ID: 950019433

View in Genome Browser
Species Human (GRCh38)
Location 3:9776687-9776709
Sequence AAGAGCAATAAGAAGACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 295}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950019433_950019436 23 Left 950019433 3:9776687-9776709 CCTGCAGTCTTCTTATTGCTCTT 0: 1
1: 0
2: 1
3: 20
4: 295
Right 950019436 3:9776733-9776755 GTCTAGTGTGTCCCCATTTCTGG 0: 1
1: 0
2: 0
3: 9
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950019433 Original CRISPR AAGAGCAATAAGAAGACTGC AGG (reversed) Intronic
902960615 1:19960685-19960707 AAGGGCAAGAAGAAGGCGGCAGG - Intergenic
903831836 1:26180129-26180151 AAAAACAAAAAAAAGACTGCTGG + Intronic
904547604 1:31288202-31288224 AAAAGCAATAAGAAGTATGGGGG + Intronic
905186379 1:36199985-36200007 AAGAGCAATGAGAAGGCCCCGGG - Intergenic
905312400 1:37059016-37059038 CAGAGCAAGAAGAAGACCCCTGG - Intergenic
905696674 1:39979757-39979779 AAGGGCAAGAAGAAGAGGGCAGG - Intergenic
905840271 1:41170583-41170605 TAGAGCAATAAGAATGCTGGTGG - Intronic
906091411 1:43182625-43182647 AATAGTAATCAGAAGGCTGCTGG + Intronic
906867147 1:49434255-49434277 TCCAGCAATAAGAAGATTGCTGG + Intronic
907265513 1:53257699-53257721 ATCAGCAATAAAAAGACTGTAGG + Intronic
907575288 1:55520817-55520839 AACAGCAATAACAAGAAAGCAGG - Intergenic
909188861 1:72525775-72525797 AAGAACAAAAAACAGACTGCAGG - Intergenic
910236945 1:85046757-85046779 AAGATTAATAAGGATACTGCTGG + Intronic
911150067 1:94589918-94589940 CAGAGTACTAAGAAGACTTCTGG - Intergenic
912016539 1:105044229-105044251 AAGAGCAACAACAACACTGCAGG + Intergenic
912920447 1:113861673-113861695 AAGAGAAAAATGAAGCCTGCCGG - Intronic
915717409 1:157957407-157957429 AACAGCAATTAGAAGACTCCAGG + Intergenic
915981882 1:160425466-160425488 AAGAGCAAGAAGAAGAAGGGTGG - Exonic
916157302 1:161865906-161865928 AAGAGCAAAAAGAACAATCCAGG - Intronic
916182754 1:162101371-162101393 AACAACAATAACAAGACTGGAGG - Intronic
916425451 1:164675746-164675768 TATAGCACTAAGAAGACAGCAGG - Intronic
916774830 1:167951025-167951047 AAGAGATAAAAGATGACTGCAGG - Intronic
919355800 1:196519997-196520019 AACAGCAAAAAGAAAACTTCAGG + Intronic
919907330 1:202086965-202086987 AACAGCAATGACCAGACTGCAGG + Intergenic
921677865 1:217996632-217996654 AAGAGAAATAATAAGCCTGCAGG - Intergenic
922609185 1:226911800-226911822 AAGAAGAAGAAGAAGACAGCTGG - Intronic
922663032 1:227446962-227446984 AAGAGCAAACAGAAGGCTGGGGG - Intergenic
923067968 1:230537668-230537690 AAGGTCAACAGGAAGACTGCAGG - Intergenic
1063143047 10:3273006-3273028 AAGAGCAATAAAAAGATCACTGG - Intergenic
1066435932 10:35396782-35396804 GAGAGCACGAAGAGGACTGCAGG - Intronic
1066476440 10:35751606-35751628 AATAGCAATAGGAAGCTTGCTGG - Intergenic
1066627168 10:37418567-37418589 AAAACCACTGAGAAGACTGCTGG + Intergenic
1067963599 10:50884301-50884323 AAGGGAAAAAAGAAGACAGCTGG - Intronic
1069269317 10:66505146-66505168 ATAAACAATAAGTAGACTGCAGG - Intronic
1069431980 10:68345405-68345427 AAGTGCATTAAGAGAACTGCAGG + Exonic
1071383063 10:85089865-85089887 AGGAGGAATAATAAGACAGCAGG - Intergenic
1071768078 10:88691348-88691370 ATGAGCAATAAGAAATCTGAAGG + Intergenic
1072552114 10:96487008-96487030 GTGAACAATACGAAGACTGCAGG - Intronic
1073926365 10:108520986-108521008 AAGAGCAGTAAAGAGACTGAAGG - Intergenic
1076925793 10:133485133-133485155 AACAGCAAAAAGAAAACTACAGG - Intergenic
1078024586 11:7682668-7682690 AGGAGCAAAGAGAAAACTGCTGG - Intergenic
1078582309 11:12547932-12547954 AAGAACAGTAAGGAGACTGTGGG - Intergenic
1079009713 11:16817982-16818004 AAGAGCAGTGAGAAAACAGCAGG - Intronic
1079199847 11:18367366-18367388 AAGAGAAATGGGAAGACTGAAGG - Intergenic
1079439604 11:20497641-20497663 AAGATCTATAGGAAGACTCCCGG + Intronic
1079841468 11:25406002-25406024 AAGAAAAAGATGAAGACTGCAGG - Intergenic
1080722581 11:34864458-34864480 AAAAGCAAGAATAAGACTGACGG - Intronic
1081767767 11:45623767-45623789 AAGAGGAGAAAGAAGAGTGCTGG + Intergenic
1083097190 11:60263699-60263721 AAACACAATAAGAAGACGGCAGG - Intergenic
1084931313 11:72558648-72558670 AGGAGAAATAATAAGACTGATGG + Intergenic
1087441677 11:98191794-98191816 AAGAGCATTAAGGAGACATCTGG + Intergenic
1088092237 11:106056426-106056448 AATAGCATCAAGAAGAGTGCAGG + Intronic
1088107279 11:106221598-106221620 AAGAGCAATGGGAAAACTGAGGG + Intergenic
1088329646 11:108637621-108637643 AAGTGCAATAGGAAGCCAGCTGG + Intergenic
1088568362 11:111196910-111196932 AGAAGGAATTAGAAGACTGCTGG - Intergenic
1089514475 11:119023477-119023499 AAGTGCACTAACAAGGCTGCTGG - Exonic
1092314814 12:7399423-7399445 AAGAGGAAGAAGAAGAATGGGGG - Intronic
1094323323 12:29209109-29209131 AAAAGCAATAAGAAGACCCACGG + Intronic
1094697470 12:32834686-32834708 AAGAGAAGAAAGAAGACTGGGGG + Intronic
1097104290 12:56611979-56612001 GAGACCACTGAGAAGACTGCTGG + Exonic
1097511563 12:60548612-60548634 AAGAGCATTAAAAACAATGCAGG - Intergenic
1098164407 12:67678951-67678973 AACAGAAGTAAGAAGACTCCAGG + Intergenic
1098329853 12:69341765-69341787 AATAGCAAAAACAAGATTGCAGG + Intergenic
1098349956 12:69548229-69548251 AAGACCAATTAGAAGGCTGTTGG + Intronic
1099097867 12:78398144-78398166 AAGTGCATGAAGAAGACTGTGGG - Intergenic
1099517224 12:83611708-83611730 AAGAGCAATAAAAAAAAGGCTGG + Intergenic
1100428147 12:94506772-94506794 AAAAGCATTAGGGAGACTGCTGG - Intergenic
1102295570 12:111733876-111733898 GACAGCACTAAGAAAACTGCCGG - Intronic
1102640044 12:114359096-114359118 AAGAATAATAAGAAAACGGCCGG + Intronic
1103103299 12:118199600-118199622 AGGAGCTAGAGGAAGACTGCTGG + Intronic
1103272842 12:119687989-119688011 AAGTGCAAAGAGATGACTGCAGG + Exonic
1103886714 12:124208007-124208029 AAGAGCATTAGGAAAAGTGCAGG - Intronic
1104184163 12:126412417-126412439 AAGGGCAATAAGGAGCCTTCTGG + Intergenic
1105804226 13:23940800-23940822 GAGAGCAATAAGAAATATGCAGG - Intergenic
1105917271 13:24928161-24928183 AAGAGCAGCTAGAGGACTGCTGG - Intergenic
1106736131 13:32589114-32589136 AAGAGCAACAAGAAAACTTAAGG + Intronic
1108558338 13:51618920-51618942 AGCAGCAATCACAAGACTGCTGG + Intronic
1109248803 13:59992442-59992464 AATATTAATAAGGAGACTGCAGG + Intronic
1109686954 13:65832596-65832618 AACAGCTATAAGAAAACTGGAGG - Intergenic
1109952786 13:69522570-69522592 AAGAACAATAAGAAGGATGGAGG - Intergenic
1109979677 13:69890804-69890826 TAAAGCAATAAGAAAAATGCAGG - Intronic
1110297453 13:73884968-73884990 AAGAAGATTATGAAGACTGCCGG - Intronic
1110839911 13:80130080-80130102 AAGAAAAATAAGAGGATTGCTGG + Intergenic
1111956126 13:94760514-94760536 AAGAAGAAGAAGAAGACTTCTGG - Intergenic
1112124285 13:96447558-96447580 AAGGGCAAGAAGAAGGCAGCAGG - Intronic
1112237718 13:97651187-97651209 AAGGGCAAGAAGAAGAGGGCAGG + Intergenic
1113205487 13:107911304-107911326 AAGGGCAATAAGAAGAGTGAAGG - Intergenic
1113986477 13:114320496-114320518 ATAAGCACTCAGAAGACTGCTGG - Intronic
1114709947 14:24768072-24768094 AGGAGCAAGAAGAAGACCCCAGG + Intergenic
1117587988 14:57232717-57232739 AAGAGCAGTTAGAAGAATGTAGG - Exonic
1118627420 14:67672417-67672439 AAGAAAAAAAAGTAGACTGCAGG - Intronic
1118794441 14:69128531-69128553 AAGAAAAAAAACAAGACTGCAGG + Intronic
1120664226 14:87286838-87286860 AAAAGCAATCAAAAGACTGGAGG - Intergenic
1121932418 14:97984676-97984698 TAGAGAAATGATAAGACTGCGGG - Intergenic
1124041139 15:26104879-26104901 AAGACAAGTAAGAAGATTGCTGG + Intergenic
1124704835 15:31954930-31954952 AAGATAAATGAGAAGTCTGCAGG - Intergenic
1126525456 15:49649434-49649456 GAGAGCATTAAGAAGTCAGCAGG + Exonic
1126712852 15:51480700-51480722 AATAGAAAGAAGAAGATTGCAGG - Exonic
1126716922 15:51527425-51527447 ATGAGCAATAAGAAGTCATCTGG + Intronic
1127297126 15:57618521-57618543 AAGAGGAATAGGAAGACTGTGGG + Intronic
1129114343 15:73356949-73356971 CAGAGCAATCAGAGAACTGCAGG + Intronic
1129422912 15:75443749-75443771 AAAAGCAATAAGAAAACTGAAGG + Intronic
1129976980 15:79830851-79830873 ATGAGCAATAAGAAGAGAGGAGG + Intergenic
1135997245 16:27259810-27259832 AAGAGCAACAAGTAGACTGCCGG + Intronic
1136128674 16:28204483-28204505 AAGAGCAGTAAGAAGACCGAGGG + Intronic
1136547851 16:30965594-30965616 AAGAGCATGGAGAAGCCTGCGGG - Exonic
1137257914 16:46792767-46792789 AAGAAAAAAAAGAAGACGGCCGG + Intergenic
1139810159 16:69608450-69608472 AAGAAGCTTAAGAAGACTGCTGG + Intronic
1146218541 17:30998624-30998646 AAGAACAATAAGAACATGGCCGG - Intronic
1147256916 17:39186957-39186979 AAGAGCAAGAGGGAAACTGCAGG + Intronic
1147344012 17:39775168-39775190 TAGTGCAATAAGAAGAGTACTGG - Intronic
1149637912 17:58185102-58185124 AAGGGCAAGAAGAAGATCGCGGG - Intergenic
1149745293 17:59091196-59091218 AAGAGAAATGGGCAGACTGCAGG + Intronic
1149828267 17:59849266-59849288 AAAATCCCTAAGAAGACTGCAGG + Intergenic
1150495450 17:65604649-65604671 AAAAGAGATGAGAAGACTGCAGG - Intronic
1150878198 17:68993460-68993482 AAGAGCAATATAAAGATTCCAGG - Intronic
1150911821 17:69395692-69395714 AAAAGCACTAAAAAGAGTGCCGG - Intergenic
1151488453 17:74417289-74417311 AACAACAACAAAAAGACTGCTGG + Intergenic
1155427579 18:25722692-25722714 AGGAGCAACAAGAAGGCTGGAGG - Intergenic
1156057545 18:33026242-33026264 AAGAGCAATATGAGGAATCCTGG + Intronic
1156139590 18:34090729-34090751 TTAAGCAATAAGAAGCCTGCTGG + Intronic
1156204017 18:34866185-34866207 AAAAGCAATGAGAAAACCGCAGG - Intronic
1156551289 18:38020613-38020635 AAGAGCTATAAAAATATTGCTGG - Intergenic
1157278594 18:46330560-46330582 AAGTACAATAAGAAGATTTCTGG - Intronic
1159150874 18:64522227-64522249 AACAGAAAGACGAAGACTGCAGG + Intergenic
1161548015 19:4894079-4894101 AAGAAGAAGAAGAAGACAGCCGG + Intronic
1161834022 19:6632812-6632834 AAGAGATAAAAGAAGACAGCTGG + Intergenic
1162424561 19:10586750-10586772 AAGAGGAATAAAAGGACTTCAGG + Intronic
1164805854 19:31116033-31116055 AAGAGAAAGAAGAATACTCCAGG + Intergenic
1165395896 19:35563442-35563464 ATGAGCAAGAAGAAGAAGGCGGG - Exonic
1167477247 19:49708182-49708204 CAGAGCAAGAAGATGACTCCAGG + Intronic
928170575 2:29000592-29000614 AAGAGCAATAAGAAGTCTTGAGG + Intronic
928572916 2:32626993-32627015 AAGAGCCAGGAGAAAACTGCAGG - Intergenic
928659367 2:33485372-33485394 AGAAGCTAAAAGAAGACTGCAGG - Intronic
928686256 2:33752971-33752993 ATGAGCAAGAAGAAAACTGAGGG + Intergenic
928957960 2:36890861-36890883 AAGGGCAAGAAGAAGTCAGCTGG + Intronic
929462578 2:42114176-42114198 AAGAAGAAGAAGAAGATTGCTGG + Intergenic
930288611 2:49465943-49465965 ATGAGCAATAAGAAATCTGAAGG - Intergenic
932178035 2:69620531-69620553 AAGAGCATTCAGAAGAGTGATGG - Intronic
933057235 2:77685774-77685796 AAGTGAAAGAGGAAGACTGCAGG + Intergenic
933084695 2:78040886-78040908 GAGAGAAAGAAGAAGACTGTTGG + Intergenic
933608802 2:84412778-84412800 AAGGGCAATAAGAAGCCTTGAGG + Intergenic
933730237 2:85450721-85450743 AGGGGGAAGAAGAAGACTGCTGG + Intergenic
933927374 2:87106974-87106996 AAGTGAAAGAGGAAGACTGCAGG + Intergenic
935720862 2:105977819-105977841 ATAAGCAATAAGAAGACACCAGG - Intergenic
935736214 2:106108536-106108558 AAGAACAATGAGAAGGCTGAGGG - Intronic
935813170 2:106819646-106819668 ATGAGCAATAAGAAATCTGAAGG + Intronic
935998806 2:108803667-108803689 AAGAGCAAAAACAAAAATGCAGG + Intronic
936249245 2:110854641-110854663 AAGAGCATTAAGGAGACTTCAGG + Intronic
937618837 2:123961395-123961417 AAGAGGAATTTGAAGAGTGCCGG - Intergenic
938171995 2:129087426-129087448 AAGAGCAATAAGTCGTTTGCAGG - Intergenic
938406124 2:131034271-131034293 CTGAGAGATAAGAAGACTGCAGG - Intronic
938812327 2:134864855-134864877 AGGAGGAAGAAGAAGACTGATGG - Intronic
939021646 2:136964674-136964696 AAGAGAAATGAGATGACAGCTGG - Intronic
939163904 2:138619732-138619754 AATAGGAATCAGAAGACTGAAGG - Intergenic
940375334 2:152951679-152951701 GAAAGCAATAAATAGACTGCAGG + Intergenic
940559139 2:155272063-155272085 AATAGAAATAAGAAGAATGATGG - Intergenic
941582080 2:167310771-167310793 AAGAAAAAAAAGAAGCCTGCTGG + Intergenic
943261400 2:185668035-185668057 AGGAGCAATAAGAAGACATAGGG - Intergenic
943261639 2:185672072-185672094 TAAAGCAATAAGAAGACTGGTGG + Intergenic
943676032 2:190717270-190717292 CAGAGCAACAAGAAAAATGCCGG - Intergenic
943766388 2:191666874-191666896 AAGAGCAGTAAGAAGATAACTGG - Intergenic
943913532 2:193598621-193598643 AAGAAGAAGAAGAAAACTGCAGG + Intergenic
943916508 2:193641671-193641693 AAAATCAATAAGGAGACAGCAGG - Intergenic
944190160 2:196994484-196994506 AAGAAGAAGAAGAAGACTGTTGG - Intronic
945425728 2:209698146-209698168 AAGAGTAATAAGTAGATAGCAGG - Intronic
947089218 2:226492035-226492057 AAGAGCAGTAAGAAAACTCTTGG - Intergenic
947629371 2:231642003-231642025 AAGAAGAATGAGAAGGCTGCCGG - Intergenic
948417564 2:237824649-237824671 TAGAGCAAGAGGAAGAATGCGGG - Intronic
1168863788 20:1066214-1066236 AAGAGCAACAATAAGACTGATGG - Intergenic
1169777669 20:9273907-9273929 AAGAACAGGAGGAAGACTGCTGG + Intronic
1169803269 20:9533040-9533062 TGGAGAAATAAGAAGACTTCTGG + Intergenic
1170210059 20:13839186-13839208 AACAGCAATCAGAAAACTCCAGG - Intergenic
1172947314 20:38699619-38699641 AAGAAGAAGAAGAAGACTTCAGG + Intergenic
1172978659 20:38925139-38925161 AGGAGAAAGAAGAAGATTGCTGG + Intergenic
1174296607 20:49549849-49549871 AAGAGCAAGAGGGAGACTGAAGG + Intronic
1174490784 20:50893513-50893535 AAGAGGCATTAGCAGACTGCAGG + Exonic
1174551179 20:51362815-51362837 ATGAGATATAAGAAGTCTGCTGG + Intergenic
1175860141 20:62145748-62145770 AAGCCCAATACGCAGACTGCTGG - Intronic
1177535146 21:22416438-22416460 AATAGCATTAAGAAAATTGCTGG - Intergenic
1178161309 21:29919222-29919244 AAAAGCAATATGAAGCCTGAAGG + Intronic
1181516305 22:23415504-23415526 AAGAGCAGTAAGATGCCTACAGG - Intergenic
1182015495 22:27036048-27036070 AAGAAGAAGAAGAAGAATGCAGG - Intergenic
1185368855 22:50449743-50449765 AAGAGCAACAATAAAACTGACGG + Intronic
950019433 3:9776687-9776709 AAGAGCAATAAGAAGACTGCAGG - Intronic
950845804 3:16015047-16015069 AAGAGGAAGAAGACGACGGCAGG - Intergenic
954913333 3:54127536-54127558 AAGAGCAATCTGAAGAGTGCTGG - Intronic
954985358 3:54785913-54785935 AAGATCACTTAGAAGTCTGCAGG - Intronic
958671960 3:97217582-97217604 AAGAGGTATAAGAAAACTTCTGG + Intronic
959404581 3:105944565-105944587 GAGAGCCATAGGAAGACTGTTGG + Intergenic
960337488 3:116435874-116435896 AATAACAATAAGAAGGCAGCAGG + Intronic
962000718 3:131292976-131292998 AAAATCGATAAAAAGACTGCTGG - Intronic
962714984 3:138118126-138118148 AAGAGCAAAGAGAAGAGTCCAGG + Intergenic
964270791 3:154954121-154954143 AACAGAAATAAAAAGACTGAAGG + Intergenic
964627574 3:158773842-158773864 AAGAGGAAAAGGAAGACAGCAGG - Intronic
964740925 3:159965173-159965195 AAGAGCTAAAAGAAGAGTGAGGG - Intergenic
965174033 3:165307583-165307605 CTGAGCAAAAAGAAGACAGCTGG + Intergenic
966199770 3:177349670-177349692 AAAAGAAATTAGAAAACTGCTGG - Intergenic
966440809 3:179942395-179942417 CAGAGCAATGACAACACTGCGGG + Intronic
966820484 3:183920493-183920515 AACAGCAAAAAGAAGAAGGCAGG + Exonic
967574827 3:191077344-191077366 GAGAGAAATTAGAAGACTGCTGG - Intergenic
967815778 3:193797076-193797098 AACAGCAACAAGAAGAAAGCTGG + Intergenic
969527666 4:7712184-7712206 AAGAGAAATAACAAGTCAGCAGG - Intronic
970379049 4:15488162-15488184 ATGAGCAATAAGAAATCTGAAGG - Intronic
970759927 4:19472522-19472544 AACAGCAAAAAGAAAACTACAGG + Intergenic
971468361 4:26990155-26990177 TTGAGCAAAAAGAACACTGCTGG + Intronic
974624426 4:64403760-64403782 AATAGGAAAAAGAAGACTGAGGG + Intronic
974645257 4:64681530-64681552 AATAACAATAAGAATACTGATGG + Intergenic
974646960 4:64706968-64706990 AATACCAATAAGAAGAATCCTGG + Intergenic
975055011 4:69919171-69919193 AATGGCTATAAGAAGACTGTGGG - Intergenic
975910081 4:79257266-79257288 AAGATCAACAAAAAGACTGGTGG - Intronic
976267185 4:83195446-83195468 AAGAGCAAGGAGAAGAGGGCGGG - Intergenic
976875450 4:89849249-89849271 AAGAGCAATAAGAATGTTTCTGG - Intergenic
977423494 4:96834655-96834677 GAGAGCAGCAAAAAGACTGCAGG + Intergenic
977764651 4:100782676-100782698 AGAAACAATAAGAAGGCTGCTGG - Intronic
977773754 4:100892886-100892908 AAGAGAAACAAGCAGACTGAAGG - Intergenic
978157593 4:105507637-105507659 AAGAGAGATGAGAAGACTGGCGG + Intergenic
979786573 4:124722348-124722370 GAGAGCAAGAGGAAGACTGAGGG - Intergenic
981527447 4:145720562-145720584 AAGAGCAAGAAGAACACTCCCGG - Intronic
981568665 4:146129514-146129536 AACGGCAATAAGAAGTCTGCAGG + Intergenic
984914143 4:184705432-184705454 AAGGGCAACATGAAGACAGCGGG + Intronic
987694752 5:21313638-21313660 AAGAGCTCTCTGAAGACTGCAGG - Intergenic
987703496 5:21431913-21431935 AAGAGCACAAAGAAGAGTGATGG + Intergenic
988203295 5:28098071-28098093 AAAAGCCATATCAAGACTGCTGG - Intergenic
989513230 5:42312639-42312661 TAGATCAATAAGAAAACTTCAGG + Intergenic
992781578 5:80132906-80132928 AAGAGCAGTGAGAAGGCTGTTGG + Intronic
992830223 5:80586800-80586822 AAGATGAATCAGAAAACTGCTGG - Intergenic
993021044 5:82591338-82591360 AATAACAATAAGAATACTGCAGG - Intergenic
993113081 5:83683969-83683991 AAGAGGGAGAAGCAGACTGCGGG + Intronic
994217644 5:97157225-97157247 ATGAGCAATAAGAAATCTGAAGG - Intronic
996481897 5:123985074-123985096 AAGAAAAAGAAGAAGACTTCAGG - Intergenic
997829394 5:137136736-137136758 AAGAGCAGTGTGAAGACAGCTGG - Intronic
999094660 5:148967142-148967164 AGGAGCCATTAGAAAACTGCTGG - Intronic
999492258 5:152062851-152062873 AAGCTCAATTAGAAGACTGGTGG - Intergenic
1000601759 5:163283842-163283864 AAGATAATTAAGAAGAGTGCAGG - Intergenic
1001264571 5:170264198-170264220 AAGAACAAAAAGAAGATTGGAGG - Intronic
1002192903 5:177488069-177488091 AAGTGCAAGAAGAAGATTACAGG - Exonic
1003803400 6:9697572-9697594 ATGTGTAATAAGAAGACTGGAGG + Intronic
1005405007 6:25477319-25477341 CTCAGCAATCAGAAGACTGCAGG - Intronic
1005556149 6:26986290-26986312 AAGAGCTCTCTGAAGACTGCAGG + Intergenic
1009476690 6:64100832-64100854 AAAAGCAACAAGAAAACTACTGG - Intronic
1009898264 6:69779991-69780013 AAGGGCAAGAAGAAGAGTGCTGG - Intronic
1011609423 6:89136018-89136040 GTGGGCAATAAGAATACTGCTGG + Intergenic
1012134359 6:95537391-95537413 AACAACAATAAAAAGACTTCAGG - Intergenic
1012666725 6:101980131-101980153 AAGAGCACTATGTAGAATGCAGG - Intronic
1014328466 6:120029041-120029063 CAGAGCAACAAGAAGGCTTCTGG + Intergenic
1015994101 6:138980282-138980304 ATGAGCAAAAAGAATACTGGGGG - Intronic
1016115504 6:140279851-140279873 AACAGCAACAAGAAAACTCCTGG + Intergenic
1016499477 6:144703238-144703260 TAGAGAGATAAGAAAACTGCTGG + Intronic
1017957504 6:159190546-159190568 AAGACCCAGAAGGAGACTGCAGG - Intronic
1018281894 6:162195402-162195424 AAGAGAGGTAAGAAGACTCCTGG + Intronic
1018483271 6:164213552-164213574 AAGAGCTCAAAGAAGCCTGCTGG - Intergenic
1018882300 6:167896481-167896503 AAGGGCAGCAAGAATACTGCAGG + Intronic
1020983307 7:15099196-15099218 AAGAGAAATAAGAATAGAGCTGG - Intergenic
1025477929 7:60950263-60950285 AAGACAAATGAGAAGAGTGCAGG + Intergenic
1026128452 7:67600117-67600139 AAGAGCGAAAAGATGTCTGCTGG - Intergenic
1028404349 7:90460023-90460045 AAGAGCAAGAAGAAAGTTGCTGG + Intronic
1029884951 7:103858958-103858980 CAGAGAAAGAAGAAGACTGGAGG + Intronic
1030407164 7:109129137-109129159 AAGGGCAAGAAGAAGATGGCAGG + Intergenic
1032370410 7:131344693-131344715 ACCAGCAATAACAATACTGCTGG - Intronic
1033119794 7:138657589-138657611 AAGAGCAATTAGAAAACTGATGG - Intronic
1033923893 7:146432752-146432774 AAGAGCAAAACCAAAACTGCAGG + Intronic
1036950637 8:13135738-13135760 AAGTGGAATAAAAAGACTCCTGG - Intronic
1037454157 8:19047076-19047098 CAGAGGAATAAGAGGCCTGCTGG - Intronic
1037899579 8:22679794-22679816 AAAAGCCAAAAGAAGACTGTTGG - Intergenic
1038046420 8:23769014-23769036 AAGGGCAAAAAGCAGGCTGCAGG + Intergenic
1040988088 8:53318365-53318387 AAGGGCAAGAAAAAGACAGCGGG - Intergenic
1041329914 8:56713759-56713781 GAGAGCAATATGAAATCTGCTGG - Intergenic
1041621786 8:59978738-59978760 AAGACCAAGAATCAGACTGCAGG + Intergenic
1042798669 8:72692917-72692939 AAGTCCAATAATAATACTGCTGG + Intronic
1044398339 8:91741025-91741047 AAGCACAATAATAAGGCTGCTGG + Intergenic
1045521618 8:102907784-102907806 AAGAGTAACAAGAAGACACCTGG + Intronic
1045796797 8:106055853-106055875 AAAAGCAAAAGGAAGGCTGCTGG - Intergenic
1047257105 8:123222278-123222300 AAGAAAAATAAGATGCCTGCCGG - Intronic
1047297703 8:123585976-123585998 AAGAGAAAGAGAAAGACTGCTGG - Intergenic
1047707410 8:127513637-127513659 ATGAACAATAAGAACACTACTGG + Intergenic
1051190072 9:14501928-14501950 AACAGCAATGTGAAGAGTGCAGG - Intergenic
1051577956 9:18638861-18638883 TAGAGCAAAAAGAAAACTGGAGG + Intronic
1051586190 9:18729405-18729427 AAGAGCCACGAGAAGTCTGCAGG + Intronic
1052161597 9:25267677-25267699 AAGAGAAAGAAGAAGAGTGGTGG - Intergenic
1052511818 9:29431905-29431927 AAGAGCCATAGGAAGACAGTGGG - Intergenic
1052805780 9:33011852-33011874 ACTAGCAGTAAGGAGACTGCAGG - Intronic
1053409544 9:37906632-37906654 AAGGGCCATAAGAAGGTTGCTGG + Intronic
1054730739 9:68700517-68700539 AAGAACAATAAGAAAACTGGAGG - Intergenic
1057376168 9:94525239-94525261 AAGAAATATAAGAAGACTGAAGG - Intergenic
1058127058 9:101207322-101207344 GAGGGCAATAATAATACTGCAGG - Intronic
1059553287 9:115251919-115251941 AAGAGAAATAGTAAGAATGCAGG - Intronic
1059906213 9:118989819-118989841 CAGAACAAAAAGAAGACTGATGG + Intergenic
1059933454 9:119284092-119284114 GAGAGAAATAAGAGGACTGGTGG - Intronic
1060186089 9:121564989-121565011 CAGAGCGTTAAGAAGGCTGCGGG + Intergenic
1061058727 9:128239750-128239772 ATGAACAAGAAGAAGACTTCAGG + Exonic
1203493116 Un_GL000224v1:125470-125492 AAGAACATTCAGAAGACAGCAGG - Intergenic
1203505736 Un_KI270741v1:67345-67367 AAGAACATTCAGAAGACAGCAGG - Intergenic
1185912813 X:4000981-4001003 TAGGGCAATAATAAGACTGTGGG + Intergenic
1185987466 X:4851500-4851522 AACAGCAACAAGAAAACTCCAGG + Intergenic
1186194746 X:7099124-7099146 AAGACCAATAAGAAGAAAGTTGG - Intronic
1187450383 X:19391004-19391026 AAGATCAATAAGTAGAATGATGG - Intronic
1188111578 X:26200236-26200258 AAGAGCATTGACATGACTGCTGG - Intergenic
1188338628 X:28971488-28971510 AAGAGCAAGACAAGGACTGCAGG + Intronic
1188345118 X:29054406-29054428 AAGCGTAATAAGGAGACTGAGGG - Intronic
1190062835 X:47222032-47222054 AAGAGGAAGCAGAAGACGGCTGG + Intronic
1192396618 X:70788213-70788235 ATGAGCAAAAAGAATACAGCTGG + Intronic
1192435289 X:71139596-71139618 AGGTGCAAGAAGAAGACTTCAGG + Intronic
1192765148 X:74132430-74132452 CAGGGCAAGAATAAGACTGCAGG - Intergenic
1192765741 X:74138083-74138105 AAGGGCAAGAAGAAGACGGTAGG - Intergenic
1193451804 X:81679902-81679924 CAGAGGAATATGAAAACTGCAGG - Intergenic
1193665739 X:84314051-84314073 AAAAGAAAAAAGAAAACTGCAGG + Intergenic
1195315816 X:103676777-103676799 AAGAACAAGCAGAAGACTCCTGG - Exonic
1195573309 X:106421058-106421080 AAAAGCAATTAGAAGACTATTGG - Intergenic
1196142455 X:112279059-112279081 AAAAACAATAAGAAAACTGAAGG + Intergenic
1197288844 X:124630108-124630130 ATGAACAAAAAGAAGACTGTTGG + Intronic
1198021367 X:132661655-132661677 AAAAGAAAAAAGAAGCCTGCTGG - Intronic
1198430587 X:136562809-136562831 ATGAGCAATAAGAAGTCTGAAGG - Intergenic
1200295611 X:154916255-154916277 AACAGCAAAAAGAAAACTACAGG - Intronic
1201648294 Y:16259536-16259558 AAGAGCAATAAAAGGACAGGAGG - Intergenic
1201654516 Y:16325765-16325787 AAGAGCAATAAAAGGACAGGAGG + Intergenic
1202061703 Y:20896077-20896099 AAGGGCAAGAAGAAGATGGCAGG - Intergenic