ID: 950021347

View in Genome Browser
Species Human (GRCh38)
Location 3:9789848-9789870
Sequence CCCAAGAAGCAGAAACTGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 416
Summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 369}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950021347_950021359 29 Left 950021347 3:9789848-9789870 CCTTCCAGTTTCTGCTTCTTGGG 0: 1
1: 0
2: 3
3: 43
4: 369
Right 950021359 3:9789900-9789922 CATGGTCTCGACCCAGCTTCAGG 0: 1
1: 0
2: 0
3: 4
4: 85
950021347_950021350 -9 Left 950021347 3:9789848-9789870 CCTTCCAGTTTCTGCTTCTTGGG 0: 1
1: 0
2: 3
3: 43
4: 369
Right 950021350 3:9789862-9789884 CTTCTTGGGCTTCCCATGTTTGG 0: 1
1: 0
2: 1
3: 14
4: 314
950021347_950021354 -5 Left 950021347 3:9789848-9789870 CCTTCCAGTTTCTGCTTCTTGGG 0: 1
1: 0
2: 3
3: 43
4: 369
Right 950021354 3:9789866-9789888 TTGGGCTTCCCATGTTTGGGGGG 0: 1
1: 0
2: 0
3: 10
4: 144
950021347_950021353 -6 Left 950021347 3:9789848-9789870 CCTTCCAGTTTCTGCTTCTTGGG 0: 1
1: 0
2: 3
3: 43
4: 369
Right 950021353 3:9789865-9789887 CTTGGGCTTCCCATGTTTGGGGG 0: 1
1: 0
2: 2
3: 17
4: 156
950021347_950021357 11 Left 950021347 3:9789848-9789870 CCTTCCAGTTTCTGCTTCTTGGG 0: 1
1: 0
2: 3
3: 43
4: 369
Right 950021357 3:9789882-9789904 TGGGGGGAGCTCCAAGTTCATGG 0: 1
1: 0
2: 1
3: 18
4: 182
950021347_950021352 -7 Left 950021347 3:9789848-9789870 CCTTCCAGTTTCTGCTTCTTGGG 0: 1
1: 0
2: 3
3: 43
4: 369
Right 950021352 3:9789864-9789886 TCTTGGGCTTCCCATGTTTGGGG 0: 1
1: 0
2: 3
3: 18
4: 206
950021347_950021351 -8 Left 950021347 3:9789848-9789870 CCTTCCAGTTTCTGCTTCTTGGG 0: 1
1: 0
2: 3
3: 43
4: 369
Right 950021351 3:9789863-9789885 TTCTTGGGCTTCCCATGTTTGGG 0: 1
1: 0
2: 1
3: 15
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950021347 Original CRISPR CCCAAGAAGCAGAAACTGGA AGG (reversed) Exonic
900247812 1:1646716-1646738 CCTGAGAAGCAGAGACTGGTGGG - Intronic
900259039 1:1713870-1713892 CCTGAGAAGCAGAGACTGGTGGG - Intronic
901219596 1:7575888-7575910 CCAGGGAAGCAGGAACTGGAGGG - Intronic
904016976 1:27429274-27429296 CCCATTCAGCAGACACTGGACGG + Intronic
904569294 1:31449312-31449334 CACAAGATGTAGAAAATGGAAGG - Intergenic
904627609 1:31815800-31815822 CGCAAGGAGCAGATACTGAACGG + Intronic
905190184 1:36227735-36227757 AGCAAGAAGCAGAGATTGGAGGG + Intronic
905373406 1:37500218-37500240 CCCAGGAAGCAGAGGCTGCAGGG + Intronic
906111194 1:43323163-43323185 CCCAAGAGACAGAAACTGGCCGG + Intergenic
906257602 1:44362282-44362304 CCCATTAAGCAGAAACTTCAAGG - Intergenic
906418262 1:45639941-45639963 CCCAAGTAGCTGAAACTACAGGG - Intronic
906753662 1:48288842-48288864 GCCAGGAAGCTGAAACTGGGTGG + Intergenic
907661950 1:56401402-56401424 CCCAGGAAGGAGATGCTGGAGGG - Intergenic
908167022 1:61468736-61468758 CCAAAGAGGCAGAACGTGGATGG - Intergenic
908491600 1:64649793-64649815 CCCAAGGAGCAAAATTTGGATGG - Intronic
908576700 1:65467688-65467710 GCCAAGAAGCACGAACTGGGTGG - Intronic
910847624 1:91618555-91618577 CCTAAGAGGCAGAAACCGCAAGG + Intergenic
912201425 1:107462194-107462216 TCCACGAAACAGAAACTGGTAGG - Intronic
912265142 1:108149830-108149852 CCCAGGGAACAGAAACTGGCTGG - Intronic
912696131 1:111843484-111843506 CCAAAGAAGCAGAAACAGTCAGG - Intronic
913148593 1:116017244-116017266 CCCAAGTAGCTGGGACTGGAGGG - Intronic
913182724 1:116337712-116337734 CCCTAGAAGCAGAAAAGGGAAGG - Intergenic
913227198 1:116710619-116710641 CCCAAGACCCAGAAAGGGGAAGG + Intergenic
914964361 1:152240941-152240963 GCCAAGAAGAAGAATGTGGAGGG - Intergenic
915571781 1:156748864-156748886 CCCAAGAGGCAGAAAAGAGAAGG + Intronic
918139951 1:181711764-181711786 CCCAAGGAGCAGAAGGGGGAAGG + Intronic
918616563 1:186550961-186550983 GCCGAGAAGCTCAAACTGGATGG - Intergenic
919899059 1:202030342-202030364 CCCAAGAAGTAGAAACCTCAAGG + Intergenic
920001503 1:202803083-202803105 CCCAAGAAGTGGAAGCTGCAGGG + Intronic
920161468 1:204001588-204001610 TCCAAAAGGGAGAAACTGGAGGG - Intergenic
920196747 1:204232909-204232931 CCCAACAAGGAGAAATTGGAAGG - Intronic
920412456 1:205773106-205773128 CCCAAGAAGAAGACACTGTGTGG + Intronic
921359983 1:214322500-214322522 CACAAAAAGCAGAAAATGGGAGG - Intronic
921798939 1:219379957-219379979 CCCAAAAGGCAGGAACTGGCTGG + Intergenic
922907547 1:229185863-229185885 GTTAAGAAGCAGACACTGGATGG + Intergenic
923435919 1:233967975-233967997 ACCAAGTACCACAAACTGGATGG + Intronic
923802158 1:237220574-237220596 CCCGAGAAACAGAAACTATACGG - Intronic
923940283 1:238816123-238816145 GCCAAGGAGCAGAGACTGCAAGG + Intergenic
924226044 1:241922556-241922578 CCCAAGTAGCTGAGACTGTAGGG + Intergenic
1065158999 10:22899753-22899775 ACAAAGTAGCATAAACTGGATGG - Intergenic
1065812364 10:29453828-29453850 CCCAAGTAGCCGAAACTACAGGG + Intergenic
1066299021 10:34080579-34080601 CCAAAGAAGCAGGAACTAAAAGG + Intergenic
1066581041 10:36882565-36882587 CCCAAGTAGCTGAGACTGCAAGG - Intergenic
1067290664 10:44937442-44937464 GCCAAGAAGCAAAGACTAGAAGG + Intergenic
1067408139 10:46041667-46041689 CCCAAGTAGCAGAGACTACAGGG - Intronic
1067514193 10:46922806-46922828 TCCAAAAGGGAGAAACTGGAAGG - Intronic
1067648061 10:48129025-48129047 TCCAAAAGGGAGAAACTGGAAGG + Intergenic
1067901263 10:50244087-50244109 GCAAAGAAGCAGGAGCTGGAGGG + Intronic
1068115765 10:52736025-52736047 GCCAGGAAGCTGAAACTGGGTGG - Intergenic
1068953059 10:62796592-62796614 CCTAAGAAACAGTAAATGGATGG + Intergenic
1069160360 10:65084639-65084661 CCTCAGAAGCAGATTCTGGAGGG + Intergenic
1070030861 10:72676031-72676053 CCCAAGTAGCTGAGACTAGAGGG + Intergenic
1070225214 10:74497070-74497092 CCCAAGTAGCAGAGACTACAGGG + Intronic
1070369834 10:75771721-75771743 CTCAAAAAGTAGGAACTGGAAGG - Intronic
1070518559 10:77230725-77230747 CCAAAGAGGCAGGAACTGGGAGG - Intronic
1070679970 10:78442080-78442102 CCCCAGGAGAAGACACTGGATGG + Intergenic
1071349680 10:84727601-84727623 CCAAGGAAGCTGAAACTGGGTGG + Intergenic
1071578430 10:86747691-86747713 CCCAAGAAGCAGCAAAGAGATGG + Intergenic
1071830887 10:89370940-89370962 CCCAGGAGGCAGAGACTGCAGGG + Intronic
1073006929 10:100331375-100331397 CTCAAGGAGGAGAAACTGCAGGG - Intergenic
1073184412 10:101607146-101607168 CACAAAAAGCAGAACCAGGAGGG - Intronic
1074089457 10:110235050-110235072 TCTAAGAAGCAGAAATTGGATGG - Intronic
1074631444 10:115259271-115259293 GCCAGGAAGCTTAAACTGGACGG - Intronic
1074720224 10:116257446-116257468 CTCAAGAAGGTGCAACTGGAAGG + Intronic
1075418266 10:122281707-122281729 ACCAAGAAGCAGAAAATGGAAGG + Intronic
1075420728 10:122298545-122298567 CCCAAAAAGCAGGAATTGAAGGG - Intronic
1076213614 10:128674063-128674085 GACAAGAAGCAGAAACCTGAGGG - Intergenic
1076333114 10:129686146-129686168 CAGCAGAAACAGAAACTGGAGGG + Intronic
1077930365 11:6725058-6725080 CCCAAAAAACAAAAACAGGATGG + Intergenic
1078495290 11:11811310-11811332 CCCGAGGAGCAGAGAATGGAAGG - Intergenic
1078822692 11:14897873-14897895 GATAAGAAGCATAAACTGGAGGG - Intergenic
1080576873 11:33607941-33607963 ACCAAGAAGCTGAAGCTTGAGGG + Intronic
1082232590 11:49786333-49786355 GCCAAGAGGCAGAAACTACAGGG - Intergenic
1082599600 11:55133197-55133219 GCCAGGAAGCTCAAACTGGATGG + Intergenic
1082658924 11:55886197-55886219 CACAAGAACCAGATGCTGGAAGG + Exonic
1083286481 11:61662465-61662487 ACCAAGCAGCAGACACTGGCTGG - Intergenic
1083733918 11:64668889-64668911 CCCAAGAAGTAGTTCCTGGAGGG + Intronic
1083774575 11:64888127-64888149 GCAAAGATGCAGAAACCGGACGG - Intronic
1083811870 11:65110897-65110919 CCCTAGAGACAGAGACTGGAGGG - Intronic
1084697635 11:70765134-70765156 CCCAGGAAACAGGAAATGGATGG - Intronic
1085192085 11:74635553-74635575 CCCAAGTAGCTGAAACTAAAAGG - Intronic
1086298241 11:85395755-85395777 GCCAGGAAGCACAAACTGGGTGG + Intronic
1086618045 11:88847608-88847630 GCCAAGAGGCAGAAACTGCAGGG + Intronic
1088242808 11:107788833-107788855 CCCAAGAAGCTGAGACTACAGGG - Intergenic
1089524487 11:119088036-119088058 CCAGAGAAGCAGAGACTAGAGGG - Intronic
1090167347 11:124563830-124563852 CCCTACAAGAATAAACTGGAAGG + Intergenic
1091385904 12:94497-94519 CCCAAGGAGCAGGAGGTGGATGG + Intronic
1092601524 12:10071464-10071486 CCCAAGAAGCAGAGACTGTGTGG - Exonic
1092610454 12:10166888-10166910 CACCAGAAAAAGAAACTGGAGGG - Exonic
1093019577 12:14190726-14190748 CCCAGGAGGTAGAAACTGCAGGG + Intergenic
1094435974 12:30421197-30421219 ACCAAGAGGCAGAGGCTGGAGGG - Intergenic
1094858401 12:34431473-34431495 GCCAAGAAGCTCAAACTGGGTGG + Intergenic
1095215800 12:39545868-39545890 CCAAAGAAGCAGAAAGAGGAAGG + Intergenic
1095563691 12:43595466-43595488 CCCAAGAAGGAGCAAGTGAATGG - Intergenic
1096196882 12:49654319-49654341 CCAGAGAAGCAGCAACAGGAAGG + Intronic
1096333093 12:50731755-50731777 GACAAGAAGCGGAAACTGGTTGG + Intronic
1096465606 12:51846702-51846724 CCCCAGAAGAAGAAACAGAAGGG - Intergenic
1097158581 12:57029804-57029826 CCCAAGCTGCAGAAGCTGAAAGG - Exonic
1097287861 12:57891426-57891448 CCCAGGAAGCAGAAGTTGCAGGG + Intergenic
1097445919 12:59670668-59670690 TCCAAAAAGGAGAAATTGGAAGG + Intronic
1098840568 12:75472782-75472804 GCCAAGGAGCAGAGTCTGGATGG - Intergenic
1099250014 12:80242932-80242954 TCTTAGAAGCAGAAACAGGACGG - Intronic
1099610490 12:84862183-84862205 AGAAAGAAGCAGAAATTGGAAGG - Intronic
1099752102 12:86788404-86788426 CCCAAGGAGAAAAAAATGGAAGG + Intronic
1099986389 12:89670201-89670223 GACAAGAACCAGAAACAGGAGGG + Intronic
1101595413 12:106160288-106160310 CCCAAGTAGCTGAGACTAGAGGG + Intergenic
1101931338 12:109016584-109016606 TCCAGGAAGAAGAAACTGTATGG - Intronic
1102688746 12:114744075-114744097 CCAAAGAAACAGATATTGGAGGG - Intergenic
1102728810 12:115089821-115089843 ACCAAGAAACAAAAACTGTAAGG + Intergenic
1103627331 12:122229981-122230003 CCCAGGAACCAAAAAATGGAGGG + Exonic
1104360486 12:128128460-128128482 ATCAAGAAACAGAAAATGGATGG - Intergenic
1104635121 12:130433696-130433718 CCCAAGAAGGAAAAAAGGGATGG - Intronic
1105047805 12:133020669-133020691 ACAAAGAACCACAAACTGGATGG + Exonic
1105968954 13:25410240-25410262 TTCAATAATCAGAAACTGGAGGG - Intronic
1106003120 13:25743389-25743411 ACCAAGCACCATAAACTGGATGG - Intronic
1107870379 13:44741233-44741255 CCCAGGAAGCAGAGATTGCAGGG - Intergenic
1108131456 13:47305786-47305808 AACAAGAAGCAGACACTGAAAGG + Intergenic
1108577631 13:51803547-51803569 CCCCAGAAGCACACACTGGCTGG + Intronic
1108778094 13:53791639-53791661 CCCAATAAGCATAAACTAGATGG - Intergenic
1110570113 13:76993734-76993756 CCCAAGTAGCAGAAACTTTTGGG + Intronic
1110670862 13:78175917-78175939 CCCACGTGGCAGAAAGTGGAAGG + Intergenic
1113121140 13:106924862-106924884 CCCAAGTTGCAAAAACTTGATGG - Intergenic
1114523960 14:23356642-23356664 CCCAAGAAGCAGAGTCAGGGAGG + Exonic
1115366093 14:32558800-32558822 CACAAGAAGGGGAAAATGGAGGG + Intronic
1116212705 14:41968468-41968490 GCCCAGAAGCACAAACTGGGCGG - Intergenic
1116919714 14:50560346-50560368 CCACAGAAGCAGAAAGTGGAGGG - Intronic
1117755349 14:58969115-58969137 CCCAAGCACCTGAAACTGCAGGG + Intergenic
1121889090 14:97572482-97572504 ACCAAGCAGAAGACACTGGAAGG - Intergenic
1122034514 14:98937579-98937601 CCCAAAAAGCAGCAAATGGCAGG - Intergenic
1122351693 14:101098696-101098718 ACCAAGAAGCAGAGGCTGGAGGG + Intergenic
1123485877 15:20738080-20738102 CCAAAGAAACAGTAACTTGAAGG + Intergenic
1123542365 15:21307124-21307146 CCAAAGAAACAGTAACTTGAAGG + Intergenic
1123695039 15:22872978-22873000 AACAAGAAGCAGAAACAGAATGG + Intronic
1124654894 15:31499968-31499990 ACCAAGCAGCAGTATCTGGAAGG + Intronic
1125260481 15:37818824-37818846 CCCAATAAGCAAAAATGGGATGG + Intergenic
1125354174 15:38799565-38799587 CTGAAGCAGCAAAAACTGGAAGG - Intergenic
1127131848 15:55874273-55874295 CCAAACAAGCAGAAACTGGAGGG + Intronic
1128524600 15:68403757-68403779 CCCAAGGAGCTGAGACTGCAGGG + Intronic
1128539467 15:68516322-68516344 CCCAGGAAGCAGAAATGGTATGG + Intergenic
1130571433 15:85048483-85048505 CAGAAAAAGCATAAACTGGAGGG - Intronic
1131708592 15:95026321-95026343 CCCAAGAAGCAGCCACAGGAGGG + Intergenic
1202950683 15_KI270727v1_random:34265-34287 CCAAAGAAACAGTAACTTGAAGG + Intergenic
1133535107 16:6694399-6694421 CACAAGAAGAAAAAACTGGTTGG + Intronic
1134471215 16:14527886-14527908 GCCCAAGAGCAGAAACTGGAAGG + Intronic
1135701716 16:24638414-24638436 CTCAAAAAACAGAAACAGGATGG + Intergenic
1137774827 16:51045980-51046002 CCCCAGAAGCAGAAGCTGGGAGG + Intergenic
1137858922 16:51826492-51826514 CCCAGGAAGTAGAGGCTGGAGGG + Intergenic
1138436208 16:57001411-57001433 CTCAAGAGGCAGAAACAGGATGG + Intronic
1138677938 16:58665528-58665550 TCTAAGAAGCAGAAGCTGGTTGG - Exonic
1138797628 16:59989128-59989150 ACCATGAAGCAGGAACTGGGGGG - Intergenic
1139449022 16:67015641-67015663 CCCAAGTAGCTGAGACTGCATGG - Intergenic
1141270113 16:82531868-82531890 CCAAATAAGCCTAAACTGGAGGG - Intergenic
1141969964 16:87474570-87474592 CAAGACAAGCAGAAACTGGAGGG + Intronic
1142213292 16:88818536-88818558 GCCAAAAAGCAGGAAATGGAGGG + Intronic
1142538681 17:640044-640066 GCCAGGAAGCTGGAACTGGATGG - Intronic
1142680063 17:1542122-1542144 CCCAGGAGGCAGAAGCTGCAGGG + Intronic
1143365165 17:6403274-6403296 CTCAAGAGGCTGAAGCTGGAGGG - Intronic
1143505704 17:7363819-7363841 CCCAAGAGACAGAGAGTGGAAGG - Intergenic
1143949387 17:10620640-10620662 CCTGAGAATCAGAACCTGGAAGG + Intergenic
1144477830 17:15603953-15603975 CCCAAGTAGCTGAGACTGCAGGG - Intronic
1148094144 17:45040858-45040880 CCCAAGAAGTAAAAACTGAGAGG - Intronic
1148736448 17:49867869-49867891 TCCAAGGAGCATCAACTGGAGGG + Intergenic
1151342406 17:73480436-73480458 CCCAGGAAGAAGGAGCTGGATGG + Intronic
1152021063 17:77780615-77780637 CCCAAGAAGCAGCAAGTTCAGGG - Intergenic
1153934284 18:9906991-9907013 CCCAAGTAGCTGGAACTGCAGGG - Intergenic
1154145637 18:11864160-11864182 CCCAAGAGGCAGAAGTTGCAGGG - Intronic
1155107474 18:22681845-22681867 CCCAAGAATTAGAAACTGGGGGG + Intergenic
1155780526 18:29826886-29826908 CACAAGCAGCAGACCCTGGAGGG + Intergenic
1157129437 18:44990952-44990974 CCAAAAAAGAAGAAACGGGATGG + Intronic
1158470321 18:57730217-57730239 CCCAAGAAAGAGAAACTAGAGGG + Intronic
1158499229 18:57984874-57984896 GCCAAGAAGCAGAAAATGACAGG + Intergenic
1158933880 18:62347001-62347023 ACCAGGAAACAGAAACTGGCAGG - Intronic
1159418840 18:68188490-68188512 GCAAGGAAGCAGGAACTGGAAGG - Intergenic
1160431334 18:78814853-78814875 CCCAAACAGCAGGAACTGGAGGG + Intergenic
1160973292 19:1779934-1779956 CCCAAGAACCAGGAACTGAGGGG - Exonic
1162770156 19:12944489-12944511 CCCCAGAAGGAGACACAGGAGGG - Exonic
1163094100 19:15043155-15043177 CCCAAGAAGGAAGAACTGGGTGG - Intergenic
1165974408 19:39662219-39662241 TCCAAGAAGCTGAGAATGGAGGG - Intergenic
1165979803 19:39710974-39710996 TCCAAGAAGCTGAGAATGGAGGG - Intergenic
1166482233 19:43184079-43184101 CCCCAGAAGCATAAACAGAAGGG - Intronic
1166491835 19:43267081-43267103 CCCCAGAAGCAGAAACAGAAGGG - Intronic
1166740208 19:45109984-45110006 CTCAAGAAGCTTACACTGGATGG - Intronic
1167172773 19:47844313-47844335 CCCAAGAGGCAGAGGCTGGAGGG - Intergenic
1168631052 19:57956361-57956383 CCAAAAAAACAGAACCTGGAAGG + Intergenic
1168653276 19:58107483-58107505 CCCAAGAGGCAGAGGCTGCAGGG + Intronic
924975939 2:175343-175365 TCCAAGAAGGATAAACTTGAAGG + Intergenic
925577762 2:5378332-5378354 CCCATGGAGCTGGAACTGGATGG + Intergenic
925979312 2:9164237-9164259 CCCAAGAAGGGGGAACAGGAGGG - Intergenic
926574461 2:14564705-14564727 CTCAAGAAGAAGAAACAGGAGGG + Intergenic
928684193 2:33731344-33731366 CCCAAGTAGCTGAAACTACAGGG + Intergenic
930013099 2:46952642-46952664 CCCAAGAAGCTGCGGCTGGAGGG + Intronic
930035233 2:47081024-47081046 CCCAAGAAGCAGAACCCACAGGG - Intronic
931634996 2:64332912-64332934 CCCGAGGAGCAGAAACTTGTGGG - Intergenic
932145555 2:69313000-69313022 CCACAGAGGTAGAAACTGGAGGG - Intergenic
932324497 2:70848400-70848422 CCGAAAAAGGAAAAACTGGAAGG + Intergenic
932377540 2:71251066-71251088 GCCAGGAAGCACAAACTGGGTGG - Intergenic
933328028 2:80863466-80863488 CCCCAGGGGCAGACACTGGAGGG - Intergenic
934060653 2:88289564-88289586 CAAAGCAAGCAGAAACTGGAAGG + Intergenic
934542720 2:95189423-95189445 CCCAAGAAAAATAAACAGGAAGG - Intergenic
935537380 2:104309926-104309948 CCCAAGAGGCAGAGATTGCAGGG + Intergenic
937517686 2:122673869-122673891 CCAAAGAGGGACAAACTGGAAGG + Intergenic
938586209 2:132693155-132693177 GCCAAGAAGCAGAAGATGGAAGG - Intronic
939193363 2:138942623-138942645 GCCCAGAAGCAGGAACTGGGTGG - Intergenic
940419857 2:153467593-153467615 CCCATGAAAAAGAAAATGGAGGG - Intergenic
942635305 2:177997785-177997807 CAGAAGAAGCAGAAAATGGAGGG - Intronic
942779942 2:179630007-179630029 GCCAAGAAGCTCAAACTGGGCGG + Intronic
946045776 2:216819840-216819862 CCCAAAAAGAAGAAATTAGAAGG - Intergenic
946249663 2:218404750-218404772 CCCAGGAAGCAGAACCGGAAGGG - Exonic
947602208 2:231460477-231460499 GCCAAGAAACAGAAAGTGGAAGG - Exonic
947608568 2:231507168-231507190 GCCAAAAAGCAGAAATTAGAAGG - Intergenic
948190081 2:236051640-236051662 CCCAAAGAGCAGAAGCAGGAAGG + Intronic
1168755178 20:311470-311492 CCCAAGTAGCAGAGACTACAGGG + Intergenic
1169056032 20:2621746-2621768 ACCAAAAAGGAGAAAATGGAAGG - Intronic
1169393845 20:5212735-5212757 CCCCAGAACCAAAAGCTGGAAGG - Intergenic
1169514246 20:6298887-6298909 CCCAAGACCCAGAAATTAGAAGG + Intergenic
1170059348 20:12243218-12243240 ACCAAGTACCAGAAACTAGACGG - Intergenic
1171317357 20:24206762-24206784 ACGAGGAAGCCGAAACTGGAGGG - Intergenic
1171748339 20:29022422-29022444 GCCAGGAAGCAGGAACTGGGTGG + Intergenic
1172042094 20:32052763-32052785 CCCAAGAAGGGGAACCTGGACGG - Intronic
1173314334 20:41930090-41930112 TCCAGGAAGCAGGAACTAGAGGG + Intergenic
1173386446 20:42592739-42592761 ACCAGGAAGCAGAAACTGACAGG - Intronic
1173403510 20:42745283-42745305 CGCCAGGTGCAGAAACTGGATGG - Intronic
1173472704 20:43336128-43336150 GCCAAGAAGCAGGGGCTGGAGGG - Intergenic
1173939737 20:46900249-46900271 CCAAAGAATGAGGAACTGGAGGG + Intronic
1174434730 20:50498065-50498087 GCCAAGAAGAAAAAACTGGGAGG - Intergenic
1175001638 20:55635513-55635535 ACAAACAAACAGAAACTGGAGGG - Intergenic
1175157864 20:56984704-56984726 CAAAAGAGGCAGAAACTGCAGGG + Intergenic
1175617635 20:60414795-60414817 CCTAAGAAGCAGAAACTGTGTGG - Intergenic
1175731356 20:61356241-61356263 CCCAAGAAACTGCATCTGGAAGG + Intronic
1176265203 20:64205572-64205594 GCCAAGAAGAGGAAGCTGGAGGG + Exonic
1176375506 21:6085220-6085242 CCACAGCAGCAGACACTGGACGG + Intergenic
1177071666 21:16517229-16517251 CCCAAGTAGCTGGAACTGCAAGG + Intergenic
1177126649 21:17201979-17202001 TCCAAGAAGCAAAAACTCAAAGG + Intergenic
1177932750 21:27305025-27305047 CCCAAGAAGCTATAACTGGATGG + Intergenic
1179187543 21:39096549-39096571 CCCCAGAGGAAGAAACTTGAGGG + Intergenic
1179747968 21:43453024-43453046 CCACAGCAGCAGACACTGGACGG - Intergenic
1184684307 22:46089202-46089224 CCCAGGCAGCAGGAGCTGGAAGG - Intronic
1185222902 22:49637882-49637904 GCCAAGAAGCAGAGCGTGGATGG + Intronic
949312086 3:2711309-2711331 CCCAGGAGGCAGAAACTGGCTGG - Intronic
949924570 3:9031163-9031185 CACAAAAGGCAGAAAGTGGAAGG - Intronic
950021347 3:9789848-9789870 CCCAAGAAGCAGAAACTGGAAGG - Exonic
950859251 3:16133014-16133036 TCCAAGAGGCAGAAGCTGGCTGG - Intergenic
951738469 3:25894194-25894216 TCCAAGGAGCAGAAAGAGGAAGG + Intergenic
951820101 3:26798601-26798623 CCCCAGAAGAAGAAAATGAAAGG - Intergenic
953134757 3:40172845-40172867 CCCAAGATGCAGTGAGTGGATGG - Intronic
953528139 3:43712606-43712628 CCCAAGAGGCTTAAACTAGAAGG + Intronic
953800519 3:46019276-46019298 CCCAAGAAGCATAAATCTGAAGG + Exonic
954109226 3:48424930-48424952 CCCAGGAAGCAGGGTCTGGATGG + Intronic
954636715 3:52074881-52074903 CCCAAGAAGCTGAAGACGGAAGG + Intergenic
954667341 3:52263509-52263531 TCCAGGAAGCTGAAACAGGATGG + Intronic
955039885 3:55305864-55305886 GCCAAGAAGGAGAAATTGGTAGG + Intergenic
956876067 3:73464562-73464584 AACAAGATACAGAAACTGGAAGG - Intronic
961484387 3:127206971-127206993 CCCAAGAGGCAGAGAGAGGAGGG - Intergenic
961494054 3:127277853-127277875 TCCAAGAAGCAGGAAGTAGAGGG - Intergenic
963528210 3:146440419-146440441 GCCAAGAAGCTCAAACTGGGTGG - Intronic
964466950 3:157004321-157004343 TACAGGAAGCAAAAACTGGATGG + Intronic
964502034 3:157358532-157358554 CCCCAGAAGCATTAAGTGGATGG + Intronic
964998675 3:162923604-162923626 CCCAAGAAGCTGGAACTACAGGG + Intergenic
965006355 3:163031223-163031245 ACCAACAAGCAGAAAAAGGAGGG - Intergenic
967540033 3:190656480-190656502 CCCAAGAGTCAGAAACTCAATGG + Exonic
967751882 3:193124491-193124513 CCCAAGAAGGAGAAATGGAAAGG + Intergenic
970497711 4:16643980-16644002 CTCAAGAAGCAGCACTTGGAAGG - Intronic
970573851 4:17408420-17408442 CCCAGCAAGCAGAAACTGGAGGG + Intergenic
970604403 4:17665899-17665921 ACTAAGAAGCAGCAACTGGGGGG - Intronic
970756342 4:19431071-19431093 CTCAAGAGATAGAAACTGGAGGG + Intergenic
970929554 4:21493583-21493605 TCCAAGCAGCAGAAACTCAAAGG - Intronic
975781988 4:77849347-77849369 CCCAAGAAGCTGGGACTGCAGGG + Intergenic
977170104 4:93751480-93751502 CCCAAGAACCAGAAACTGCCTGG - Intronic
977771697 4:100868448-100868470 GCCTAGAAGCACAAACTGGGTGG - Intronic
978187291 4:105871683-105871705 CCCAAGAAGCTGACACTGGGAGG + Intronic
979932643 4:126651027-126651049 CCCAAGAAGGACAAAGAGGAAGG + Intergenic
980942802 4:139290882-139290904 CCCAAGAGGCAGAGGCTGGGAGG - Intronic
982465159 4:155721460-155721482 CAGAGGAAGCAGAAAGTGGAAGG - Intronic
982836513 4:160125733-160125755 GCCAGGAAGCAGGAACTGGGTGG - Intergenic
982976796 4:162073532-162073554 CTCAAGAAGCAGAAAATTGTAGG + Intronic
983081141 4:163386944-163386966 CCAGAGAAGCAGAACCTGTAGGG + Intergenic
983319083 4:166172421-166172443 ACAAAAATGCAGAAACTGGAAGG - Intergenic
984344549 4:178505844-178505866 TCCACAATGCAGAAACTGGAAGG + Intergenic
984414985 4:179446615-179446637 ACAAAGAAGCACAAACTGGATGG + Intergenic
986952434 5:13105809-13105831 GCAGAGAAGTAGAAACTGGAAGG + Intergenic
989379329 5:40798131-40798153 GCCGAGAAGCAGAAACACGACGG - Exonic
989423524 5:41268982-41269004 CCCAAGCAGGAGAAACTGCTTGG - Intergenic
989516826 5:42353650-42353672 GCCAGGAAGCTCAAACTGGATGG + Intergenic
991354891 5:65758109-65758131 CCCAAGTAGCTGAAACTACAGGG - Intronic
992475115 5:77094432-77094454 CCCAAGTAGCAGAGACAGGCAGG + Intergenic
992632846 5:78698592-78698614 ACCACAAAGCAGACACTGGAGGG + Intronic
992661217 5:78962899-78962921 TCAAACAGGCAGAAACTGGAAGG + Intronic
992720525 5:79556672-79556694 CCTAGGAAGCAAAATCTGGAAGG - Intergenic
996275408 5:121660368-121660390 GCCAAGAAGCTCAAACTGGGCGG + Intergenic
996665086 5:126049745-126049767 GGCAAGAAGCATATACTGGAAGG + Intergenic
997891346 5:137679805-137679827 CCCAGGAAGCAGTATCTGGTGGG + Intronic
998465534 5:142341069-142341091 GACAAGAAGCAGAAACTGAGAGG + Intergenic
998549869 5:143067041-143067063 ACCAAGAAGCAGAAGCGGGAGGG - Intronic
999454508 5:151703704-151703726 CCCAAAAAGAAGCAACTGAAAGG + Intergenic
1000087574 5:157901411-157901433 CTCCTGAAGCAGAAACTGGAGGG + Intergenic
1000108168 5:158080468-158080490 CCCAAGAACCAGCAACTAAAGGG - Intergenic
1000939116 5:167338706-167338728 TCAAAGAAGCAGGAACTGGGTGG + Intronic
1001033107 5:168277094-168277116 CCCAAGAACCAGGACCTGGAAGG - Intergenic
1001231981 5:169996684-169996706 CCCAAGAAGCACAAACTCTGTGG + Intronic
1001445649 5:171780681-171780703 CCCAAGAGCCAGCAACTGCATGG + Intergenic
1002173679 5:177389372-177389394 CACAAGAAGCAGCAAGGGGAAGG - Intronic
1003100943 6:3176104-3176126 CCCAAGCAACGGAAACTGTAAGG + Intergenic
1004166011 6:13257087-13257109 CCCCAGAAGCAGAAGCTGCTAGG - Intronic
1004938375 6:20530153-20530175 CCCAAGTAGCTGAAACTACAGGG - Intergenic
1005369053 6:25111241-25111263 CCAAATAAGTAGAATCTGGAAGG + Intergenic
1005459440 6:26054531-26054553 CCCAAGAAAGAGAAAGGGGAGGG - Intergenic
1008596152 6:53043969-53043991 TCCAAGAAGCAGAAACTAAGAGG + Intronic
1009176038 6:60460871-60460893 TCCAGGAAGCTCAAACTGGATGG - Intergenic
1010281709 6:74030314-74030336 GCCAAGAAGCTCAAACTGGGTGG - Intergenic
1010298009 6:74222955-74222977 GCCCAGAAGCACGAACTGGATGG - Intergenic
1010377804 6:75193240-75193262 CCCAACATCTAGAAACTGGATGG + Intronic
1010672641 6:78704632-78704654 CCAAAGATGCAGAAACTGACAGG - Intergenic
1011135225 6:84092875-84092897 TCCAAAAAGGAGAAAATGGAAGG + Intergenic
1011616625 6:89203318-89203340 ACCAAGGATCAGAAAGTGGAGGG - Intronic
1012053920 6:94380754-94380776 CACATGAAGCAGAAACCTGAGGG - Intergenic
1012161666 6:95892068-95892090 AACAAGAACCACAAACTGGATGG + Intergenic
1012261156 6:97089218-97089240 CCAAAGTAGCAGAAACAAGAAGG + Intronic
1012649980 6:101740691-101740713 CACAAGAAGCAGAGGCTGGCTGG - Intronic
1015808681 6:137140001-137140023 CACCAGAAGCAGAAGCTGCACGG - Intergenic
1016523858 6:144977375-144977397 ACCGGGAAGCAGAAACTGGGTGG - Intergenic
1016811258 6:148263217-148263239 CCGAAGAAGCAGAAGGTGGCAGG + Intergenic
1017265887 6:152445517-152445539 TAAAAGAAGAAGAAACTGGAAGG - Intronic
1017702759 6:157091489-157091511 TCAAACAAGCAGAATCTGGAAGG + Intronic
1017828552 6:158102351-158102373 CCCAAGTAGCTGAAACTATAGGG + Intergenic
1019464175 7:1177506-1177528 CTCAGGAAGCAGAAGCAGGAGGG - Intergenic
1020685326 7:11286590-11286612 GACAAGGAGCAGAAATTGGATGG - Intergenic
1021406826 7:20277423-20277445 CCCAAGTAGCAGAAACAGCATGG - Intergenic
1021491837 7:21227373-21227395 CCCAAGAACACAAAACTGGAAGG + Intergenic
1022462039 7:30618507-30618529 CCCAAGTAGCTGAAACTACAGGG - Intronic
1022935900 7:35176077-35176099 CCCAAGAGGCAGAGGCTGCAGGG + Intergenic
1024594868 7:50923642-50923664 CACAAAAAGTAGAAACTGGATGG - Intergenic
1028172135 7:87610991-87611013 CCCAAGTAAGAGAAAATGGATGG - Intronic
1029810078 7:103038303-103038325 GCCAGGAAGCACAAACTGGGCGG + Intronic
1031931281 7:127688288-127688310 CCCAAAGAGCAGAAACTTAAGGG - Intronic
1032190265 7:129761210-129761232 CCCAAGAACTAAAAACTGGAGGG + Intergenic
1032315474 7:130834556-130834578 CCCATGAAGCAAATAATGGAAGG - Intergenic
1032529810 7:132610766-132610788 TCCAGGAGGCAGAAACTGGGAGG - Intronic
1032888362 7:136166446-136166468 CTCAAGAAGAAGGAAATGGAAGG + Intergenic
1035013156 7:155738849-155738871 CCCATGAAGCAGAAGCCGGTCGG - Intronic
1035636947 8:1154870-1154892 TCCAGGTAGCAGACACTGGAGGG - Intergenic
1036527485 8:9548593-9548615 CCCAAGTAGCTGGAACTGCAGGG + Intergenic
1038525205 8:28267342-28267364 CCCAAGAAGCAGGATCCGGATGG - Intergenic
1038625696 8:29190788-29190810 CCCAAGCGGCAGACACTGGCTGG - Intronic
1039347714 8:36726227-36726249 GCCAGGAAGCACAAACTGGGTGG + Intergenic
1040288336 8:46111705-46111727 CCCGAGAAGCAAAAACGGGATGG - Intergenic
1040295222 8:46145510-46145532 CCCCACAAGCAAAAACGGGATGG - Intergenic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1040736384 8:50513560-50513582 CCCAGGAAGCTCAAACTGGGTGG - Intronic
1041520668 8:58752452-58752474 CACCAGAAGGAGATACTGGAGGG - Intergenic
1042307070 8:67343495-67343517 CCCAAGAAGCCGTACCTCGAGGG + Exonic
1042458185 8:69029711-69029733 ACAAAGAACCACAAACTGGATGG - Intergenic
1042776780 8:72440731-72440753 CCCAAGTAGCTGAAACTACAGGG - Intergenic
1042990015 8:74628864-74628886 CCCAGGAAGCAGAAAATTGCTGG + Intronic
1044164778 8:88968062-88968084 CCCAAAAATGAGAAACAGGAAGG - Intergenic
1044440827 8:92221709-92221731 GCCAGGAAGCTCAAACTGGATGG - Intergenic
1045679794 8:104646373-104646395 CCCCAGAAGCAGAAGCTGCTAGG + Intronic
1047298959 8:123596587-123596609 CCCAGGACTTAGAAACTGGAGGG - Intergenic
1047562151 8:125998558-125998580 CTCAAGAAGAACAAACTGCAAGG - Intergenic
1047888025 8:129274451-129274473 CCCAAGAAGCAGAAAAAGGCAGG + Intergenic
1049793906 8:144487492-144487514 CCCAAGTAGCTGGAACTGCAGGG + Intronic
1050057440 9:1670519-1670541 CCCAACAAGCAGGAGCTTGAAGG + Intergenic
1050309601 9:4339770-4339792 CCAGAGAACCAGAAACTGTAGGG + Intronic
1050586998 9:7123388-7123410 CCAAAGAAACAGAACCTGTAGGG + Intergenic
1051626371 9:19103107-19103129 ACCAAGAATCAGAAACCCGAAGG - Exonic
1052582453 9:30375947-30375969 CCCAAGAAGAAGAAAGTTGGAGG + Intergenic
1052754991 9:32531840-32531862 ATCAAAAAGCAGAAACTGGAGGG - Intergenic
1053169599 9:35869199-35869221 CCCATGAAGGAGAGATTGGAGGG + Intergenic
1054722199 9:68615333-68615355 TGCAGGAGGCAGAAACTGGAGGG + Intergenic
1055182225 9:73402212-73402234 CCCAAGAAGAAGAAAATGGCTGG - Intergenic
1056095865 9:83252550-83252572 CCCAAGTAAAAGAAACTGAATGG + Intronic
1056958421 9:91101180-91101202 CCTAAGAACCCGCAACTGGAAGG + Intergenic
1057614484 9:96576555-96576577 CCCAGGATGCAGAGACTGCAGGG + Intronic
1058464346 9:105213077-105213099 AACAAGAAGCAGTCACTGGAGGG - Intergenic
1060322098 9:122571980-122572002 CCCCAGAATCAGAAACTGCAAGG - Intergenic
1060781724 9:126418034-126418056 GGCAAGAGGCAGAATCTGGAAGG + Intronic
1060946154 9:127570090-127570112 GTCAACAAGCAGAAAGTGGATGG - Intronic
1061682602 9:132250364-132250386 CCCAAGAAGCTGAGCCTGCAAGG + Intergenic
1062355177 9:136158484-136158506 CTCAAGAAACAGACCCTGGAGGG - Intergenic
1062657862 9:137613490-137613512 ACCAGGAAGCAGGAACTGGAAGG - Exonic
1203655169 Un_KI270752v1:16915-16937 CCAAAGAAGTAGAAACAGGGAGG - Intergenic
1185487694 X:495484-495506 CCCAAGTAGCTGGAACTGCAGGG + Intergenic
1186715970 X:12251681-12251703 CTCTAGAAGCAGACACTGAAAGG - Intronic
1186917496 X:14239204-14239226 TCCAGGTAGCAGAAACTGCAAGG - Intergenic
1187439475 X:19305162-19305184 TCCTAGAAGCAGAAACCGGTCGG - Intergenic
1187613956 X:20972904-20972926 CCAAAGAAGCAGAAAGTGATTGG - Intergenic
1187705396 X:22005103-22005125 CCCAGGAAGCTCAAACTGGGTGG - Intergenic
1188627249 X:32299896-32299918 CACAAAAAGCAGAAACTAGGAGG - Intronic
1188758042 X:33988120-33988142 ACGAAGATTCAGAAACTGGATGG + Intergenic
1189440251 X:41029587-41029609 CCCAGGAGGCAGAGACTGCAGGG - Intergenic
1189576563 X:42359800-42359822 CCATAGAGGCAGAGACTGGAGGG - Intergenic
1189764345 X:44354699-44354721 CAAAAGAAGCAGAAACTGGCCGG + Intergenic
1194333664 X:92617096-92617118 CCCAAAAATCAGAAACAGTAAGG - Intronic
1194353795 X:92855835-92855857 CCCAAGAAAAAGAAAATGGCTGG + Intergenic
1195464160 X:105161132-105161154 CTCAAGAAGCTGAAGCCGGAGGG + Intronic
1196065708 X:111462020-111462042 CTCTAGAAGCTGAAAATGGAAGG - Intergenic
1196724168 X:118881016-118881038 GCCAAAAAGTAGAAACTGGCTGG - Intergenic
1197257081 X:124274963-124274985 CCCAAGAGGCAGCAAGGGGAGGG + Intronic
1198677686 X:139148159-139148181 ACCAAGTAGGAGCAACTGGAAGG + Intronic
1199697687 X:150354678-150354700 TCCAAGAAGGAGGAATTGGAAGG - Intergenic
1200642347 Y:5736098-5736120 CCCAAAAATCAGAAACAGTAAGG - Intronic
1200662155 Y:5972907-5972929 CCCAAGAAAAAGAAAATGGCTGG + Intergenic
1200830053 Y:7680498-7680520 GCCAAGAAGGAGAAAAAGGATGG - Intergenic
1200979513 Y:9248796-9248818 TCCAAGAAGGAGAAAGAGGATGG + Intergenic
1201018244 Y:9625832-9625854 GCCAAGAAGAAGAAAGAGGACGG - Intergenic
1201062324 Y:10058717-10058739 TCCAAGAAGGAGAAAGAGGATGG - Intergenic
1201237486 Y:11924966-11924988 CCCAGGAAGCTGAAGCTGTAAGG + Intergenic
1201638594 Y:16153694-16153716 ACAAAGAGGCAGAGACTGGAAGG - Intergenic
1201952995 Y:19586100-19586122 GCCAGGAAGCTCAAACTGGATGG - Intergenic
1202161648 Y:21941027-21941049 GTCAAGAAGGAGAAACAGGATGG - Intergenic
1202174705 Y:22086483-22086505 CCCAGGAAGCTAAAACTGGGTGG + Intronic
1202216657 Y:22499899-22499921 CCCAGGAAGCTAAAACTGGGTGG - Intronic
1202229708 Y:22645346-22645368 GTCAAGAAGGAGAAACAGGATGG + Intergenic
1202313448 Y:23550819-23550841 GTCAAGAAGGAGAAACAGGATGG - Intergenic
1202326530 Y:23696169-23696191 CCCAGGAAGCTAAAACTGGGTGG + Intergenic
1202544240 Y:25973884-25973906 CCCAGGAAGCTAAAACTGGGTGG - Intergenic
1202557355 Y:26119776-26119798 GTCAAGAAGGAGAAACAGGATGG + Intergenic