ID: 950020561

View in Genome Browser
Species Human (GRCh38)
Location 3:9784548-9784570
Sequence ATTTAAATATGTGCACATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 569
Summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 517}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950020561_950020565 4 Left 950020561 3:9784548-9784570 CCCTTATGTGCACATATTTAAAT 0: 1
1: 0
2: 2
3: 49
4: 517
Right 950020565 3:9784575-9784597 TGTAAGTAAGCCAGGCATGGTGG 0: 1
1: 3
2: 80
3: 1106
4: 9494
950020561_950020564 1 Left 950020561 3:9784548-9784570 CCCTTATGTGCACATATTTAAAT 0: 1
1: 0
2: 2
3: 49
4: 517
Right 950020564 3:9784572-9784594 TATTGTAAGTAAGCCAGGCATGG 0: 1
1: 0
2: 3
3: 66
4: 836
950020561_950020563 -4 Left 950020561 3:9784548-9784570 CCCTTATGTGCACATATTTAAAT 0: 1
1: 0
2: 2
3: 49
4: 517
Right 950020563 3:9784567-9784589 AAATATATTGTAAGTAAGCCAGG 0: 1
1: 0
2: 1
3: 22
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950020561 Original CRISPR ATTTAAATATGTGCACATAA GGG (reversed) Intronic
900842221 1:5061945-5061967 AATTAAATATATCCACACAATGG + Intergenic
900897235 1:5492220-5492242 TTTTATATATCTGCACATCAAGG - Intergenic
903677841 1:25075830-25075852 ATTCGAATATGTGCACATTTGGG - Intergenic
904185007 1:28697150-28697172 ATATATATATGTACACACAAGGG - Intronic
905053192 1:35070852-35070874 ATTTCAATATATGCAGAAAAAGG - Intronic
905101016 1:35522150-35522172 ATATATATATATGCACATATAGG + Intronic
906182402 1:43833566-43833588 TTTTAAAGATGTGCAAATTAAGG + Intronic
908072676 1:60480439-60480461 ATATAAATATATGTACACAAGGG + Intergenic
908191546 1:61708635-61708657 AATTAATTTTTTGCACATAAAGG - Intronic
908744660 1:67364089-67364111 ATTTAAATATATAGACATATAGG + Intronic
909003810 1:70252088-70252110 ACTGAAATATGTGGACAGAAAGG - Exonic
909008507 1:70305532-70305554 ATGTATATATGTGCATATATTGG - Intronic
909053932 1:70800522-70800544 ATTTCAATATATGAACCTAAGGG + Intergenic
909074784 1:71039958-71039980 ATTAACATATGTGAAAATAATGG - Intronic
909175271 1:72349486-72349508 ATTTAAAGATGAGGAAATAAAGG + Intergenic
909748843 1:79134022-79134044 TTTTAATTATGTGCAAATTAAGG + Intergenic
910043969 1:82889422-82889444 ATTTAAAAATGTATACATAAGGG - Intergenic
910611302 1:89145263-89145285 TTTTAAATAATTTCACATAAAGG + Intronic
911534473 1:99083613-99083635 ATGTAAATATATACACATATGGG - Intergenic
912186899 1:107288220-107288242 TTTCAAAAATGTGAACATAAGGG + Intronic
912285805 1:108367502-108367524 ATTTAAATAACTGTACATAGGGG - Intergenic
912571317 1:110625339-110625361 ATATAAATTTGTATACATAAAGG + Intronic
912674725 1:111668121-111668143 ATTTAGATATGGAAACATAAAGG - Intronic
912887870 1:113494938-113494960 ATTTAAATATGTCCTCAAAAAGG + Intronic
913092247 1:115484592-115484614 ATTACAAAAGGTGCACATAATGG + Intergenic
913482806 1:119304948-119304970 CTTTAAATATGTGCAGTTTATGG - Intergenic
913717419 1:121550864-121550886 TTTTAATTATGTGCAAATTAAGG + Intergenic
914728921 1:150353160-150353182 CTTTAATCATATGCACATAAGGG - Exonic
914974256 1:152344816-152344838 ATTTGAATATTTGCAGATTAGGG - Intergenic
914982671 1:152428984-152429006 ATAAAAATATGTGTATATAAGGG - Intergenic
916262651 1:162857797-162857819 ATTTAAATATGGGCACCTTGAGG + Intronic
916325104 1:163548123-163548145 CTTTGAATATTTTCACATAAAGG - Intergenic
916331150 1:163618683-163618705 ATTTAAGTATCTACATATAAAGG - Intergenic
916963992 1:169916456-169916478 AGTTAAATATTTGCAAATATAGG - Intergenic
918183413 1:182106103-182106125 ATTTAAATATAGCCACATGAGGG - Intergenic
918472725 1:184890924-184890946 ATTTAAGTATGTGCATCTGACGG + Intronic
918804339 1:189019750-189019772 ATTTTAATTTGTGTACATTAAGG - Intergenic
918858201 1:189786650-189786672 ATTTAAATATGGGTACATTTTGG - Intergenic
918905838 1:190491988-190492010 ATTTAAATATTTTAAAATAAAGG + Intergenic
918998670 1:191798320-191798342 ATATAAATATGTACATATTATGG - Intergenic
919185911 1:194148944-194148966 ATTTAAAGTTGTTCACAAAACGG - Intergenic
919365638 1:196657524-196657546 ATTTAAGTATGTGCAGATTTTGG + Intronic
921426207 1:215003717-215003739 ATATAAATATGTGCAAAGTAGGG - Intergenic
924269940 1:242321780-242321802 ATTTATAAACGTGCACACAAGGG - Intronic
1062775355 10:140760-140782 GCTTAAGTATGTGCACGTAAGGG - Intronic
1063042096 10:2352686-2352708 ATTTAAATATAAGTACATATAGG + Intergenic
1063604772 10:7513362-7513384 AGTTAAATATGTGAACTTAATGG + Intergenic
1064670697 10:17710880-17710902 ATTTAAATATCTATATATAAAGG + Intronic
1065419790 10:25530257-25530279 ATTAAAATATGCCCACATATTGG - Intronic
1065420333 10:25536721-25536743 AGTTTAATCTGTGCATATAATGG - Intronic
1066081281 10:31933197-31933219 ATATATATATATGCACATACAGG - Intergenic
1067022681 10:42815491-42815513 ATTAAAACATTTTCACATAAGGG - Intronic
1067491484 10:46708972-46708994 ATTTAAATCTTTGCACAGTAAGG - Intergenic
1067603177 10:47631406-47631428 ATTTAAATCTTTGCACAGTAAGG + Intergenic
1068146145 10:53073391-53073413 AATTAAATGTATGGACATAATGG + Intergenic
1068306337 10:55213215-55213237 ATTAAAATATGTGCATACATAGG + Intronic
1068320641 10:55409749-55409771 ATGTAAATATGTGCACATCCAGG + Intronic
1068784257 10:60953153-60953175 ATTTAAATATATGGACAACATGG + Intronic
1068942994 10:62699040-62699062 ATTCAAATTTGTGCACAAAATGG + Intergenic
1069136358 10:64771352-64771374 ATTTTATCATCTGCACATAATGG + Intergenic
1069136947 10:64779743-64779765 ATTTAAATATCAGTACAAAAAGG + Intergenic
1069296678 10:66854467-66854489 ATATATATATGTACAAATAACGG + Intronic
1069478175 10:68755515-68755537 ATCTAAGTGTGTGCACACAATGG + Exonic
1069824833 10:71248515-71248537 ATTTAAATATTTGGGCCTAAAGG + Intronic
1069968924 10:72148186-72148208 ATTAAAAGATGTGCACTCAAGGG - Intronic
1070455168 10:76607148-76607170 ATTTAAATAGGTTTAAATAAAGG + Intergenic
1071531093 10:86390785-86390807 ATTTAAGGATGGGAACATAAAGG + Intergenic
1071594105 10:86905928-86905950 ATAAAAATATGTGTACATATAGG - Intronic
1072808511 10:98442437-98442459 CTTTAAATATGTGCAATTTATGG + Intronic
1072914486 10:99529434-99529456 ATATAAATATAGGCAGATAATGG - Intergenic
1073555742 10:104449289-104449311 TTTTAAATATTTGCATAAAAGGG - Intronic
1073713727 10:106076791-106076813 CTTTAAATATGTGTAGATAAAGG + Intergenic
1073744023 10:106445387-106445409 TTTGAAATATGTGTACATTATGG - Intergenic
1074266637 10:111910833-111910855 ATTTAAATATGAGTCCAAAAGGG - Intergenic
1074636325 10:115322483-115322505 TTTTAAATATATGTATATAATGG - Intronic
1074925985 10:118071475-118071497 TTTTAAATATTTGCTCCTAAAGG - Intergenic
1075251578 10:120880804-120880826 TTTTAAATATTTGCAATTAAAGG + Exonic
1076246643 10:128952143-128952165 ATTTAAAAATGTACACATTTAGG + Intergenic
1077767327 11:5173799-5173821 ATTTAAAAATATGCAAATGATGG + Intronic
1079476609 11:20836937-20836959 TTTTAAATATGTACACATTGAGG - Intronic
1081620389 11:44615821-44615843 TTTTACGTATGTGCACATACTGG - Intronic
1083077191 11:60053134-60053156 ATTTTAATATGTACACACATGGG + Intergenic
1084343181 11:68522988-68523010 ATTTAGAAATGTGGAAATAAGGG - Intronic
1085142088 11:74155294-74155316 ATTTAAATATGAACAAAAAATGG + Intronic
1085377647 11:76081034-76081056 ATTTATAAATGTGAACACAATGG - Intronic
1085861541 11:80241749-80241771 ATTTCAATATGTGCAGATTGGGG - Intergenic
1086260883 11:84938892-84938914 ATGCAAACATGTGCACACAAAGG - Intronic
1086748782 11:90463799-90463821 ATTTAAATAACTTCACATAATGG + Intergenic
1088047157 11:105468158-105468180 ATTTAAATATTTGCCCTGAAAGG - Intergenic
1088140984 11:106615999-106616021 ATTTAGATATTTACAAATAATGG + Intergenic
1088539356 11:110897075-110897097 TTTTGAATATGTATACATAATGG + Intergenic
1088910310 11:114186057-114186079 ATTTAAAATGGAGCACATAAAGG + Intronic
1089803734 11:121063494-121063516 ATTTAAAGATATGGAAATAAAGG - Intronic
1090079392 11:123601564-123601586 ATTTAAATATATACATATATTGG + Intronic
1090508144 11:127341757-127341779 ATTTAAATATGTGTGAACAAAGG - Intergenic
1092019603 12:5190221-5190243 ATTTAAACAAGCCCACATAATGG + Intergenic
1093027359 12:14257295-14257317 ATTTAAATATGGTTACAAAACGG + Intergenic
1093111673 12:15160156-15160178 ATATATATATGTGCACATTTTGG + Intronic
1093126047 12:15329903-15329925 GTTTAAATATATACACACAAAGG + Intronic
1093451987 12:19326229-19326251 ATATAAATAAGTTTACATAAAGG - Intronic
1095755337 12:45759296-45759318 ATGTGTATATGTGCACATATAGG + Intronic
1097472548 12:60012884-60012906 ATTAAAGGTTGTGCACATAAAGG + Intergenic
1097480008 12:60112044-60112066 ATTAGAATATGTGCACCTAGAGG + Intergenic
1097939783 12:65291451-65291473 ATTTAAACATGTTTAAATAAGGG - Intronic
1097998096 12:65912284-65912306 TTTTAAAGCTGTGCACTTAATGG - Intronic
1098066222 12:66620178-66620200 ATATGAATATGTGCAAGTAACGG + Intronic
1098777513 12:74639423-74639445 TTTTAAATATGTGTACATTGTGG - Intergenic
1098897177 12:76077108-76077130 ATTTTAATGTGTTCACAGAATGG + Intronic
1099324735 12:81200301-81200323 AATAAAATATGTACATATAAAGG - Intronic
1099630322 12:85134249-85134271 ATTTGAATATATGTGCATAATGG - Intronic
1099655629 12:85486262-85486284 ATTTAAAAATATATACATAATGG - Intergenic
1099716334 12:86297471-86297493 ATTTGAGTCTGTGCACATTAAGG + Intronic
1099759514 12:86899067-86899089 ATTTAAATAGATGCAAAAAAAGG - Intergenic
1100349190 12:93762591-93762613 TTTTAACTATTAGCACATAACGG - Intronic
1101058146 12:100941169-100941191 GTTTACATATATGCACACAAAGG + Intronic
1102263908 12:111465177-111465199 ATTAAAACATGTCTACATAAAGG + Intronic
1102433963 12:112905789-112905811 TTTTAAATACGTGCAAATTAAGG + Intergenic
1102859622 12:116324172-116324194 ATTTAGATATGTCCAGAGAAGGG - Intergenic
1103840052 12:123855668-123855690 ATATATATATGCGCACCTAAAGG + Intronic
1104007946 12:124907970-124907992 ATTCAAAAATATGCACATTAAGG + Intergenic
1104434292 12:128743430-128743452 TTTTAATTATGTGCAAATTAAGG - Intergenic
1105677878 13:22694109-22694131 TTTGAAATATGTACACATTATGG + Intergenic
1105972901 13:25447312-25447334 ATTTTGATATATGCACACAATGG + Intronic
1107582013 13:41800475-41800497 TTTTAAATGTGTGAAAATAAAGG - Intronic
1107845264 13:44506213-44506235 ATTTAAATATGGTCCCAGAAGGG + Intronic
1108014152 13:46056007-46056029 TTTAAAATATGTGCACTTTATGG + Intronic
1108441843 13:50462126-50462148 ATTTAAATTTGTACATTTAATGG - Intronic
1108539109 13:51420260-51420282 ATTTAAAAATGTGCATACACTGG + Intronic
1109351215 13:61184121-61184143 TTTTAAGTATGTGTACCTAAAGG - Intergenic
1109487293 13:63043156-63043178 ATTCAAATATCTGCATATAACGG - Intergenic
1110029114 13:70583346-70583368 TTTAAAATATGTGCATAAAATGG + Intergenic
1110397628 13:75049874-75049896 ATATAAATATGTGTATATATGGG - Intergenic
1110958563 13:81590163-81590185 ATTTACTGATGTGCAAATAAGGG - Intergenic
1111171542 13:84533416-84533438 ATTTAAGTCTGTGCAGAGAAGGG - Intergenic
1111263604 13:85777126-85777148 ATATAAATATGTTCATATCATGG + Intergenic
1112828140 13:103415935-103415957 ATATATGTATGTGTACATAAAGG + Intergenic
1113373562 13:109743934-109743956 GTGTAAATATCTGCACCTAAGGG - Intergenic
1114777514 14:25501064-25501086 ATGTGTATATGTGCACAGAAAGG + Intergenic
1115237290 14:31219995-31220017 ATTGCAAAATGTGCACATTAGGG + Intergenic
1115675194 14:35665828-35665850 ATTCAGGTATGTGCACATAATGG + Intronic
1116311582 14:43333989-43334011 CTTTAAATATGTGTTCAAAATGG + Intergenic
1116404176 14:44548222-44548244 ATTTAAATATTTGCCCAAACTGG + Intergenic
1116548937 14:46209388-46209410 ATTTAATTATGTGCTCATAATGG + Intergenic
1118112657 14:62739319-62739341 ATCTAAATATTTTCACATATTGG - Intronic
1118458184 14:65963737-65963759 ACTTAAATATGTGAATAAAAAGG + Intronic
1119094423 14:71815676-71815698 ATTTAATTATGTGCACATGCTGG + Intergenic
1120427537 14:84367792-84367814 ATTTAAATATGAGCATATCTAGG - Intergenic
1120435286 14:84474011-84474033 TTTAAAATATGTTCACAGAAAGG - Intergenic
1120447789 14:84623040-84623062 ATTCAAATATGTAAAGATAATGG + Intergenic
1121512800 14:94525000-94525022 CTTTAAATATCTACTCATAAGGG - Intergenic
1123423793 15:20152390-20152412 ATTAAAACATTTTCACATAAGGG - Intergenic
1123533015 15:21158911-21158933 ATTAAAACATTTTCACATAAGGG - Intergenic
1124082199 15:26511251-26511273 ATTTAGATCTGTGTAAATAAAGG - Intergenic
1124102172 15:26705834-26705856 ATTTAAATATGTGCAGTTCATGG + Intronic
1126988223 15:54339628-54339650 ATATATATATCTCCACATAATGG - Intronic
1127039406 15:54957115-54957137 ATTTGATTATGTGGACAAAAGGG + Intergenic
1127722158 15:61713611-61713633 ATTTCAGTATGCTCACATAAAGG + Intergenic
1128933057 15:71722869-71722891 ATTTAAAAGTGTGCACAAACGGG + Intronic
1129071899 15:72958519-72958541 ATTTTAATAGGTGCACATGGAGG - Intergenic
1130385772 15:83410435-83410457 ATTGTAATATATTCACATAATGG - Intergenic
1131089082 15:89606169-89606191 ATTTATATATATGTATATAACGG - Intronic
1131349408 15:91683692-91683714 TTTGAAATATGTGCACATTGTGG + Intergenic
1133540306 16:6746124-6746146 ACTTAAATATGTGAGCATACAGG + Intronic
1133693942 16:8242914-8242936 ATTAAAACATGGGCACATATTGG - Intergenic
1134428052 16:14171779-14171801 ATTTAAACATGTGAACTTTATGG + Intronic
1134858665 16:17541375-17541397 AGGTAAATATTTGCAAATAAAGG + Intergenic
1134895045 16:17878452-17878474 ATAAAAATATTTTCACATAACGG + Intergenic
1135863879 16:26082519-26082541 ATTTACAAATGAGGACATAACGG - Intronic
1136127085 16:28191957-28191979 TTTTAAATAAGTTAACATAATGG + Intronic
1136674045 16:31883403-31883425 ATGTGCATATGTGCACATAATGG - Intronic
1136861036 16:33703214-33703236 ATTAAAACATTTTCACATAAGGG + Intergenic
1137474176 16:48792445-48792467 ATTTTAGAATGTGCACATATAGG - Intergenic
1137939901 16:52673796-52673818 ATTTAATTATGTGCAAAGAGAGG + Intergenic
1138083467 16:54113737-54113759 TTTTAAATATGGGCACCTAATGG - Exonic
1138385039 16:56630671-56630693 ATTTATTTATTTGCACATAAAGG + Intergenic
1138501820 16:57450747-57450769 ATTTAAAAATCTGCACATTGGGG + Intronic
1139291819 16:65865672-65865694 ATTTTTATATATGTACATAAAGG + Intergenic
1140434432 16:74934345-74934367 ATTTAAATATGTTCACCAACTGG + Intronic
1140672024 16:77288733-77288755 ATTTGAAAATGGGAACATAAAGG - Intronic
1141341438 16:83207475-83207497 CTTTACATATGTACACATATAGG + Intronic
1203122530 16_KI270728v1_random:1551404-1551426 ATTAAAACATTTTCACATAAGGG + Intergenic
1144612555 17:16735938-16735960 ATTAAAACATGGCCACATAAAGG - Intronic
1144900173 17:18579340-18579362 ATTAAAACATGGCCACATAAAGG + Intergenic
1145132273 17:20366325-20366347 ATTAAAACATGGCCACATAAAGG - Intergenic
1148063746 17:44853885-44853907 ATGTAAATATGTGCAGAAGAAGG - Intronic
1149006282 17:51809701-51809723 ATTTAGATATGTGGACATATCGG + Intronic
1149462790 17:56845935-56845957 ATTTAAATATGTGGATAAACAGG + Intronic
1149708344 17:58716213-58716235 ATATAAATATTTGCTAATAATGG + Intronic
1149826807 17:59835817-59835839 ATATAAATATATGCACAAAAAGG - Intronic
1150891782 17:69160306-69160328 ATTTAAAAATGGGCAAATAATGG + Intronic
1151017263 17:70569998-70570020 ATTTAATTGTGTGCACAGAGAGG - Intergenic
1151775144 17:76196015-76196037 TTTTAATTATGTGCAAATTAAGG - Intronic
1151933570 17:77247956-77247978 ATTTTAAAATGTGCACTTAAAGG - Intergenic
1152023824 17:77796170-77796192 ATTTAAGTATGTACATTTAATGG + Intergenic
1153367820 18:4278152-4278174 AGTTAAATATGTATACAAAAAGG + Intronic
1153396995 18:4634271-4634293 ATTTAAATATAAATACATAAAGG + Intergenic
1155132399 18:22951330-22951352 AATTAAATATATGCACAGACAGG - Intronic
1155266777 18:24102367-24102389 ACTTGATTATGTACACATAATGG - Intronic
1155459812 18:26065877-26065899 ATTTAAAAATGGGCAGAAAAGGG + Intronic
1155879356 18:31124668-31124690 ATTTAAAAATGTGCATATTTAGG + Intergenic
1155940569 18:31798425-31798447 ATTTAAATATATGTAGATTAAGG + Intergenic
1156359780 18:36374469-36374491 AATTAAATATGACTACATAAAGG + Intronic
1156541644 18:37917691-37917713 ATTTAAAAATGACCACATACAGG + Intergenic
1156801451 18:41119625-41119647 AGTTAAATTTGTGAACAAAAGGG + Intergenic
1156811929 18:41263209-41263231 TCTGAAATATGTGCCCATAAGGG + Intergenic
1156888109 18:42158940-42158962 TTTAAATTATTTGCACATAAAGG + Intergenic
1157417601 18:47518857-47518879 AATTTAGTATATGCACATAAAGG + Intergenic
1158674231 18:59503668-59503690 TTTTAAATATCTGCACTTGATGG - Intronic
1158998547 18:62948733-62948755 ATTTACATGTTTGTACATAAAGG - Intronic
1159418093 18:68179909-68179931 ATTTATAGAAGTGGACATAAAGG + Intergenic
1163920753 19:20286373-20286395 GTTTATATACGTGCACATCAAGG + Intergenic
1163949849 19:20573209-20573231 TTTCTAATTTGTGCACATAAAGG + Intronic
1163968161 19:20768195-20768217 TTTCTAATTTGTGCACATAAAGG - Intronic
1164135505 19:22411738-22411760 ATTCACATATGTGAAAATAAGGG - Intronic
1164162987 19:22642248-22642270 ATTTACATACGTGAAAATAAGGG + Intronic
925475263 2:4206267-4206289 TTTTAATTATATGCAAATAAGGG + Intergenic
925480592 2:4266792-4266814 ATATACACATGTGCACATACAGG - Intergenic
927036868 2:19187236-19187258 CCTTAAATCAGTGCACATAAAGG - Intergenic
928236090 2:29542069-29542091 ATTTATTAATGTGCACACAAAGG - Intronic
928639390 2:33282052-33282074 ATATATATATATGCACATATAGG - Intronic
929260129 2:39857422-39857444 ATGTACATGTGTGCACATCAGGG + Intergenic
929673609 2:43901597-43901619 TTTTAAATATGAGCACCAAATGG + Intronic
933012266 2:77081506-77081528 ACATATATATGTGCACATAGAGG + Intronic
934459405 2:94204377-94204399 ATTAAAACATTTTCACATAAGGG + Intergenic
935288434 2:101587854-101587876 TTTTAATTATGTGCAAATTAAGG + Intergenic
936157304 2:110056704-110056726 GTTTATGTATGTGCACATCAAGG + Intergenic
936187390 2:110314740-110314762 GTTTATGTATGTGCACATCAAGG - Intergenic
936279250 2:111123065-111123087 ATTTAGAGATGTGCACCTCACGG + Intronic
936892067 2:117383084-117383106 ATATATATATATGCACATAATGG - Intergenic
937069429 2:119051780-119051802 ATTTACATATGAGCATAAAAAGG + Intergenic
937761435 2:125608472-125608494 AGATAAATATTTGAACATAATGG + Intergenic
938017215 2:127877045-127877067 ATATATATATATGTACATAAAGG + Intronic
939000099 2:136724740-136724762 TTTTAAATTTGTGTACATAGAGG + Intergenic
939087751 2:137741994-137742016 ATTTAAAAAGGAGCACATAAAGG + Intergenic
939454632 2:142418473-142418495 ATTAATGTATGTGCACAAAATGG - Intergenic
940421503 2:153484329-153484351 ATTATAGTATGTTCACATAATGG - Intergenic
940923299 2:159334749-159334771 ATTTAAATATATCAATATAAAGG + Intronic
940943344 2:159588273-159588295 ATTTAAATATGGTTATATAATGG - Intronic
941166366 2:162087361-162087383 ATATAGATATGTGCAGATACAGG - Intergenic
941274303 2:163471366-163471388 AATTAAATAAGTGGACATCAGGG + Intergenic
941314457 2:163975278-163975300 TTTTCAATATGTGAACAGAATGG - Intergenic
941366811 2:164620533-164620555 ATTTAAATGTATGAATATAAAGG + Intronic
941495454 2:166195875-166195897 ATTTAAATTTTTGTAGATAAGGG - Exonic
941675886 2:168343186-168343208 ATGTAAAGATGTGGACATTATGG + Intergenic
941780857 2:169443213-169443235 TTCTTAATATGAGCACATAATGG - Intergenic
942185838 2:173424362-173424384 ATTTAACCATGTGAACATATTGG - Intergenic
942529217 2:176890515-176890537 ATTTAAAAATATTCATATAAAGG - Intergenic
943158375 2:184214427-184214449 TTTCTAGTATGTGCACATAAAGG + Intergenic
943178274 2:184506771-184506793 ATTTAATTATTTTCAAATAAAGG + Intergenic
943432634 2:187823956-187823978 ATTTAATTGTATGCACAAAATGG + Intergenic
944038116 2:195322186-195322208 ATTTAAATGTTTGAAGATAAGGG - Intergenic
944207741 2:197174531-197174553 ATGTATATATGTGCACATAAAGG + Intronic
944341317 2:198604178-198604200 ATTTAAGAATGTGTACATTAAGG - Intergenic
944591384 2:201221021-201221043 ATTTAAATAGATGCACACATAGG - Exonic
944648345 2:201803127-201803149 ATTCATATATGTCCACACAATGG - Intronic
945190070 2:207178775-207178797 AGTTTAATAAGTACACATAAAGG - Intergenic
945567509 2:211420114-211420136 ATTTATTTATATACACATAATGG + Intronic
947024702 2:225724183-225724205 ATTTATATTTGTCTACATAATGG + Intergenic
947036370 2:225862474-225862496 ATTTAAATATGTATATATTAAGG - Intergenic
947441205 2:230122999-230123021 ATATAAATATATACATATAAAGG + Intergenic
947803291 2:232946067-232946089 ATATATATATATGCACACAATGG + Intronic
1169108267 20:3015915-3015937 ATTTAACCATGATCACATAATGG + Intronic
1169927055 20:10794377-10794399 TTTTAAAAATGTGAACAAAAAGG - Intergenic
1170223328 20:13964172-13964194 ATTTAAATATTTAGACATACAGG - Intronic
1170487328 20:16832128-16832150 ATTTAGATATTTACAAATAATGG + Intergenic
1170678067 20:18500560-18500582 TTTTAAATATGTGCAGCTTAAGG + Intergenic
1170879912 20:20287883-20287905 ATTGAAATTTGAGCACAGAATGG + Intronic
1171163579 20:22951009-22951031 ATTTGGAAATGTGCACAGAATGG + Intergenic
1172431399 20:34895235-34895257 ATATATATATATGCACATATAGG + Intronic
1174145625 20:48450478-48450500 ATATAAATATGAGTGCATAATGG + Intergenic
1174964959 20:55202140-55202162 TTTGAAATATGTGTACATTATGG - Intergenic
1175296981 20:57915240-57915262 CTTTCAATATGGCCACATAAGGG + Intergenic
1177413462 21:20762338-20762360 ATTAAAATGTGTGAATATAATGG + Intergenic
1177461476 21:21416692-21416714 ATTTAAATATTTTTACTTAATGG + Intronic
1177675727 21:24295884-24295906 TTTTAATTATATGCAAATAAAGG + Intergenic
1177909093 21:27008747-27008769 ATTTAAATATGGGAACACTAAGG - Intergenic
1179169922 21:38964880-38964902 CTTAAAATATGTGAAAATAAGGG + Intergenic
1179663716 21:42894831-42894853 ATGTTTATATGTGCACATACAGG + Intronic
1180577369 22:16791500-16791522 GTTGAAATATGTACACAGAATGG + Intronic
1182966844 22:34529744-34529766 ATTTAAAGAGGTGCACAAGAAGG + Intergenic
1182970508 22:34570246-34570268 TTATAAATATGTATACATAAAGG - Intergenic
949744482 3:7272526-7272548 ATTTGAATATGTACACATTAAGG - Intronic
950020561 3:9784548-9784570 ATTTAAATATGTGCACATAAGGG - Intronic
950977248 3:17261317-17261339 ATATATAAATGTACACATAAAGG + Intronic
951011291 3:17683133-17683155 ATTTTAACATGTGCATAAAAAGG - Intronic
951424831 3:22532153-22532175 ATTCAGATATATGCACATAAAGG + Intergenic
951642565 3:24852525-24852547 ATGAAAATATGTCCACATAAAGG + Intergenic
951842086 3:27045268-27045290 ATGTAAATATGTGTACTTTAAGG - Intergenic
952065405 3:29563694-29563716 ATTATAATATTTACACATAATGG - Intronic
952852724 3:37742098-37742120 ATGAGAATATATGCACATAAAGG - Intronic
953102769 3:39846044-39846066 ATTAAAATATATGCACATTTTGG + Intronic
953278537 3:41529335-41529357 ATTTAAACATGTCTACATGAAGG - Intronic
953796629 3:45991076-45991098 TTTTAAAAATGTGCTCATGATGG - Intronic
954163449 3:48738429-48738451 ATTTAACTATGTGTAGTTAAAGG + Intronic
954585094 3:51727349-51727371 TCTTAATTATGTGAACATAATGG - Intergenic
955497257 3:59546900-59546922 ATTTAAATATGGCTTCATAAAGG + Intergenic
955877770 3:63511391-63511413 ATTAAAACATGTGAACAGAATGG - Intronic
956017251 3:64896560-64896582 ATTTAAATGTGTACAGAAAAGGG + Intergenic
956827570 3:73012682-73012704 ATTTAAAATTGTGCAACTAAAGG + Intronic
956828173 3:73018321-73018343 ATTTAAGTATGTGCAGATTTTGG + Intronic
957288550 3:78247968-78247990 ATTTAAATAAAAGCACAGAAAGG + Intergenic
957613832 3:82503967-82503989 CATTAAATATATGCAGATAAGGG - Intergenic
958157697 3:89775479-89775501 ATTTACTTATATGCTCATAAGGG - Intergenic
959409598 3:106004171-106004193 CTTTAAATATGTACACCAAATGG + Intergenic
959509332 3:107192042-107192064 AAGTAGATATGTTCACATAAAGG + Intergenic
959531741 3:107441172-107441194 TTTTAAATATGGGCCCATGATGG - Intergenic
959581031 3:107982522-107982544 ATTTAAAAAAGTAAACATAATGG + Intergenic
960647567 3:119905094-119905116 ATTTAAATATTTGTTAATAAAGG + Intronic
961349224 3:126288368-126288390 ATTTACACATGCGCACATAATGG + Intergenic
961374429 3:126453973-126453995 ATATATATATGTGTACATATAGG + Intronic
961632834 3:128313734-128313756 ATTCATATATGTCCACATGAGGG - Intronic
962207698 3:133448476-133448498 ATTTTCATATCTGCAGATAAAGG - Exonic
962567776 3:136680372-136680394 TTTTAAAAATCTTCACATAAAGG + Intronic
963199722 3:142573990-142574012 ATTTAAAAATGTGAACAAAGAGG + Intronic
963342920 3:144058787-144058809 ATTTACATATTAGCACCTAATGG - Intergenic
963782415 3:149499636-149499658 ATGTAAATATATGTAAATAAAGG + Intronic
964034057 3:152174269-152174291 ATTGAAATATGTGTCCAGAAGGG + Intergenic
964066982 3:152592142-152592164 ATCTAAATATGAGCCCATAAAGG - Intergenic
964197298 3:154079522-154079544 TTTTAATTATGTGCAAATTAAGG + Intergenic
964201661 3:154123797-154123819 ATTTTAATAAGTGCAGCTAATGG - Intronic
965239807 3:166181187-166181209 TTTTAATTTTATGCACATAATGG - Intergenic
965290126 3:166867461-166867483 ATTTAAATAAATGTAGATAATGG - Intergenic
965342669 3:167509725-167509747 ATTCTAATATGTGCACATGAAGG + Intronic
966282924 3:178255590-178255612 AATAAAATATGTGGACACAAAGG - Intergenic
966670091 3:182516914-182516936 ATTGAAATATTTAGACATAATGG + Intergenic
966916543 3:184587428-184587450 CTTAAAATATGTGCAACTAAGGG - Intronic
969553634 4:7891035-7891057 ATTGCAATATGTTCACACAATGG + Intronic
970860320 4:20695229-20695251 ATTTATATATATCCACAAAATGG - Intergenic
971464638 4:26943288-26943310 TTTTGAATATGTGTAAATAAGGG - Intronic
971519971 4:27537183-27537205 ATTACAATATGTGGCCATAAAGG - Intergenic
972734171 4:41824239-41824261 ATTTAAAGATGTAGAGATAAAGG + Intergenic
973771935 4:54214622-54214644 AATAACTTATGTGCACATAATGG - Intronic
973842542 4:54876726-54876748 TTTTAATTATGTGCAAATTAGGG + Intergenic
974961982 4:68713841-68713863 ATTTACAAATGAGAACATAAGGG - Intergenic
974996954 4:69173351-69173373 TTCTAAATATATACACATAATGG + Intronic
975009920 4:69338302-69338324 TTCTAAATATATACACATAATGG + Intronic
975253519 4:72208084-72208106 ATATAAATATGTGAACTTACAGG + Intergenic
975880647 4:78902303-78902325 ATATTAATATGAGAACATAATGG + Intronic
976021183 4:80629092-80629114 ATTAAAAAATGTGGACACAATGG + Intronic
976178590 4:82378234-82378256 CTTTAAAAATTTGAACATAAGGG - Intergenic
976562528 4:86518384-86518406 TTTCCAATTTGTGCACATAAAGG + Intronic
976700163 4:87961030-87961052 ATATAAAAATGTACACAAAATGG - Intergenic
977816392 4:101417845-101417867 ATGTATATATATGCACATATAGG - Intronic
978608283 4:110507016-110507038 ATGAAAGTATGTGCACAAAATGG + Intronic
978839880 4:113199128-113199150 ATTTAAATGTATGTACATCAGGG - Intronic
978998510 4:115186368-115186390 ATATACATATGTGCATATACAGG + Intergenic
979061878 4:116073164-116073186 ATTTTAGTCTGTTCACATAAAGG + Intergenic
979339285 4:119501584-119501606 CTTTAAATAAATGCACACAATGG - Intronic
979773682 4:124560686-124560708 ATTTCTATATGTGAACATATTGG + Intergenic
979905388 4:126283343-126283365 ATTTAAAAATGTAAACATCATGG - Intergenic
979959096 4:126994528-126994550 ATTTAAATATGTACATAGAATGG + Intergenic
980297748 4:130944277-130944299 ATTTAAATCTCTGCAGTTAAAGG - Intergenic
980785358 4:137547207-137547229 GTTTAAATATTAGCACTTAACGG + Intergenic
981469205 4:145110760-145110782 ATTGAAATATATACACAAAATGG - Intronic
981901989 4:149877039-149877061 AATTAAATATGTGAAGATATGGG - Intergenic
982652444 4:158103171-158103193 TTTTAATTATGTGCAAATTAAGG + Intergenic
982881742 4:160728549-160728571 CTTACAATATGTGCACATAAAGG - Intergenic
983820768 4:172191334-172191356 ATTTAATTATGTGAACAGAAAGG - Intronic
984197539 4:176676954-176676976 TTTTAATTACGTGCAAATAAAGG - Intergenic
984317911 4:178151823-178151845 ATTTACATATATGCAAATTAGGG - Intergenic
984337370 4:178410011-178410033 ATTTAAATATTTTCACCTAGTGG - Intergenic
985077235 4:186227717-186227739 ATTTAAATATTTCTACATAAAGG - Intronic
985904244 5:2820790-2820812 TTCTAAATATATGCAGATAACGG - Intergenic
985984720 5:3504968-3504990 ATGAAAATATGTGGACATATAGG - Intergenic
986423660 5:7609323-7609345 ATTTTAATATAAGCCCATAAGGG + Intronic
987173746 5:15285788-15285810 ATTAAAATCTTTGCAGATAATGG + Intergenic
987291602 5:16513488-16513510 ATTTAAATAAAGGCACATATTGG - Intronic
987499906 5:18696714-18696736 ATTAAAACATCTGCAAATAATGG + Intergenic
987850193 5:23341629-23341651 ATTTTATTATTTGCACTTAAAGG - Intergenic
987893048 5:23907954-23907976 ATTTAAATATGCACATTTAAAGG + Intergenic
988110245 5:26809990-26810012 TTTTAAAAATGTGCACAGAAAGG - Intergenic
988293463 5:29322193-29322215 TTCTAAATATGTGTACCTAATGG - Intergenic
988952342 5:36276110-36276132 ATTAAAATAAGTGGAAATAAAGG + Intronic
989961142 5:50416921-50416943 TTTTAATTATGTGCAAATTAAGG - Intronic
990249755 5:53901637-53901659 ATTTCAATATGCACACTTAATGG - Intronic
991468919 5:66946568-66946590 ATTTGAATAGCTGCACAAAAGGG - Intronic
992193338 5:74315735-74315757 ATTGAAATATGTGGACTTATGGG - Intergenic
993229036 5:85207987-85208009 AATTTAATATTTGCACATAATGG + Intergenic
993305857 5:86274232-86274254 ATTTAAATAACTGTACATAGGGG - Intergenic
993771531 5:91933805-91933827 TTTTAAATATTTGCAAATAAAGG + Intergenic
994326298 5:98449862-98449884 AATTAAATATGTTCATTTAATGG + Intergenic
994456088 5:100009953-100009975 ATTTAAATATGTACTCATTTGGG + Intergenic
995073825 5:107957763-107957785 TTTTAAATATGTACAAATTATGG - Intronic
995187324 5:109285938-109285960 ATTTCAATATATGCAGAAAAAGG + Intergenic
996351775 5:122551466-122551488 TTTGAAATATGTACACATTATGG - Intergenic
996555544 5:124775208-124775230 ATTTAAGTATGTCCATATAATGG + Intergenic
997495976 5:134326226-134326248 CTTTAAATTTCTGCAGATAATGG - Intronic
998125008 5:139612568-139612590 ATTTAAATTTGTGGTTATAATGG - Intronic
998465243 5:142338385-142338407 ATTTAAGGATGTGCTCATTATGG + Intergenic
998640269 5:144002448-144002470 ATTTCAATATGTCAACTTAATGG + Intergenic
998987465 5:147776586-147776608 GTTTAAATATCTTCCCATAATGG + Intronic
999887518 5:155939276-155939298 TTTGAAATATGTACACATAGTGG - Intronic
1000890634 5:166797624-166797646 ATATATATATATGCATATAATGG + Intergenic
1000925096 5:167184589-167184611 ATTAGAATATATACACATAAGGG - Intergenic
1001376855 5:171267896-171267918 ATTTAAATATTAGCAAAAAATGG - Intronic
1001769005 5:174278416-174278438 ATTCATATATGTATACATAAAGG - Intergenic
1001850317 5:174958231-174958253 TTTGAAATATGTATACATAATGG + Intergenic
1003749002 6:9034974-9034996 ATTTAAAGAAGAGCACATGATGG + Intergenic
1003968268 6:11274158-11274180 ATTGAGATATGTGCAAATGAGGG - Intronic
1004221355 6:13749435-13749457 ATCTATATATGTCAACATAATGG - Intergenic
1004433236 6:15565348-15565370 ATGAAAACATGTGCACACAAAGG + Intronic
1004854240 6:19733222-19733244 AATTAAATATATGAACAAAATGG - Intergenic
1005436732 6:25820074-25820096 ATGTAAATATGTACAGAAAATGG - Intronic
1007411968 6:41669515-41669537 ACTTAAATATGTGCAATAAATGG + Intergenic
1008206349 6:48663626-48663648 AGTTATATATGTGAACATGAAGG + Intergenic
1008215972 6:48789329-48789351 ATTTGAATATGTGCAGATTTTGG - Intergenic
1008426254 6:51360727-51360749 ATTTAAAAAAGTGCACTTAAAGG - Intergenic
1008444829 6:51576072-51576094 AATTAAATATGTGCATAGGAAGG + Intergenic
1008552911 6:52650068-52650090 ATGTAAACATGTGCAACTAAAGG + Intergenic
1008939145 6:57027306-57027328 ATTTATTTATGTTTACATAAAGG - Exonic
1009734065 6:67652538-67652560 CTGTAAAGATGTACACATAATGG + Intergenic
1009818678 6:68771296-68771318 CTTTAATTATGTGCACACATTGG - Intronic
1010601797 6:77837869-77837891 ATTTAAATATGTAGTTATAAAGG - Intronic
1011076270 6:83442618-83442640 ATTTAAAAAATTACACATAAAGG - Intergenic
1011364685 6:86568911-86568933 ATATAAAAGTGTGCACAAAAAGG - Intergenic
1011737704 6:90328763-90328785 ATTTAAATATTTAAACATATTGG - Intergenic
1011980611 6:93371555-93371577 ATTGAAATATATGCACACATAGG - Intronic
1012132528 6:95515295-95515317 ACTTTAATAGGTCCACATAAGGG - Intergenic
1012465047 6:99507770-99507792 ATTTAAAAATGTGCACACTGTGG + Intronic
1012505874 6:99945567-99945589 ATTTAAATATGTAAACACTAAGG + Intronic
1013439779 6:110151907-110151929 ATAATAATATGTGCATATAATGG - Intronic
1013800720 6:113938970-113938992 ATTTCAGTATGTTCACACAATGG + Exonic
1013850897 6:114514231-114514253 TTTTAAACATGTGGACTTAAAGG + Intergenic
1014482699 6:121957365-121957387 TTTTACATATGTGGACATCAAGG - Intergenic
1014569675 6:122993618-122993640 AATAAAATATATGCACAAAAAGG - Intergenic
1014836970 6:126170823-126170845 ATTTTAATAAGTGAAAATAAGGG + Intergenic
1015109162 6:129571358-129571380 ATTTAAATAAATGCAAAGAAGGG + Intergenic
1015824394 6:137296222-137296244 ATTTGAATGTTTGCACATCAGGG - Intergenic
1016145542 6:140667802-140667824 CTTAAAATATGTGTCCATAATGG - Intergenic
1016459493 6:144267373-144267395 ATTTAAATATATGTACATGGGGG - Intergenic
1016831139 6:148434479-148434501 ATATGAATGTGTGCACATAGAGG - Intronic
1018241850 6:161784462-161784484 ATTTAAAAATGAGCAAAGAAAGG + Intronic
1018891871 6:167988472-167988494 ATTTAAAGATGAGAACACAATGG - Intergenic
1019355748 7:577939-577961 TTTAAATTATGTGCACATTAAGG + Intronic
1020156168 7:5726556-5726578 ATTTAAATGTGTTCAAATCAGGG + Intronic
1020544445 7:9506433-9506455 ATATATATATGTGCACAAGAAGG - Intergenic
1021405135 7:20258046-20258068 ATTTTAAAAAGTACACATAAAGG - Intergenic
1021569066 7:22046204-22046226 ATTTGAATATGTTCATACAATGG - Intergenic
1022511773 7:30939285-30939307 ATTAAAATATATGCAAATATAGG + Intronic
1022613585 7:31904499-31904521 ATTTAAATATTTGGACACAGTGG - Intronic
1022775253 7:33520661-33520683 ATTTATATATTTCCACATAAGGG - Intronic
1023459843 7:40384274-40384296 AGATAAATATGTGTACATCAGGG + Intronic
1024435951 7:49354777-49354799 ATTTAATTATGTGCAAATTAAGG + Intergenic
1025522010 7:61747166-61747188 AATGAAATATCTTCACATAAAGG - Intergenic
1025545738 7:62165283-62165305 AATGAAATATCTTCACATAAAGG - Intergenic
1026341498 7:69438021-69438043 TTTTAAATATGTACAGATGAAGG - Intergenic
1027501751 7:78960640-78960662 ATTTCAATATGTTTAAATAATGG - Intronic
1027840549 7:83305620-83305642 ATTAAAATACATGTACATAATGG - Intergenic
1027898495 7:84077431-84077453 ATGTAAATATGTCAACAGAAAGG + Intronic
1028167451 7:87554360-87554382 ATTTAAATCTCTGAACATTAAGG + Intronic
1028439667 7:90845456-90845478 ATTCAAATAAGTTCAAATAAGGG - Intronic
1029064236 7:97832676-97832698 ATTTATATATGTACACGTAATGG - Intergenic
1029147367 7:98456166-98456188 GTTTGAATGTGTGCATATAATGG + Intergenic
1029147370 7:98456232-98456254 GTTTGAATATGTACACATAATGG + Intergenic
1030024306 7:105307728-105307750 ATTCAAAAATGTGGAAATAAGGG - Intronic
1031186778 7:118491526-118491548 ATTCCAATATGTGGAGATAAAGG - Intergenic
1031249825 7:119365515-119365537 ATTTATATATGTAAATATAAAGG - Intergenic
1031381607 7:121092872-121092894 ATTTAAATATGTGCTATAAATGG - Intronic
1031988925 7:128183370-128183392 TTTTAACCATGTGCACATATTGG + Intergenic
1032059162 7:128709327-128709349 ACATAAGTATGTGCAAATAAAGG - Intronic
1032638808 7:133741631-133741653 ATTGAACTATGTGCACAGTACGG + Intronic
1032799178 7:135304822-135304844 ATATAAAATTGTGCACAAAAGGG - Intergenic
1032890252 7:136186973-136186995 ATTTAATTCTGTCCACATACTGG + Intergenic
1033326876 7:140387028-140387050 TTTAAAATATGTGCACATTGTGG + Intronic
1034387823 7:150755140-150755162 ATTTTCATATATGCACATAGTGG - Intergenic
1034800905 7:154055195-154055217 AGATATATATGTGCAGATAATGG - Intronic
1035353046 7:158259813-158259835 ATTCACATATGTGTACACAAAGG - Intronic
1035353057 7:158259971-158259993 ATTCACATATGTGTACACAAAGG - Intronic
1035619488 8:1027047-1027069 GGTGAAATATGTGCCCATAATGG + Intergenic
1035703151 8:1652664-1652686 TTTTACATAAGTGCACAGAAAGG - Intronic
1036110598 8:5896703-5896725 ATACAAATATGTTCAAATAATGG + Intergenic
1036421996 8:8605460-8605482 ATTTTAACATGTGCTCATCAGGG - Intergenic
1037055061 8:14429927-14429949 TTTCTAATTTGTGCACATAAAGG + Intronic
1037072655 8:14671191-14671213 ATTTAAAATTGTGCAGATGAGGG + Intronic
1038102699 8:24396601-24396623 TTGTCTATATGTGCACATAAGGG - Intronic
1038591741 8:28845068-28845090 ACTTACATATGTTCACTTAATGG + Intronic
1039924298 8:41915462-41915484 ATTTTAATGGGTGCAGATAAGGG - Intergenic
1039950745 8:42170471-42170493 ATTTAAATATTTATACAAAAGGG + Exonic
1041461977 8:58120984-58121006 ATTTAAATATTTGAATATAAAGG + Intronic
1041516855 8:58709795-58709817 ATTGAAATATCTAAACATAAGGG - Intergenic
1041804814 8:61838532-61838554 ATTTATTAATATGCACATAAAGG + Intergenic
1042165970 8:65946664-65946686 ACTTAAACATGTCCAGATAATGG - Intergenic
1042319524 8:67460422-67460444 CTGAAAATATGTGCAAATAAAGG + Intronic
1042441665 8:68834772-68834794 AATTAAATATATGTAAATAATGG + Intergenic
1042480708 8:69299085-69299107 TAATAGATATGTGCACATAATGG - Intergenic
1042990208 8:74630978-74631000 ATGTAATTATGTGTACTTAAAGG + Intronic
1043086832 8:75845249-75845271 ATTAAAATATATGAATATAATGG + Intergenic
1043156612 8:76789413-76789435 AAATAAATATGTGCATATCACGG + Intronic
1043522178 8:81058287-81058309 GTTTCAATGTGTGTACATAAAGG + Intronic
1044592786 8:93930239-93930261 CATAAAATATGTGCACATAAGGG - Intergenic
1045224001 8:100226815-100226837 ATATAATCATGTGCTCATAATGG + Intronic
1045287531 8:100804883-100804905 ATTACAATATGTATACATAAAGG - Intergenic
1045413170 8:101940355-101940377 TGTTATATATGTCCACATAAGGG - Intronic
1046304675 8:112349619-112349641 ACTTACATATGTGCAGATAATGG - Intronic
1046477194 8:114761048-114761070 ATTTTAATATGTTACCATAAGGG - Intergenic
1046619214 8:116510203-116510225 GTTTAAATAGGTGGACATTATGG + Intergenic
1046712186 8:117522351-117522373 TTTTAAATATGTATACATAGTGG + Intronic
1048433028 8:134388296-134388318 ATATAAACATGTTCACTTAAAGG + Intergenic
1048685834 8:136904551-136904573 ATTTAACTGTGTGCAGATTAAGG + Intergenic
1049227279 8:141461538-141461560 AGTTAATTATGTGCAAATTACGG - Intergenic
1049287565 8:141784226-141784248 ATTTAAATATTTTCACATGATGG - Intergenic
1050122662 9:2323571-2323593 ACATAAATATTTGCACATATGGG + Intergenic
1050179221 9:2901717-2901739 ATTTAAAGATGATTACATAAAGG - Intergenic
1050216079 9:3325508-3325530 ATTTAAATGTATATACATAAAGG + Intronic
1050723401 9:8617765-8617787 ATTTATATATGTACATAAAAGGG + Intronic
1050755860 9:9002509-9002531 AATTAATTATGTGCCTATAATGG + Intronic
1051117389 9:13712356-13712378 ACTTAAAAATTTGCAGATAATGG - Intergenic
1051581795 9:18684157-18684179 ATTGGAATATGTGCAAATGAGGG - Intronic
1052528827 9:29656045-29656067 ATTTACTAATGTGCACATGAGGG - Intergenic
1052531863 9:29695397-29695419 GTTTAAATTTGTGGACCTAATGG - Intergenic
1052712046 9:32068892-32068914 TTTTAATTATCTGCACACAAGGG - Intergenic
1053531763 9:38889278-38889300 ATATAGATATGTGCTAATAATGG - Intergenic
1053689904 9:40580161-40580183 ATTAAAACATTTTCACATAAGGG + Intergenic
1054203986 9:62113706-62113728 ATATAGATATGTGCTAATAATGG - Intergenic
1054301152 9:63381105-63381127 ATTAAAACATTTTCACATAAGGG + Intergenic
1054634376 9:67474659-67474681 ATATAGATATGTGCTAATAATGG + Intergenic
1055135387 9:72823655-72823677 ATTTAAAGATGTCCAGATGAAGG + Intronic
1055250273 9:74294847-74294869 ATTTAAATTTGTGGCCATTATGG + Intergenic
1055761428 9:79612901-79612923 ATTTATATGTGTTTACATAATGG + Intronic
1055844148 9:80540669-80540691 ATTTTAAAATGATCACATAATGG + Intergenic
1056258787 9:84826818-84826840 ATTTAAATCTCTGGACATCAAGG + Intronic
1056503199 9:87231008-87231030 ATTGTAATATGTGCAAATACAGG - Intergenic
1057613001 9:96563328-96563350 ATAGAAATATGTACACATCATGG - Intronic
1058129744 9:101237620-101237642 ATATATATATATGCACACAATGG - Intronic
1058129751 9:101237806-101237828 ATATATATATATGCACACAATGG - Intronic
1058129785 9:101238413-101238435 ATATATATATATGCACACAATGG + Intronic
1058544665 9:106048194-106048216 TTTTATTCATGTGCACATAAGGG + Intergenic
1059078054 9:111215829-111215851 TTTTTAGTTTGTGCACATAAAGG + Intergenic
1059873808 9:118609074-118609096 ATTTATCTGTGTGCACACAATGG - Intergenic
1060926367 9:127458029-127458051 ATTTATACATGTGCACACACAGG - Intronic
1185821881 X:3213208-3213230 ATATATATATGTACACACAATGG + Intergenic
1185868316 X:3642088-3642110 ATTAAAATATGTGCACAGGAGGG - Intronic
1185955735 X:4487005-4487027 ATATAAATATATGCATATAGAGG + Intergenic
1185998408 X:4979718-4979740 ATTAAAATGTCTTCACATAAGGG - Intergenic
1186033531 X:5395523-5395545 ATTTAAATATGTGTTGATCAAGG + Intergenic
1186173176 X:6898977-6898999 ATTTAAGTAGGTGCAAATGAAGG - Intergenic
1186243585 X:7596349-7596371 TTTTAAGTATGTACACATATTGG - Intergenic
1186257561 X:7739054-7739076 AAATAAACATGTGAACATAAAGG + Intergenic
1186614376 X:11171271-11171293 ATGTATATATGTGCACAGGAAGG - Intronic
1187201980 X:17143943-17143965 TTTTAAATATGAGCAAAGAAGGG - Intronic
1187435092 X:19260595-19260617 ATTTAAATATGTGGTCAAAGTGG + Intergenic
1187693965 X:21899610-21899632 ATTTATATATATATACATAAAGG + Intergenic
1187737074 X:22315896-22315918 ATTTAAATATTTGACCATAAAGG - Intergenic
1189175043 X:38948021-38948043 ATTGAAATAAATGCATATAAGGG + Intergenic
1189400334 X:40662160-40662182 TTTTAAATATGTGAACAGGACGG - Intronic
1189836212 X:45025731-45025753 ATTTAAATATGTAAACATTAGGG - Intronic
1191647792 X:63502201-63502223 CTTGAAATATGTGTACATAGTGG - Intergenic
1192911273 X:75607119-75607141 TTTTAAATATTTGCATATAAAGG - Intergenic
1194571825 X:95561884-95561906 ATTTAATTATATGCAAATTAAGG + Intergenic
1194597720 X:95879403-95879425 ATTTAAAAATGTGTAAGTAAAGG + Intergenic
1195277628 X:103297825-103297847 TTTTAAATATGTACAAATTATGG + Intergenic
1195539977 X:106052599-106052621 ATTTAATTATATGCAAATTAAGG + Intergenic
1195818294 X:108912886-108912908 TTTCAAGTTTGTGCACATAATGG - Intergenic
1196644337 X:118100521-118100543 ATTTAAAAATATGAACTTAATGG - Intronic
1196713558 X:118788660-118788682 ATTATAATATGTGCACACAATGG - Intronic
1196895981 X:120336335-120336357 ATTTAAATATGCTCAAATAAAGG - Intergenic
1197078732 X:122386049-122386071 ATTTTGTTATGTGCACAGAATGG - Intergenic
1197512192 X:127383358-127383380 TTTTTAATTTGTGCACATAGAGG + Intergenic
1197970560 X:132110732-132110754 GTTCAAATATGTGCACACATTGG - Intronic
1198147737 X:133874406-133874428 ATATATATATGTGCATAAAATGG - Intronic
1198444191 X:136694823-136694845 ATTCAAATATATGCAAATATGGG + Intronic
1198647381 X:138823982-138824004 ATATAAATATGCTCAGATAAAGG - Intronic
1198682085 X:139193972-139193994 ATATGAATATGTGCCCATATGGG - Intronic
1198695939 X:139338042-139338064 TTTCTAATTTGTGCACATAAGGG + Intergenic
1199047733 X:143196609-143196631 ACTTATAAATATGCACATAATGG - Intergenic
1199107085 X:143882223-143882245 TTTTAAATATAAGCACATTATGG - Intergenic
1200820457 Y:7577481-7577503 AGTGAAAAATCTGCACATAATGG - Intergenic
1201230800 Y:11862505-11862527 AGTGAAAAATCTGCACATAACGG - Intergenic
1202069536 Y:20976394-20976416 GTTTGTATATGTGCACATCAAGG - Intergenic