329 16:55768162-55768184 AGCCGTTGCCAAGACAATTAAGG - Intergenic
1144231806 17:13213636-13213658 AACTCTTGCCAGGATAGCTAAGG + Intergenic
1145285710 17:21504806-21504828 GATTCTTGCCAAGAGAATTAAGG + Intergenic
1148621577 17:49038558-49038580 AAATGTTGCCTGGAGCATTCAGG + Intronic
1149221405 17:54418601-54418623 TTATGTTGCCAGGAGGATTATGG - Intergenic
1156592740 18:38510011-38510033 AAATATTGCCAGGAGAAGTTAGG - Intergenic
1156844303 18:41646426-41646448 AACTGTTACCAGTAGAATAATGG - Intergenic
1158758948 18:60361119-60361141 TTCTGTTTCAAGGAGAATTATGG + Intergenic
1158960980 18:62587492-62587514 GACTGTTGCAAGGAGAACCACGG - Intronic
1161016146 19:1984683-1984705 AACAGTTGCCAGGAGGCTGAAGG - Intergenic
1162483381 19:10942983-10943005 AACTGTTCTCAGAAGAAATAGGG - Intergenic
1164663379 19:30000559-30000581 AACTGTTGCCCTCAGAATTTTGG + Intronic
1166624828 19:44341829-44341851 AACTGCAGCCAGAAGAAATATGG - Intronic
1168213208 19:54906591-54906613 ATCTGTTGCCAGGGAAATTATGG + Exonic
1168530037 19:57119989-57120011 TTCTGTTCCCAGGAGAATCAGGG + Intronic
926781778 2:16479486-16479508 TATTGTGGCCAGGAAAATTATGG - Intergenic
926790167 2:16562633-16562655 AACTGTTGCAAGAAAAATAATGG - Intronic
928250310 2:29671625-29671647 ACTTGTTGCCAGGAAAATTGTGG + Intronic
929466734 2:42151784-42151806 AACTGTGGCCAGTAGAATGGGGG + Intergenic
929801969 2:45111997-45112019 ATCTGTTACCATAAGAATTACGG + Intergenic
929805995 2:45145463-45145485 AGCTGTGGCTAGGAGGATTATGG - Intergenic
929859751 2:45666622-45666644 AGCTGTAGCCTGGAGAATTCTGG - Intronic
933229009 2:79784311-79784333 AACTGTGCCCAGGGGAACTACGG - Intronic
933505478 2:83171830-83171852 AACTCTTGCCTTGAAAATTAAGG - Intergenic
934979572 2:98828813-98828835 ACTTGTTGCCAGGAGACTTGCGG - Intronic
937572469 2:123380942-123380964 TTATGTTCCCAGGAGAATTATGG - Intergenic
941348652 2:164403366-164403388 AACTGTTGCCTGAAGCAATATGG + Intergenic
942275083 2:174315425-174315447 CACTGTTGCAATGAGGATTAAGG + Intergenic
942941215 2:181620071-181620093 AACTGTTGCTATGAGAACAAAGG + Intronic
943449365 2:188028715-188028737 TTATGTTCCCAGGAGAATTATGG + Intergenic
945776188 2:214109250-214109272 GACAGTTGCCACGTGAATTAAGG + Intronic
1168759661 20:341214-341236 AACCTTGGCCAGGAGAATTTAGG - Intergenic
1171086230 20:22240483-22240505 AACTGTTGCAAGAAGAAATAGGG - Intergenic
1171282789 20:23914975-23914997 AATTATTCCCAGCAGAATTATGG + Intergenic
1172082450 20:32352840-32352862 AACTGAGGCCAGAAGCATTATGG + Intergenic
1173002942 20:39118540-39118562 AACTGTTGCCAGGGAAGTAAAGG + Intergenic
1174719657 20:52798330-52798352 TACAGTTGCCATGAGAACTAGGG - Intergenic
1177661197 21:24085866-24085888 ATATGTTCCCAGGGGAATTATGG - Intergenic
1182221843 22:28764887-28764909 ACTTGTTGCTAGGGGAATTATGG - Intergenic
1185164935 22:49255581-49255603 AACTGTTGGCAGGTGGATTTTGG + Intergenic
950018922 3:9772696-9772718 AACTGTTGCCAGGAGAATTAGGG + Intronic
951444185 3:22758046-22758068 CACTGTTGCCAAAAGATTTAAGG + Intergenic
951546085 3:23826920-23826942 AACTGTTGCCAGGAGGTTTTTGG + Intronic
952071790 3:29646150-29646172 AACTGTGACCAGTACAATTAAGG - Intronic
952636704 3:35541858-35541880 ACCTGTGGACAGGAAAATTAAGG + Intergenic
953488032 3:43321245-43321267 AGCTGTTGTCAGGAGAACAAAGG + Intronic
953684926 3:45069718-45069740 TACTGTTTCAAGGAGAATAATGG + Intergenic
958094409 3:88924103-88924125 AACTGTTTCCATGTGAGTTAGGG + Intergenic
958552920 3:95639479-95639501 AACTTTTGCAAGCAGTATTATGG - Intergenic
959688958 3:109177815-109177837 GCCTGAGGCCAGGAGAATTAAGG - Intergenic
960883922 3:122375155-122375177 AACTGGTAGCAGTAGAATTAAGG + Intronic
963207518 3:142651863-142651885 GACTGTTGCCAAGAGAAATGAGG - Intronic
964481444 3:157142632-157142654 AACTGTGGCCTGGAGTATTGTGG + Intergenic
965725276 3:171709479-171709501 AACTGATTCCAGGTGAATTTAGG + Intronic
970839217 4:20447207-20447229 AGTTGTTGCCAAGAGATTTAGGG - Intronic
971226168 4:24753349-24753371 AAGTGGTGCTATGAGAATTAGGG + Intergenic
974169366 4:58245973-58245995 ACGTCTTGCCAGGTGAATTAGGG + Intergenic
974324184 4:60392866-60392888 ATCCTTTGCCAGGAGAATTATGG - Intergenic
974801816 4:66828191-66828213 TTATGTTCCCAGGAGAATTACGG + Intergenic
976018742 4:80593426-80593448 AACTGTTGCAATGATAATTAAGG + Intronic
977497079 4:97790550-97790572 AACAGCTACCAGGAAAATTAGGG - Intronic
977891063 4:102312237-102312259 AAATGTTTCCAGGGGAATTTAGG - Intronic
980523280 4:133958513-133958535 AACTGATGCCAGGAGTAGTGGGG - Intergenic
983121179 4:163886919-163886941 AATTCTAGCCAGGAGAATTTGGG - Intronic
984361661 4:178742579-178742601 GTCTGTTCCCAGGAGGATTATGG + Intergenic
985333646 4:188868758-188868780 GAGTGGTGGCAGGAGAATTATGG - Intergenic
987981777 5:25095128-25095150 AACTGCTGCCTGGAGATTTGGGG - Intergenic
988815748 5:34833029-34833051 AACTCTTGTCAGGTGAATTCTGG + Intergenic
990803395 5:59631327-59631349 AACTGTTGGCAGGGGCATAAGGG - Intronic
991706178 5:69361020-69361042 AACTGCTGCCAGGAAAATTAAGG + Intronic
995449150 5:112281277-112281299 AAGTGGTGGCAGGAGAATTCGGG + Intronic
996438931 5:123467465-123467487 AAAGGTTGTCAGGAGAATAAAGG - Intergenic
998774205 5:145580855-145580877 AACTGGTGGTAGGAGAAATACGG - Intronic
999041424 5:148417436-148417458 TACAGATGCCAGGGGAATTAGGG + Intronic
999721877 5:154404477-154404499 CAGCATTGCCAGGAGAATTAAGG + Intronic
999797438 5:155001723-155001745 CGCTGTTGCCAGGAGAATGGAGG + Intergenic
1000563840 5:162823637-162823659 TACTGTGGCCAGGAGATTGATGG - Intergenic
1003654103 6:7989423-7989445 CACTGTTGTCAGGAGAAGAAGGG + Intronic
1007027355 6:38589902-38589924 ACCTATTGCCAGGGGACTTAAGG - Intronic
1007864666 6:44955499-44955521 TACCGTTGCCAGGGGCATTATGG - Intronic
1008458289 6:51737886-51737908 AAATATTGGCAGGAGAATGAGGG + Intronic
1009716879 6:67409103-67409125 GACTGTTTCCAGCATAATTAGGG - Intergenic
1010814331 6:80339086-80339108 CACTGTGACAAGGAGAATTAGGG + Intronic
1012825884 6:104145921-104145943 ATCTGGTGCCAGGAAAATTTAGG - Intergenic
1013700124 6:112757068-112757090 AATTGTTGGCAAGAGTATTAGGG - Intergenic
1013770707 6:113624938-113624960 AACTGTTCACAGGACAATCAAGG + Intergenic
1014670479 6:124298530-124298552 AGCTGTTGACAGGTAAATTATGG - Intronic
1016416024 6:143834811-143834833 CACTGTGGCCAGGATGATTAGGG - Intronic
1017333105 6:153222524-153222546 AATTGTGGCCTGGAGAATGATGG - Intergenic
1018182645 6:161237698-161237720 AAATGTTGGCAGAAGGATTATGG + Intronic
1021242553 7:18221669-18221691 AACTTTTGGCAGGAGAAATAAGG + Intronic
1021265795 7:18520699-18520721 AACTGTTTCCAAGACATTTACGG - Intronic
1022781802 7:33592779-33592801 AAATGTTGCCAGGATCATTGGGG + Intronic
1024840020 7:53574895-53574917 TTATGTTCCCAGGAGAATTATGG - Intergenic
1028450304 7:90974534-90974556 AACTTTTGCCTTGAGAATTAGGG + Intronic
1028674337 7:93441862-93441884 AACTGTGGCCAAGAAAATTGAGG - Intronic
1030532809 7:110731158-110731180 AATATTTGCCATGAGAATTAAGG + Intronic
1031897934 7:127374126-127374148 AACTGTTGGCAGTATTATTAGGG + Exonic
1031989530 7:128188697-128188719 AACAGTTGCCAAGAGAAGTGGGG + Intergenic
1032562517 7:132907401-132907423 AAATGCTGCCAGGAAAATAAAGG + Intronic
1033622898 7:143077977-143077999 AGTTGTTTCCAGGAGGATTATGG - Intergenic
1034106223 7:148492729-148492751 TACTGTTCCTAGGAGAATTACGG + Intergenic
1035640873 8:1184395-1184417 AACTGTTACCAAGAGAAGAAAGG - Intergenic
1035836356 8:2757184-2757206 AAGGGTTGCTATGAGAATTAAGG + Intergenic
1037077957 8:14745373-14745395 ATCTGTTGCCAGGAGCCTTGTGG + Intronic
1037081197 8:14788495-14788517 TACTGTCCCCAGAAGAATTATGG - Intronic
1037441317 8:18918988-18919010 ATCTGTAGAAAGGAGAATTAAGG - Intronic
1039411158 8:37356364-37356386 ATCTGGTGCCAGGAAAATTTAGG + Intergenic
1039468891 8:37801719-37801741 AACTGAGGCCAGGAGAAGAAGGG + Intronic
1043307156 8:78809317-78809339 AACTGTTGCCATGAGGATCATGG - Intergenic
1044464265 8:92485321-92485343 AACAGTTGTCATGAGAATCAGGG - Intergenic
1046149933 8:110210994-110211016 AACTCTAGCCAGGGGAACTAAGG + Intergenic
1047709354 8:127535726-127535748 ACATGTAGCCTGGAGAATTATGG + Intergenic
1048650417 8:136469928-136469950 AACGTCTGCAAGGAGAATTAAGG - Intergenic
1049869789 8:144965686-144965708 AGTTGTTCCCAGGAGGATTATGG + Intergenic
1050161904 9:2727818-2727840 AACTGAGGCCAAGAGAATTTAGG + Intronic
1050424071 9:5496017-5496039 AACTGTTGCCAGTAGTATTCTGG + Intergenic
1052516790 9:29491688-29491710 AGGGGTTGCAAGGAGAATTATGG + Intergenic
1055991410 9:82110437-82110459 TACTGTTCTCAGAAGAATTAGGG - Intergenic
1058147038 9:101423937-101423959 AAAGGTTGCCAGGAGAAATGAGG - Intronic
1060934585 9:127507822-127507844 GACTGTTGCCAGGAGGATGCTGG - Intronic
1186368293 X:8919103-8919125 AAATGTAGACAGGAGCATTAGGG - Intergenic
1188050773 X:25483055-25483077 AACTGGTCCCAGAAGAATGAGGG - Intergenic
1188818059 X:34739629-34739651 CAGAGTTGCCAGGAGAATAAAGG + Intergenic
1188968722 X:36586242-36586264 CAATGCTGCCAGGAGAATTTAGG - Intergenic
1190998462 X:55635876-55635898 GACTCTTGCCAGGAGCCTTAAGG - Intergenic
1191046195 X:56140105-56140127 AACTGTTGCCAGCAAGATTGTGG + Intergenic
1192100171 X:68255942-68255964 ATCTCTTGCCAGGAAAATTTAGG + Intronic
1196045817 X:111255255-111255277 GACTGTGATCAGGAGAATTATGG - Intronic
1196210203 X:112987435-112987457 AGCTTTTGCATGGAGAATTAAGG + Intergenic
1196519380 X:116655036-116655058 AAGTGTTCCCAGGGGGATTATGG + Intergenic
1197303825 X:124815548-124815570 AATAGTTGCCAGAAAAATTATGG + Intronic
1198714672 X:139544450-139544472 AACTGTTGCCAGGGGGACAAAGG - Intronic
1198879915 X:141269056-141269078 AACAGTTGACATGAGCATTAAGG + Intergenic
1200975560 Y:9208977-9208999 AGCAGTTGCCAGGATAACTACGG + Intergenic