ID: 950020788

View in Genome Browser
Species Human (GRCh38)
Location 3:9786233-9786255
Sequence CAGAATAAGAGCAAGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 489
Summary {0: 1, 1: 0, 2: 1, 3: 45, 4: 442}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950020788_950020796 28 Left 950020788 3:9786233-9786255 CCGGCCTCCTTGCTCTTATTCTG 0: 1
1: 0
2: 1
3: 45
4: 442
Right 950020796 3:9786284-9786306 GTGACCTTGTGCAGACTGCAAGG 0: 1
1: 0
2: 0
3: 13
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950020788 Original CRISPR CAGAATAAGAGCAAGGAGGC CGG (reversed) Intronic
900369737 1:2326351-2326373 CAGCCTAAGAGAAAGGAGGCAGG + Intronic
900699010 1:4032420-4032442 CAAAATAAGAACACGGAAGCAGG - Intergenic
900731256 1:4262315-4262337 AAGCATAGGTGCAAGGAGGCAGG - Intergenic
900871928 1:5310542-5310564 CAGAATGAGAGCGAGGAAGAGGG + Intergenic
901141146 1:7032259-7032281 CAGAAAAAGAGAAAAGGGGCCGG - Intronic
901383343 1:8889985-8890007 TAGAATAAGAGGCAGGAGCCTGG - Intergenic
901854569 1:12036407-12036429 CAGAAAAAGAAAAAAGAGGCTGG + Intergenic
901961440 1:12829364-12829386 GAGAATGAGAGAAGGGAGGCAGG - Intronic
901968028 1:12883971-12883993 GAGAATGAGAGAAGGGAGGCAGG - Intronic
902017148 1:13317809-13317831 GAGAATGAGAGAAGGGAGGCAGG + Intronic
902350977 1:15854095-15854117 AAAAATAAAAGCAAGCAGGCCGG - Intronic
902527898 1:17071227-17071249 CAGGAGCAAAGCAAGGAGGCTGG + Intronic
903660851 1:24977569-24977591 TAAAAGAGGAGCAAGGAGGCCGG + Intergenic
904274017 1:29368692-29368714 CAGAAGAAGAGAAAGGAAACAGG + Intergenic
904351125 1:29907364-29907386 TCGAGGAAGAGCAAGGAGGCTGG - Intergenic
905034659 1:34909903-34909925 CAAGATAAGGACAAGGAGGCTGG - Intronic
905345188 1:37306425-37306447 CAGAGTGAGAGAGAGGAGGCTGG + Intergenic
905387117 1:37612840-37612862 AGGAAGGAGAGCAAGGAGGCGGG - Exonic
906786104 1:48617549-48617571 GAGAATAGCAGGAAGGAGGCGGG - Intronic
907401467 1:54227332-54227354 CAGGATAAGGGCCAGGAGGCGGG + Intronic
907849978 1:58247151-58247173 CAGAATGGGGGCAAGGAGGCTGG + Intronic
908046980 1:60181336-60181358 CAGAGTAAAAGTAAGGAAGCTGG - Intergenic
908621525 1:65986582-65986604 CAGAATAAGACAAAGGAGGAGGG - Intronic
908894931 1:68888118-68888140 TAGAAAAAAAGCAAGGGGGCTGG + Intergenic
909592725 1:77370087-77370109 CAGAATAAGTCCAAAGTGGCAGG + Intronic
916158566 1:161884775-161884797 CAAAATCAGAGTAAGAAGGCAGG + Intronic
918290052 1:183098787-183098809 CAGACAGAGAGCAAAGAGGCAGG + Intronic
918421260 1:184366294-184366316 CAGAGGAAGAGCAAGGAAGGAGG - Intergenic
918497231 1:185154654-185154676 CAAAATAAGAGAAAGGAGCTTGG + Intronic
918690516 1:187473405-187473427 CAGATTAAGACCAAGCAGGTGGG + Intergenic
919016035 1:192038061-192038083 CAGAAAAAGAACACTGAGGCCGG + Intergenic
920369533 1:205469338-205469360 CAGCAAGAGAGCAAGGAGGGTGG - Intergenic
921380502 1:214519751-214519773 CAAAATATAAGCAAGCAGGCTGG + Intronic
921595090 1:217046017-217046039 CACAATAAGAGCAAGTAGGTTGG + Intronic
922338135 1:224634285-224634307 AAGAATAAGAAAAAAGAGGCCGG + Intronic
922737481 1:227995299-227995321 CAGAGTAAGACCCTGGAGGCTGG + Intergenic
922954454 1:229587440-229587462 AAGAGTGAGAGCAAGGAGACTGG - Intergenic
923715068 1:236418247-236418269 CAGAAAAAAAGAAAAGAGGCCGG - Intronic
924758861 1:246966094-246966116 AAGAATAAGGGCAAAGAGCCTGG + Intronic
1062879422 10:966156-966178 GAGAAAAAGAAGAAGGAGGCTGG + Intergenic
1062951050 10:1503799-1503821 CAGAGTAGGAGCAAGGGGGCGGG - Intronic
1063218746 10:3946923-3946945 AAGAAAAAAAGCAAGGAGGGAGG - Intergenic
1063547604 10:6997587-6997609 CAGAAAAATTGCAAGGGGGCCGG + Intergenic
1063655430 10:7983315-7983337 CAGAATAAGGGGCAAGAGGCAGG + Intronic
1064559149 10:16578675-16578697 CAGAATAACATGGAGGAGGCAGG - Intergenic
1064739417 10:18416918-18416940 CAGAATTAGGGCAAGGACCCAGG + Intronic
1065699783 10:28413850-28413872 TAGAATAAAAGAAAGGAGGCCGG + Intergenic
1066708831 10:38210789-38210811 CAGAGAAAGAGCATGGAAGCTGG + Intergenic
1067343528 10:45422277-45422299 CAGAATGAGAGGATGGAGGCTGG - Intronic
1067522638 10:47019745-47019767 CAGAGTCAGAGCATGGAGGTTGG + Intergenic
1067734598 10:48839606-48839628 CAGATCAAGAGAAAGCAGGCTGG + Intronic
1067993457 10:51242160-51242182 CAGGATAAAAGACAGGAGGCTGG + Intronic
1070311259 10:75275724-75275746 CAGACTGAGGGCAAGGGGGCTGG + Intergenic
1070935133 10:80288149-80288171 AAGAACAAGAGCAAGGAAGATGG + Intronic
1071445032 10:85737549-85737571 CATATTAAGAGCAAGGATGGAGG + Intronic
1071530180 10:86384437-86384459 CAGAAAAAGAGGAACCAGGCAGG + Intergenic
1072841355 10:98777750-98777772 AAGAAGAAGGACAAGGAGGCAGG - Intronic
1073364229 10:102924931-102924953 CAGAATCAGAGCTGGAAGGCAGG + Intronic
1073771300 10:106738543-106738565 CAGTGTGAGAGGAAGGAGGCTGG + Intronic
1073793085 10:106959330-106959352 CAGAACAAGAGCAAGAAAGAAGG + Intronic
1073991688 10:109268746-109268768 CAGAATAAGACCCATGATGCAGG + Intergenic
1075565464 10:123500481-123500503 CAGAAGCAGAGGAAGGAGGAAGG - Intergenic
1076100647 10:127774941-127774963 CACAAAAAGTGCAAGGAGTCTGG - Intergenic
1078667975 11:13341723-13341745 CAGAATAAGAGGAGAGAGCCTGG - Intronic
1078860907 11:15245291-15245313 AAGAGTATGAGCAAGGAGGAGGG + Intronic
1079132430 11:17755153-17755175 CAGTGCAAGAGCATGGAGGCAGG + Intronic
1081330858 11:41797981-41798003 CAGACTAAGAACAAAGAGTCAGG - Intergenic
1081556142 11:44163418-44163440 CAGCACAAGAGCAGGGAGTCTGG - Intronic
1081812346 11:45921199-45921221 CAGATGAAGATCAGGGAGGCTGG + Intergenic
1081981756 11:47270815-47270837 GAGAACTGGAGCAAGGAGGCTGG - Intronic
1083768504 11:64853690-64853712 CAAAAAAAGACCAAGGTGGCTGG + Exonic
1083825433 11:65200637-65200659 CAAAAAAAGAACAAGGCGGCCGG - Intronic
1083846649 11:65338425-65338447 CAAAGTCAGAGCAAGGAGGCTGG - Intronic
1084484579 11:69440332-69440354 CATAATAAGAGCAGGAAGCCAGG + Intergenic
1084561441 11:69907762-69907784 CAGAAGCAGAGGAAGCAGGCAGG + Intergenic
1085750348 11:79155758-79155780 AGGAAGAAGAGAAAGGAGGCAGG - Intronic
1087283854 11:96243302-96243324 AGGAAGCAGAGCAAGGAGGCGGG + Intronic
1088979195 11:114846479-114846501 CAGAACAAGAGCATTGAAGCAGG - Intergenic
1090732198 11:129581578-129581600 GTGAATAAGCGCATGGAGGCAGG + Intergenic
1090889740 11:130913256-130913278 CAGAATTAGAACAAAAAGGCAGG + Intronic
1091398920 12:171198-171220 GAGAAGAAGAACAAGGGGGCAGG - Intronic
1091441513 12:514531-514553 TAGTATGAGAGCAAGGAGGAAGG + Intronic
1091451802 12:576652-576674 CTGAGAAAGAGCACGGAGGCCGG - Intronic
1092171252 12:6375258-6375280 CAGGATTAGAGAGAGGAGGCAGG - Intronic
1092191452 12:6524252-6524274 GAGAATCAGAGCAAGGAGGGAGG + Intronic
1092308493 12:7325978-7326000 GAGAATAAGAACATGGTGGCAGG - Intronic
1095191099 12:39258926-39258948 CTGAATTAGAACAAGGAGTCTGG + Intergenic
1095891292 12:47236591-47236613 GAGAATAGGAGTGAGGAGGCAGG - Exonic
1096545738 12:52338958-52338980 CCCACCAAGAGCAAGGAGGCTGG - Intergenic
1096828873 12:54299554-54299576 CAGGCTAAGAGTAAGGAGGATGG - Intronic
1097389378 12:58990667-58990689 GTGAATAAGAGCAAGGACGTTGG + Intergenic
1097686225 12:62693594-62693616 CTGACAACGAGCAAGGAGGCAGG - Intronic
1099590766 12:84586249-84586271 CAGGATTAGAGCAAGTAGGAAGG - Intergenic
1099676277 12:85764783-85764805 AAGAATAAAAGGAAGGAGGAAGG + Intergenic
1100143812 12:91652909-91652931 AGGAATAAAAGCAAGGAGTCAGG + Intergenic
1101001351 12:100361323-100361345 TCTAATAAGAGCCAGGAGGCCGG - Intronic
1101128731 12:101666470-101666492 GAGAAGAGGAGAAAGGAGGCTGG - Intronic
1101552434 12:105775262-105775284 CAGAATGTGAGCAAGGAATCAGG - Intergenic
1101695537 12:107122306-107122328 GAGAAGAAGAGGAAGGAGGTTGG + Intergenic
1102231852 12:111268091-111268113 CATTATAAGAGAAAGGAGGTTGG - Intronic
1102717367 12:114986110-114986132 GAGAAAGAGAGGAAGGAGGCAGG - Intergenic
1104510663 12:129374802-129374824 CAGAGAAAGAGGATGGAGGCTGG + Intronic
1104714378 12:131006641-131006663 CAGAAGGAGAGCAAGGAGGGTGG + Intronic
1104768539 12:131345965-131345987 GAGAAGAAGGGCAAGGTGGCAGG + Intergenic
1104861822 12:131928022-131928044 CAGTGCAAGAGCCAGGAGGCAGG - Intergenic
1107174482 13:37384642-37384664 CAGAAGATGAGAAAGGAGGTTGG + Intergenic
1107995275 13:45853019-45853041 CAGAACAAGAGCCATGAGGGAGG - Intergenic
1108040923 13:46338665-46338687 AAGAACAAGACCATGGAGGCAGG + Intergenic
1109384705 13:61611163-61611185 AAGGAAAAGAGGAAGGAGGCAGG - Intergenic
1110045118 13:70818439-70818461 CATACAAAGAGCAAAGAGGCAGG + Intergenic
1110143534 13:72160688-72160710 CAAAATAAATCCAAGGAGGCTGG - Intergenic
1110150629 13:72248718-72248740 CAGAATAAGAGGAAAAAGGATGG + Intergenic
1111905958 13:94256463-94256485 CAGACCAAGAGCAAGGAGACTGG + Intronic
1112185157 13:97120894-97120916 CAATATAAGAACAAAGAGGCTGG - Intergenic
1112228843 13:97567848-97567870 CTGGATAAGAGAAAGGATGCTGG + Intergenic
1112470242 13:99681880-99681902 CAGAAAAGATGCAAGGAGGCAGG - Intronic
1113185519 13:107682358-107682380 CAGGATGAGTGCAAGGAGGGTGG - Intronic
1113460203 13:110477050-110477072 GAAAATAGGAGCAAAGAGGCCGG + Intronic
1114456520 14:22858272-22858294 CTTAAAAAGAGCCAGGAGGCCGG + Intergenic
1114562198 14:23601430-23601452 CAGAAAAAGAGCTGGGTGGCTGG - Intergenic
1114728063 14:24960172-24960194 CAGATTGAGAGCAAGGAGTGGGG + Intronic
1115463165 14:33684592-33684614 AAGAATGAGAGCAAAGAGGCTGG - Intronic
1117374327 14:55107175-55107197 CATAAAAATACCAAGGAGGCCGG - Intergenic
1117869359 14:60183738-60183760 GAGAATGCAAGCAAGGAGGCTGG + Intergenic
1118899447 14:69974267-69974289 GAGGATCAGAGGAAGGAGGCAGG + Intronic
1119781721 14:77280329-77280351 AAGAACAAGAGCAGGGAGACCGG - Intronic
1119986399 14:79142875-79142897 CAGAATAAGTGCAAGGGAGGAGG + Intronic
1120680829 14:87478528-87478550 CAGAATCAGAGCATGGATGTCGG + Intergenic
1121263401 14:92582881-92582903 CAGGAAGAGAGCAAAGAGGCAGG - Intronic
1124102888 15:26712390-26712412 CAGAAGAGCAGCAAGGAGGCTGG + Intronic
1126046671 15:44648215-44648237 CAGAATAGTAGGAAGCAGGCTGG + Intronic
1126867022 15:52947819-52947841 TGGAATAAGAGAAAGGAAGCGGG + Intergenic
1127267530 15:57374110-57374132 AAGAAAAAGAGAAAGGAGGGAGG - Intergenic
1128092976 15:64931456-64931478 CACAAGAAGAGCAATGAGGATGG - Intronic
1128134283 15:65251179-65251201 CAAAATAAGAGATGGGAGGCAGG - Intronic
1128217860 15:65946691-65946713 CAGAATAAGAACCAGCACGCAGG - Intronic
1128542113 15:68543472-68543494 GAGGATAAGAGCATGGGGGCTGG + Intergenic
1128565054 15:68695575-68695597 AAGAATATGAACAAGGAGGGAGG + Intronic
1128593133 15:68920456-68920478 CAGAGTAAGAGTAAGGAGTAAGG + Intronic
1129191270 15:73939073-73939095 CAGTGTAGGAGTAAGGAGGCTGG - Intronic
1129457429 15:75683258-75683280 CAGATGGAGAGCAGGGAGGCTGG - Intronic
1129726362 15:77903687-77903709 CAGATGGAGAGCAGGGAGGCTGG + Intergenic
1130060461 15:80566244-80566266 CAGAGTTAGAGGAAGAAGGCAGG - Intronic
1130274403 15:82469046-82469068 CAGATGAAGAGCAGGGATGCTGG + Intergenic
1130466750 15:84196420-84196442 CAGATGAAGAGCAGGGATGCTGG + Intergenic
1130497514 15:84477116-84477138 CAGATGAAGAGCAGGGATGCTGG - Intergenic
1130589045 15:85201013-85201035 CAGATGAAGAGCAGGGATGCTGG + Intergenic
1130709112 15:86261971-86261993 CAGAATAAGAGGAAGATTGCAGG - Intronic
1132010445 15:98270999-98271021 CAGAATAGCAGGAGGGAGGCAGG + Intergenic
1132079608 15:98852848-98852870 CAGAATAAGGGCAGGGATGCCGG - Intronic
1133423949 16:5671279-5671301 AAATCTAAGAGCAAGGAGGCAGG + Intergenic
1134718305 16:16367778-16367800 CAGTAGATGAGCAGGGAGGCTGG - Intergenic
1134956447 16:18384381-18384403 CAGTAGATGAGCAGGGAGGCTGG + Intergenic
1135010318 16:18871681-18871703 CATGATAATAGCAAAGAGGCCGG + Intronic
1135039554 16:19107539-19107561 CAGAACAAGCCCAATGAGGCAGG - Intergenic
1135317171 16:21458844-21458866 CATGATAATAGCAAAGAGGCCGG + Intergenic
1135370091 16:21891087-21891109 CATGATAATAGCAAAGAGGCCGG + Intergenic
1135441720 16:22480036-22480058 CATGATAATAGCAAAGAGGCCGG - Intronic
1136081536 16:27855421-27855443 CAGAAAAAGACCAACGGGGCCGG + Intronic
1136313985 16:29438999-29439021 CATGATAATAGCAAAGAGGCCGG + Intergenic
1136327424 16:29540764-29540786 CATGATAATAGCAAAGAGGCCGG + Intergenic
1136442114 16:30280762-30280784 CATGATAATAGCAAAGAGGCCGG + Intergenic
1137476244 16:48811788-48811810 CAGCATTAGAACAAGGCGGCAGG - Intergenic
1137871542 16:51954637-51954659 CAGAAGAAAAGGAAGGAGGAAGG - Intergenic
1138479176 16:57290429-57290451 CAGAAAAAGGGCAGGGAGCCAGG + Intergenic
1139833367 16:69818859-69818881 CAAATTTAAAGCAAGGAGGCTGG - Intronic
1139888921 16:70234492-70234514 CAGCATAATAGCAAAGAGGCCGG + Intergenic
1140269918 16:73456360-73456382 CAGAAGAAGATAAAGGAGGAAGG - Intergenic
1141604784 16:85146549-85146571 CAGGCTAAGAGCAAGGATGCTGG - Intergenic
1142964228 17:3571011-3571033 CAGAAAAACCCCAAGGAGGCCGG - Intronic
1143279828 17:5745263-5745285 GAGTATAAGAGCAGGGAGCCTGG + Intergenic
1143313773 17:6015834-6015856 CAAAATAAGATCAATTAGGCCGG + Intronic
1143805662 17:9424211-9424233 GAGAATAACAGCAGGGTGGCCGG + Intronic
1144204606 17:12971246-12971268 CAGAAGATCACCAAGGAGGCTGG + Intronic
1146372940 17:32276554-32276576 CAGAAGACGAGTAATGAGGCAGG + Intronic
1146520942 17:33525080-33525102 AAGAATAAGAGCACAGAGACAGG - Intronic
1146910742 17:36646859-36646881 AAGAATAGGAGAAAGGAGGCAGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149008868 17:51834390-51834412 GAGAATCTGAGGAAGGAGGCAGG - Intronic
1149389369 17:56173986-56174008 CTGTATCAGAGAAAGGAGGCAGG - Intronic
1149687839 17:58548089-58548111 CAAAAGAAGAGTAAGGAGGAGGG - Intergenic
1149865214 17:60147835-60147857 CAGAGTAAGAGGAAGGAGGCTGG + Intergenic
1149988135 17:61363967-61363989 CAGAGTGAGAGCAAGGCTGCAGG - Intronic
1149988905 17:61369474-61369496 CAGAGTCAGAGCACTGAGGCAGG + Intronic
1150107397 17:62472436-62472458 CAGGATAAAAGCCAGGAGGCTGG + Intronic
1151383570 17:73741756-73741778 GAGAAAAAGAAAAAGGAGGCAGG - Intergenic
1153253921 18:3151358-3151380 AAGTATAAAAGCAAAGAGGCTGG - Intronic
1153311164 18:3678256-3678278 TAAAACAAGAGCAAGTAGGCTGG - Intronic
1153655799 18:7281046-7281068 TAGACAAAGAGGAAGGAGGCAGG + Intergenic
1153809793 18:8741980-8742002 CTGAATAGGATCAAGGAAGCAGG - Intronic
1154073469 18:11176946-11176968 CAGGAGAGGAGGAAGGAGGCAGG - Intergenic
1155106110 18:22667859-22667881 CAGAATGAGCCCAAGTAGGCAGG + Intergenic
1156401212 18:36742148-36742170 CAGAATAACAGCAGTGAGGGTGG + Intronic
1156456729 18:37299067-37299089 AAGGCTAAGAGCAAGTAGGCAGG + Intronic
1159627647 18:70713479-70713501 CGGATTAACAGCAAGGAGGAAGG + Intergenic
1159667456 18:71179488-71179510 TAGAAAAATAGCAAGGTGGCCGG + Intergenic
1160540583 18:79618006-79618028 TAGAAAACGAGGAAGGAGGCGGG + Intergenic
1160821846 19:1062603-1062625 CAGAAGAGGAGCAAGTGGGCAGG - Intronic
1161003666 19:1924054-1924076 CAGAAAATGAGCATGGCGGCCGG - Intronic
1161434816 19:4256852-4256874 AAGAGTGAGAGCAAGGAGGAAGG + Intronic
1161627263 19:5334567-5334589 GAGGTTAAGAGCAAGGATGCTGG - Intronic
1161629031 19:5342293-5342315 AATAATAAGAGAAAAGAGGCCGG + Intergenic
1162510728 19:11116630-11116652 CAGAAAAACTTCAAGGAGGCTGG - Intronic
1162857764 19:13482187-13482209 AAGAATAGCAGTAAGGAGGCCGG + Intronic
1163317871 19:16553916-16553938 CAGAAAGAGAGCAATGAGACAGG + Intronic
1164592650 19:29514642-29514664 CAGATGAAGAGGAAGGAGGGGGG + Intergenic
1165074225 19:33272001-33272023 CAGAAAAACAGAGAGGAGGCGGG - Intergenic
1165409651 19:35651424-35651446 CAGAATAAAAGGGAGGAGGCTGG - Intronic
1165683452 19:37797311-37797333 CCAAATAAGAACAAAGAGGCTGG + Intronic
1165959065 19:39519365-39519387 TTGAAAAATAGCAAGGAGGCAGG + Intronic
1166322422 19:42026862-42026884 CAGTTTAAGAACAAGGTGGCTGG - Intronic
1166672457 19:44719061-44719083 CAGAAGAGGAGCATGGAGGAGGG + Intergenic
1167191341 19:47991932-47991954 CAGAGTGAGAGCAAGGAAGGAGG - Intronic
1168220873 19:54959431-54959453 TAGAAAAAAAACAAGGAGGCCGG - Intronic
1168318597 19:55495030-55495052 CTGGATAAGAGAAAGGATGCTGG + Intronic
925617233 2:5755193-5755215 CAGAAGAAGAGAAAGAAAGCAGG + Intergenic
926864434 2:17342375-17342397 CAGAATAAGAACATGGAGATCGG + Intergenic
927254687 2:21030019-21030041 CAGAATAAGAGAAGAGAGTCAGG + Intronic
927352485 2:22133697-22133719 AAGAATAGGAGGAAGGAGACTGG - Intergenic
927389282 2:22575151-22575173 GAGAATATGAGCAAGGGTGCAGG - Intergenic
927880067 2:26684050-26684072 GAGAAGAAAAGGAAGGAGGCAGG - Intergenic
928476414 2:31631856-31631878 CAGAATCAGAACAAGGAGATTGG + Intergenic
929011068 2:37445623-37445645 CAGAATAATATCAAGGATGAAGG + Intergenic
930403983 2:50930383-50930405 GAGAAAAAGAGAAAGGGGGCAGG + Intronic
930478075 2:51910728-51910750 CATTATAAAAGCGAGGAGGCCGG + Intergenic
930771812 2:55137251-55137273 GAGACTAAGAGCAAAGAGGAGGG + Intergenic
931745836 2:65291307-65291329 CAAAATAAGAGGAAGTAGTCTGG + Intergenic
931925469 2:67067579-67067601 AAGCATAAGAGAAAAGAGGCGGG - Intergenic
933805602 2:85996500-85996522 CTGAAGAAGAGGAAGGAGGTGGG + Intergenic
934574480 2:95391518-95391540 CAGTAGAAGAGGGAGGAGGCTGG - Intergenic
935813587 2:106825226-106825248 CTGAGAAAGAGCAAGGAGGAAGG - Intronic
937403515 2:121606760-121606782 CACAAAAAGAGAAAGGAGGTGGG + Intronic
937763406 2:125632087-125632109 CTGAAAGAGAGCAAGGAAGCAGG + Intergenic
938019187 2:127892281-127892303 CAGAAGAAGAGCAAGGACCTGGG + Intergenic
939028130 2:137038697-137038719 CAGAAAAGGGTCAAGGAGGCAGG + Intronic
940325811 2:152423892-152423914 CAAAAGAAGAGGAAGGAGGTGGG - Intronic
940746516 2:157573659-157573681 CAGAATAAGATCAGGAAGCCTGG - Intronic
940834066 2:158500912-158500934 CAGAGTAAAAGCAGGGAGGCTGG - Intronic
942215154 2:173712181-173712203 CAGAAATACAGCAAGGAGGTGGG + Intergenic
944108031 2:196100536-196100558 CAGAATCAGAGCAAGGGAGGAGG + Intergenic
946062963 2:216960755-216960777 CATAACACGAGAAAGGAGGCTGG - Intergenic
946100205 2:217314119-217314141 CAGAACAAGAGGAAGGGGGCTGG - Intronic
946494271 2:220179857-220179879 CAGAAAAATAGCAAGCAGGAGGG + Intergenic
946789216 2:223283701-223283723 CAGTATAAAAGCAAGGAAGTAGG - Intergenic
946895108 2:224316458-224316480 CTGATTAAAAGCAATGAGGCCGG + Intergenic
947702484 2:232246130-232246152 CAGCAGAAGAGCAGGGAGGATGG + Intronic
948581662 2:238991317-238991339 CAGGAAAAGAGCAAGGAAGAGGG - Intergenic
948930414 2:241128312-241128334 CCGAAAAAGAGAGAGGAGGCTGG + Intronic
1168745220 20:233486-233508 AAGAAAAAGAGAAAGGAGGTTGG + Intergenic
1168764973 20:375725-375747 CAGAACTATAGCAAAGAGGCCGG + Intronic
1168906624 20:1409125-1409147 CAGAGCAATATCAAGGAGGCAGG - Intergenic
1169899009 20:10534265-10534287 CAGAAAGAAAGGAAGGAGGCAGG - Intronic
1171478945 20:25437820-25437842 CAGAATAAGAGAAAAGGGGCCGG + Intronic
1172191671 20:33065510-33065532 CAGAAAAAGAGAAAGAAGGAAGG + Intronic
1172270442 20:33652760-33652782 CAGAAAGAGAGCAAAGAGGCCGG + Intergenic
1172291686 20:33781423-33781445 TATAATAAGGGCAAGGAGGTGGG + Intronic
1172626338 20:36349602-36349624 CAGAGAAACAGGAAGGAGGCCGG + Intronic
1172643366 20:36455147-36455169 CAGAGTAAGAGGAGGGAGGGAGG - Intronic
1172695094 20:36816968-36816990 AAGAAAATGAGCAAGGGGGCCGG + Intronic
1172785465 20:37465465-37465487 GAGAAGAGGAGGAAGGAGGCGGG - Intergenic
1172801006 20:37576198-37576220 GAGACCAAGAGCAAGGAGGAAGG - Intergenic
1172992298 20:39045576-39045598 CAGAATATGAGCTTGGAGGTGGG - Intergenic
1173695248 20:45005065-45005087 CAGAAGGAAAGAAAGGAGGCTGG - Intronic
1174607364 20:51770489-51770511 CAAGAGAAGACCAAGGAGGCCGG + Intergenic
1174926620 20:54767313-54767335 CAGAGTGAGGGCAGGGAGGCAGG - Intergenic
1175194951 20:57236651-57236673 CAGATTCAGAGAAAGGGGGCAGG + Intronic
1175328469 20:58146253-58146275 CACAACAAAAGCATGGAGGCTGG - Intergenic
1175453845 20:59094823-59094845 CTCAATGAGAGTAAGGAGGCGGG - Intergenic
1175529953 20:59667762-59667784 CAGCACAAGAGAAAGGAAGCAGG - Intronic
1175534841 20:59702323-59702345 CAAAAGAACAGGAAGGAGGCTGG - Intronic
1175779448 20:61672955-61672977 TAGAAGAAGAAGAAGGAGGCAGG + Intronic
1176857749 21:13985483-13985505 CAGGATCAGGGCCAGGAGGCTGG - Intergenic
1177683467 21:24405785-24405807 CAAAAGAAGAGAAAGCAGGCTGG - Intergenic
1177885535 21:26741596-26741618 CGGAAGAAGAGCAGGGAGGCTGG + Intergenic
1178076090 21:29014331-29014353 CAGAAGAAGAGAAAGAAGGCAGG - Intronic
1178464413 21:32833627-32833649 CAGAAAAGGACCAAAGAGGCAGG + Intergenic
1178810031 21:35873065-35873087 TAGAAAATGAGCAAGGAGGCTGG + Intronic
1178904386 21:36624453-36624475 GAGAAAAAGAGCAAGAGGGCTGG + Intergenic
1179095172 21:38307896-38307918 CAGAAAAAGAGAGATGAGGCTGG - Intergenic
1180905836 22:19410655-19410677 CAGGAGAAGAGCAAGGTGGCAGG + Intronic
1181562842 22:23715631-23715653 CAGAAAAAGAGGATGTAGGCTGG + Intergenic
1181624809 22:24116052-24116074 GAGAATTAAAGGAAGGAGGCTGG - Intronic
1182903271 22:33916746-33916768 CAGAAGTAGAGGCAGGAGGCTGG - Intronic
1183592020 22:38784807-38784829 TAGAAAAAGAGCCAGCAGGCTGG - Intronic
1183787756 22:40040700-40040722 AAGACCAAGAGCAATGAGGCAGG - Exonic
1183878085 22:40801667-40801689 CTGAAGATGAGCAAGGATGCTGG - Intronic
1184014219 22:41773577-41773599 AAAAAGAACAGCAAGGAGGCCGG + Intronic
1184198625 22:42949286-42949308 CATACTAGGAGCAAGAAGGCTGG - Intronic
1184719455 22:46301783-46301805 AAAAATAAGAGTAATGAGGCTGG - Intronic
1184724431 22:46335463-46335485 CAGAAGAAGAGCAGTGAGGCCGG + Exonic
1185307062 22:50125103-50125125 CTGAAAAAGAGCAGGGAGGGTGG + Intronic
950020788 3:9786233-9786255 CAGAATAAGAGCAAGGAGGCCGG - Intronic
952998461 3:38907969-38907991 CAGAATCTGACCCAGGAGGCTGG + Exonic
954688214 3:52382095-52382117 CAGAATCAGAGCTGGGAGGATGG + Intronic
956058224 3:65323000-65323022 TAGAAAAAGAAAAAGGAGGCCGG - Intergenic
956084139 3:65591739-65591761 CAGAGGAACAGCAAGGAGGCCGG - Intronic
957000311 3:74876704-74876726 CAGAATCAGAACATGGAGACTGG - Intergenic
957523037 3:81345564-81345586 CAGAATAAGGGGAAGGTGGATGG + Intergenic
960843660 3:121986591-121986613 CAGAAGAACAGCACAGAGGCAGG - Intergenic
962500412 3:135985507-135985529 CAGATAAACAGCAAGGAGGAGGG - Intronic
962982254 3:140501147-140501169 GAGAACAAGAGCAAGGTGGGTGG - Intronic
963105318 3:141642108-141642130 AAGCATAAGAGAGAGGAGGCCGG + Intergenic
963524308 3:146396988-146397010 CATCATAACAGGAAGGAGGCAGG - Intronic
963925584 3:150947481-150947503 CAGTATTAGATCATGGAGGCAGG + Intronic
964158549 3:153617309-153617331 AAGGAGAAGAGGAAGGAGGCAGG - Intergenic
964231533 3:154475937-154475959 CAGAATATGGGCACAGAGGCAGG + Intergenic
965492015 3:169349227-169349249 AAGAAAAAGAGCAAGAAGGAGGG - Intronic
965553052 3:169989376-169989398 CCAAATCAGAGGAAGGAGGCTGG - Intronic
965583319 3:170292596-170292618 AAGTTTAAGACCAAGGAGGCAGG + Intronic
965859885 3:173136062-173136084 AAGAATATAAGCAAGAAGGCAGG + Intronic
966091612 3:176145045-176145067 CAGGATTAAAGCAAGGTGGCAGG + Intergenic
966340608 3:178921717-178921739 CAGTCTAAGTGCATGGAGGCTGG - Intergenic
966470488 3:180283402-180283424 CAGGATCAGGGCAAGGAGGAGGG + Intergenic
966891184 3:184408817-184408839 CAGAGTAGGAGACAGGAGGCAGG - Intronic
969050057 4:4366319-4366341 CGGAGGAAGAGAAAGGAGGCTGG + Intronic
969608840 4:8216055-8216077 CAGAAGAGGGGCAGGGAGGCAGG - Intronic
970009446 4:11443245-11443267 CAGGAAAAGAGCAATGAAGCTGG - Intergenic
970162624 4:13204658-13204680 GAGAAGGAGAGCAAGGAGGATGG - Intergenic
971304503 4:25467887-25467909 CAGAAAAGGAGCAAGAAGGGTGG - Intergenic
972090447 4:35275102-35275124 CAGTATAAAAGCAAAGAGACAGG + Intergenic
973248273 4:48034080-48034102 GAGCATTAGAGGAAGGAGGCTGG + Intronic
973752132 4:54031914-54031936 AAGAATTAGAGCAAGTGGGCTGG - Intronic
974997144 4:69175346-69175368 CAGAATAGGAGGAAGGTGGAGGG + Intronic
977728651 4:100325865-100325887 GAGAAAAGGAGAAAGGAGGCAGG + Intergenic
979672332 4:123373119-123373141 AAGAAAAAGAGAAAGGAGGGAGG + Intergenic
980722151 4:136712301-136712323 CAGGATAAGGGGAATGAGGCAGG - Intergenic
980770497 4:137365520-137365542 CAATATAAGAGAAAGGAGGGAGG + Intergenic
980771336 4:137377576-137377598 CTGAATAAGTGCATGGAGGGTGG - Intergenic
980797199 4:137700025-137700047 GAGAAAGAGAGCAAGGAGGAAGG - Intergenic
981160191 4:141488254-141488276 CACAATTAGAACAAGGAGGCCGG - Intergenic
982767544 4:159365877-159365899 CATAATATAACCAAGGAGGCTGG + Intergenic
982834371 4:160105396-160105418 AAGAAACAGAGAAAGGAGGCGGG - Intergenic
983667048 4:170194085-170194107 CAGAATCAGAACAAGGAGATTGG - Intergenic
984647830 4:182238455-182238477 CAGAGTAAGGGCATAGAGGCTGG - Intronic
984847932 4:184123379-184123401 CATAATCAGAGCAAAGAGGCTGG - Intronic
986778629 5:11044111-11044133 CAGAATGAGAGCAGACAGGCAGG - Intronic
987562659 5:19543672-19543694 CAGAATTACAGTAAGGAGGAAGG + Intronic
987876028 5:23682022-23682044 CAGAAGAAGAATATGGAGGCAGG - Intergenic
988109969 5:26807550-26807572 CAAAATAAGAGCCAGGAGCAGGG - Intergenic
988325948 5:29768320-29768342 AAAAATAAGAGCAGGTAGGCCGG + Intergenic
988698632 5:33649717-33649739 CACAAGAAGAGCCAGCAGGCAGG + Intronic
988901852 5:35741426-35741448 TTGAAGAACAGCAAGGAGGCTGG + Intronic
989547991 5:42696903-42696925 AAGAGTAAGAGCATGGAGGCTGG - Intronic
990198616 5:53346429-53346451 CAGGAAAAGAGAAATGAGGCTGG + Intergenic
990502649 5:56412039-56412061 CAGAATGTGAGAAAGGAGGAAGG - Intergenic
991020919 5:61979559-61979581 TAGAATAAGAACAAGAACGCAGG + Intergenic
992446875 5:76842268-76842290 AAGAGTATGAGCAAGTAGGCTGG + Intergenic
992530027 5:77644841-77644863 GAGAAAAAGAGAAAGGAGGAAGG - Intergenic
993967965 5:94381069-94381091 CAGAAAATGAGCAAGAAGGAAGG - Intronic
995309264 5:110692512-110692534 CACAGGAAGCGCAAGGAGGCAGG + Intronic
996224672 5:120977322-120977344 GTAAAGAAGAGCAAGGAGGCCGG + Intergenic
996273897 5:121640925-121640947 AAGAATAAGAGCGAGCAGGTAGG - Intergenic
996385490 5:122905975-122905997 CAGAATAACAGCTAAGAGTCAGG + Intronic
996748667 5:126867960-126867982 CAGAATCACAGCAAGGAGTGTGG + Exonic
997775929 5:136604993-136605015 CAGAAAAAGAGGAAGGAAGGTGG - Intergenic
998016047 5:138733239-138733261 AAGCATAGGAGCAAGGAGGTGGG + Intronic
998270390 5:140701058-140701080 CAAAATGAGAGCGAGGAGGTGGG + Intronic
998547023 5:143037958-143037980 GACATTAAGATCAAGGAGGCTGG + Intronic
998618951 5:143773278-143773300 CATAATAACACCAAGGAGGATGG + Intergenic
999513695 5:152279300-152279322 CAGAATAAAAGGAAGTAAGCAGG - Intergenic
999785736 5:154888967-154888989 CAGGAGAATAGCATGGAGGCAGG - Intronic
1000011158 5:157234276-157234298 CAAAATATTAGTAAGGAGGCTGG - Intronic
1001073125 5:168604153-168604175 CAGAAGTAGACCAAGGAGCCGGG + Intergenic
1001848139 5:174939734-174939756 AAGAATACTAGCCAGGAGGCTGG - Intergenic
1002462099 5:179379071-179379093 CAGAACAAGAACCAGGATGCAGG - Intergenic
1002537447 5:179885095-179885117 AAGAATAGAAGCAAGGAGGCCGG - Intronic
1002833455 6:845239-845261 CAGAGTAAGAGGGAGGATGCAGG + Intergenic
1002968021 6:1986855-1986877 CAGAATGAGAGTAAGGGGGCTGG + Intronic
1003381803 6:5631118-5631140 CAAAATAAGAGAAAGAAAGCTGG + Intronic
1003758991 6:9153488-9153510 CAGAATAAGAGAAGAGAGGAGGG + Intergenic
1003838353 6:10094680-10094702 CACAAGAAGAGCAAGGGGGATGG + Intronic
1004490466 6:16110188-16110210 CAGAATAAAAGCCAGAAAGCTGG - Intergenic
1005024406 6:21448803-21448825 GAGAAAAAAAGCAAGGAGGGAGG - Intergenic
1005083625 6:21981564-21981586 CAGAACAAGAAAGAGGAGGCAGG - Intergenic
1005535730 6:26754591-26754613 CAGAATGAGAGCTCGGAGCCCGG + Intergenic
1005819996 6:29590280-29590302 AAGGTTAAGAGCAAGGAGTCTGG - Intronic
1005978847 6:30820534-30820556 GTGAATAAGGGCAAGGAAGCAGG - Intergenic
1007198968 6:40089023-40089045 CAGAACAAGATGAAGGAGGAGGG + Intergenic
1008453152 6:51676045-51676067 CAGAGGAGGAGGAAGGAGGCAGG + Intronic
1008719072 6:54327332-54327354 CCCAGGAAGAGCAAGGAGGCTGG + Intronic
1010198737 6:73264434-73264456 CAGTACAGGAACAAGGAGGCAGG + Intronic
1010280936 6:74021757-74021779 AACAATAGGAGCAACGAGGCTGG - Intergenic
1011300165 6:85865317-85865339 CAGGAGAAGAGCAAGGAAGAAGG - Intergenic
1011702220 6:89966551-89966573 CTGAATAAGAGCATGAAGTCAGG + Intronic
1011802292 6:91031066-91031088 CAGAATGAGAGCAGTGAGGATGG + Intergenic
1011968821 6:93195843-93195865 CAGAATGAGTGCTAGGTGGCTGG + Intergenic
1012196229 6:96344363-96344385 CAAAAGGAGAGCAAGGAAGCTGG + Intergenic
1012499163 6:99869603-99869625 GAGCATGAGAGCAAGGGGGCAGG - Intergenic
1012520170 6:100111800-100111822 CAGGATATGGGCCAGGAGGCTGG + Intergenic
1012734792 6:102925358-102925380 CAGAAAGAGAGCAAGGCGGAAGG - Intergenic
1013300729 6:108802907-108802929 CAGAGGAATAGCAAGGAGGTCGG + Intergenic
1014592962 6:123295019-123295041 CAGGAAATGAGGAAGGAGGCAGG + Intronic
1016231393 6:141809426-141809448 TAGAATATGACCGAGGAGGCAGG + Intergenic
1017674021 6:156795329-156795351 GAGAATAAGGGAAGGGAGGCCGG + Intronic
1018048093 6:159982205-159982227 AGGAAGAGGAGCAAGGAGGCAGG - Intronic
1018796565 6:167190061-167190083 CTGAGGAAGAGCAAGGAGGCCGG + Intronic
1018819754 6:167365056-167365078 CTGAGGAAGAGCAAGGAGGCCGG - Intronic
1019948801 7:4353823-4353845 TATAATAAGATCAATGAGGCCGG + Intergenic
1020893255 7:13906114-13906136 CTGAATTAGAGAAAAGAGGCAGG - Intronic
1021206528 7:17787330-17787352 CAGAAAAAGAGCCATGAGGAGGG + Intergenic
1022162092 7:27721331-27721353 CTGAAAAATAGCAAGGAGGATGG + Intergenic
1022555855 7:31295186-31295208 CAGACCAAGAGAAAGGAGGCAGG + Intergenic
1025955499 7:66179603-66179625 AAGAATAAGAGTGAGTAGGCCGG + Intergenic
1026474715 7:70725118-70725140 GAGAAAGAGAGCAAGGAGGTTGG + Intronic
1027765261 7:82332701-82332723 CACAATAAGAGGAACCAGGCGGG + Intronic
1028079682 7:86559591-86559613 AAGAATAAGAACAAACAGGCTGG - Intergenic
1028246840 7:88489607-88489629 AAGAAGAAGAACAAGGAGGATGG - Intergenic
1028379166 7:90178721-90178743 CAGAACAAGGGCTGGGAGGCAGG + Intronic
1028877425 7:95839325-95839347 AAGAAAAAGAGAAAGGAGGCTGG - Intronic
1028951067 7:96635483-96635505 CAGAAAAGGAGCAAGGCAGCAGG + Intronic
1029686466 7:102151787-102151809 CAGACCAGGACCAAGGAGGCGGG - Intronic
1030131811 7:106207916-106207938 AGGAATCAGAGCAAGGAGACAGG - Intergenic
1031186654 7:118489599-118489621 CAGAGTAAGAGCCAGCAGGTGGG + Intergenic
1031207748 7:118782450-118782472 CAGAATAAGAGAAACAAGGTAGG - Intergenic
1032036443 7:128524972-128524994 CAGGATAAAAGCCAGGAGGCCGG + Intergenic
1035029518 7:155848385-155848407 GAGAATAGGAGACAGGAGGCTGG - Intergenic
1035848519 8:2890781-2890803 TTGAGGAAGAGCAAGGAGGCAGG + Intergenic
1035913726 8:3596714-3596736 CAAAACAAGAGCCAGGAGGGTGG + Intronic
1036125455 8:6057741-6057763 CAGAATGGGAGCACGGCGGCTGG - Intergenic
1036699238 8:11000976-11000998 CTGAATCAGAGGAAGGGGGCAGG - Intronic
1036731968 8:11273766-11273788 CAAAACAAAAGCAAGAAGGCAGG - Intergenic
1037136513 8:15469047-15469069 CAGAATAAAAACGAGAAGGCTGG + Intronic
1038542070 8:28398256-28398278 CAGTATAAGAGGGAGAAGGCTGG - Intronic
1038993012 8:32890097-32890119 CACAATGAGAGCAATGAGGTTGG - Intergenic
1039721933 8:40173819-40173841 GAGAATAAGAGAAATGTGGCCGG + Intergenic
1039765695 8:40625725-40625747 CAGATGTAGAGCAAGGAGGTGGG + Intronic
1040372246 8:46788448-46788470 CAGAAAATGAGCAAAGAGGTGGG - Intergenic
1040582412 8:48708331-48708353 CAGCCAAGGAGCAAGGAGGCAGG - Intergenic
1041037045 8:53803038-53803060 AAGAAGTAGAGAAAGGAGGCTGG + Intronic
1041311173 8:56518108-56518130 CAGAAAAAGAAAATGGAGGCCGG - Intergenic
1041721084 8:60975951-60975973 TACAATAAGTACAAGGAGGCCGG + Intergenic
1043132268 8:76476031-76476053 CAGATGAAGAGCAAGTAGGATGG + Intergenic
1045399799 8:101801964-101801986 CACAATAAGAGGAAGTATGCTGG - Intronic
1045669208 8:104528476-104528498 CAGAAAAAATGCAATGAGGCCGG + Intronic
1045997618 8:108381827-108381849 CATAAGAAGAGAAAGGAGACAGG + Intronic
1046049812 8:109009539-109009561 CAGAAAAGGAGCAAGAAGTCAGG - Intergenic
1047728867 8:127709199-127709221 AAGAATGAGGCCAAGGAGGCCGG - Intergenic
1048468876 8:134689513-134689535 CTGAATTAGGGGAAGGAGGCTGG - Intronic
1049455534 8:142684494-142684516 GAGAAGAAGGGCAAGGATGCGGG + Intergenic
1049584291 8:143425808-143425830 CAGAACCAGAGCAGGCAGGCAGG - Intronic
1050220170 9:3378850-3378872 TAGAATATGAGAAAGAAGGCCGG - Intronic
1050506393 9:6353445-6353467 AGGATTAAGAGCCAGGAGGCTGG - Intergenic
1050614345 9:7386427-7386449 CAGAATCAGAACAAAGAGGGAGG + Intergenic
1052299902 9:26942584-26942606 AAGAGTCAGAGCACGGAGGCCGG + Intronic
1052350501 9:27453925-27453947 CAGCATAGGAGGAAGAAGGCAGG - Intronic
1052982915 9:34461893-34461915 CAGAAAAAGATAAAGGAGGATGG + Intronic
1053054264 9:34984906-34984928 CAGAGTCAGAGGAGGGAGGCAGG + Intergenic
1053376346 9:37609828-37609850 CTGAGGAAGAGCAAGGAGGCTGG - Intronic
1053440212 9:38109800-38109822 CAGAAGAAGCGCAAGGGGCCAGG + Intergenic
1053903920 9:42822454-42822476 CACAATGAGATCAATGAGGCAGG + Intergenic
1054531067 9:66183060-66183082 CACAATGAGATCAATGAGGCAGG - Intergenic
1055544582 9:77356156-77356178 ATGAAGAAGAGCAAGGAGGCTGG - Intronic
1056105680 9:83344031-83344053 CAGAAAAATAGCAAGGTGGGAGG + Intronic
1056368234 9:85928038-85928060 CAGAACAAGACCAAGAAGGAGGG - Intergenic
1056435127 9:86568602-86568624 CTGAATTTGGGCAAGGAGGCTGG + Intergenic
1057557914 9:96102325-96102347 CAGAAGGAGAAGAAGGAGGCCGG + Intergenic
1058132770 9:101271555-101271577 CAGAATAAGAGAAAGCATACAGG + Intronic
1060089657 9:120731742-120731764 CTGAATGAGAACGAGGAGGCAGG + Intergenic
1061124168 9:128663301-128663323 CAGAAGAAGAGGAAGGAGTGGGG - Intergenic
1061278647 9:129584370-129584392 CAGAATGTGAGCATGGAGTCTGG + Intergenic
1061821092 9:133227592-133227614 CAGAGTCAGAGCCAGCAGGCAGG - Intergenic
1061835232 9:133324243-133324265 CAGCAGCAGAGCAAGCAGGCAGG + Intergenic
1062314978 9:135962582-135962604 CAGAATAAAAGCCTGCAGGCAGG - Intergenic
1062571458 9:137187643-137187665 CAGAGTAAGAGGAAGGGGGAAGG - Exonic
1185509070 X:649332-649354 CAGAAAAAGAGAGAGGAGGCCGG - Intronic
1186623609 X:11268108-11268130 CAGAATAAGAGCCAAGAAGAAGG - Intronic
1187148328 X:16657907-16657929 CAGAAAAATAGAAAGGTGGCCGG + Intronic
1187226814 X:17380897-17380919 AAGGATACGAGCAGGGAGGCAGG + Intronic
1187485995 X:19704222-19704244 GCGAATAATAGAAAGGAGGCTGG + Intronic
1188026919 X:25219629-25219651 GACAAAAATAGCAAGGAGGCAGG - Intergenic
1189723244 X:43942000-43942022 AAGAACAAGAGCAAAGAGGATGG - Intergenic
1189942420 X:46138480-46138502 CAGGACAAGGTCAAGGAGGCAGG - Intergenic
1190281459 X:48933712-48933734 CAGAATTACTGCAAAGAGGCTGG - Intronic
1191701124 X:64043996-64044018 CTGAAAAAGAGTAAGCAGGCTGG - Intergenic
1192300977 X:69902423-69902445 CAGAACAAAAGCAAGCAAGCAGG - Intronic
1192940000 X:75902146-75902168 CAGAATCAGAACATGGAGGTTGG - Intergenic
1195097164 X:101514197-101514219 GAGCATAAGATCATGGAGGCAGG + Intronic
1195384423 X:104300330-104300352 CATAATGAGAGCAAGGTGTCAGG - Intergenic
1196283725 X:113855199-113855221 TAGACTAAGAGCAAGAAGCCTGG + Intergenic
1196308967 X:114138485-114138507 CAGAATAAAAGCTTGGAGCCAGG + Intergenic
1197221729 X:123921064-123921086 AAGAAAAAAAGAAAGGAGGCCGG - Intergenic
1198444826 X:136702001-136702023 AAGAATAAGAAAAATGAGGCCGG - Intronic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1198521874 X:137461229-137461251 CAGAAATAGAGAAAAGAGGCTGG + Intergenic
1199192673 X:144989685-144989707 CAGAATAACAGCTAGGAAGCAGG + Intergenic
1199329687 X:146544105-146544127 CAGAATGAGAGCAAGGTGAGGGG + Intergenic
1199989739 X:152979729-152979751 CAGAGAAAAAGCAAGGAAGCAGG - Intergenic
1200397197 X:155998246-155998268 CAGAAGAGGAGCCAGGAGGATGG + Intronic
1200876013 Y:8155437-8155459 CAGCATATGAGCAAGGACCCAGG - Intergenic