ID: 950021695

View in Genome Browser
Species Human (GRCh38)
Location 3:9792390-9792412
Sequence CTCCTCGCTGCGGCCTCCTA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 186}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950021684_950021695 3 Left 950021684 3:9792364-9792386 CCTAGTGCGACCCCCGCCCCCTC 0: 1
1: 0
2: 2
3: 40
4: 1068
Right 950021695 3:9792390-9792412 CTCCTCGCTGCGGCCTCCTACGG 0: 1
1: 0
2: 2
3: 13
4: 186
950021687_950021695 -9 Left 950021687 3:9792376-9792398 CCCGCCCCCTCTACCTCCTCGCT 0: 1
1: 0
2: 1
3: 70
4: 712
Right 950021695 3:9792390-9792412 CTCCTCGCTGCGGCCTCCTACGG 0: 1
1: 0
2: 2
3: 13
4: 186
950021688_950021695 -10 Left 950021688 3:9792377-9792399 CCGCCCCCTCTACCTCCTCGCTG 0: 1
1: 0
2: 5
3: 64
4: 786
Right 950021695 3:9792390-9792412 CTCCTCGCTGCGGCCTCCTACGG 0: 1
1: 0
2: 2
3: 13
4: 186
950021685_950021695 -7 Left 950021685 3:9792374-9792396 CCCCCGCCCCCTCTACCTCCTCG 0: 1
1: 0
2: 4
3: 161
4: 2140
Right 950021695 3:9792390-9792412 CTCCTCGCTGCGGCCTCCTACGG 0: 1
1: 0
2: 2
3: 13
4: 186
950021686_950021695 -8 Left 950021686 3:9792375-9792397 CCCCGCCCCCTCTACCTCCTCGC 0: 1
1: 0
2: 2
3: 62
4: 674
Right 950021695 3:9792390-9792412 CTCCTCGCTGCGGCCTCCTACGG 0: 1
1: 0
2: 2
3: 13
4: 186
950021682_950021695 22 Left 950021682 3:9792345-9792367 CCTCGTTCTCTAGGGACACCCTA 0: 1
1: 0
2: 0
3: 5
4: 72
Right 950021695 3:9792390-9792412 CTCCTCGCTGCGGCCTCCTACGG 0: 1
1: 0
2: 2
3: 13
4: 186
950021683_950021695 4 Left 950021683 3:9792363-9792385 CCCTAGTGCGACCCCCGCCCCCT 0: 1
1: 0
2: 1
3: 20
4: 154
Right 950021695 3:9792390-9792412 CTCCTCGCTGCGGCCTCCTACGG 0: 1
1: 0
2: 2
3: 13
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950021695 Original CRISPR CTCCTCGCTGCGGCCTCCTA CGG Exonic
900901707 1:5521111-5521133 CTCCTCCCTGCGTCCTCATATGG + Intergenic
901068629 1:6506425-6506447 CTCCTCGGTGGGGGCTCCGAGGG - Intronic
901295753 1:8159705-8159727 CTTCTTGCTGCGTCCTCATACGG + Intergenic
901397399 1:8991426-8991448 CCACTCGCTTCGGCCTCCCAAGG + Intergenic
902252442 1:15163194-15163216 CTCCTCCCTGCTGCCTAATAAGG - Intronic
904472202 1:30742838-30742860 CTCCTCACAGTAGCCTCCTAAGG - Intronic
904679525 1:32219299-32219321 CTCCATGCTGGGGCCTCCCAGGG - Intronic
905364162 1:37439745-37439767 CTTCTCGCTGTGTCCTCATATGG + Intergenic
905704559 1:40045025-40045047 CTGCTCGCCTCGGCCTCCCAAGG + Intronic
907080949 1:51621256-51621278 CTCCCCGCCTCGGCCTCCCAAGG - Intronic
917565014 1:176204678-176204700 CTGCTCGCCTCGGCCTCCCAAGG - Intronic
922466023 1:225845970-225845992 CTCCTCCCTGCTGCCTCCAGGGG - Exonic
924136357 1:240971176-240971198 CTTCTCGCTGTGGCCTCACATGG - Intronic
1063668665 10:8082174-8082196 CTCCCCCCTGGAGCCTCCTACGG - Intergenic
1066107140 10:32166087-32166109 CTCTTCGCTGCTGCCTCTCAGGG - Intergenic
1067171662 10:43911999-43912021 CTTCTCACTGTGGCCTCATATGG + Intergenic
1067458498 10:46440448-46440470 CTTCTTGCTGTGTCCTCCTATGG - Intergenic
1067628700 10:47944187-47944209 CTTCTTGCTGTGTCCTCCTATGG + Intergenic
1068008838 10:51422326-51422348 CACCTAGCTGTGGCATCCTATGG - Intronic
1069681348 10:70287852-70287874 CTGCTCGCTGTGGCCTCATATGG - Intergenic
1073703653 10:105958256-105958278 CTCCTCACTGCTGCCTTTTAGGG + Intergenic
1076307904 10:129477608-129477630 CTCCTCGCTGTGTCCTCACACGG - Intronic
1076539301 10:131204113-131204135 CTCCTTGCTGTGTCCTCCCATGG - Intronic
1076715288 10:132360936-132360958 CTGCTCGCTGCTGCCTCCAGTGG - Intronic
1076900850 10:133336606-133336628 CTCCTCCCTCGGGCCTCCTCTGG - Intronic
1076999622 11:316090-316112 CTCCTCGCCGCGGACTCCTCGGG + Intergenic
1079099669 11:17533371-17533393 CTCCTCCCTGAGGTCTGCTATGG - Intronic
1079388102 11:19998529-19998551 CTCCTTGCCGTGGCCTCCAAGGG + Intronic
1082857608 11:57822602-57822624 TTCCTTGCTGCGCCCTTCTATGG - Intergenic
1083890400 11:65592942-65592964 CTCCTGGCTGCTTCCTCCTCAGG + Exonic
1084267335 11:68011805-68011827 CTCCTCCCTGAGCCCTCCTCTGG + Intronic
1086419249 11:86622035-86622057 CTCCTCGCTGAGGCCTGATGAGG - Intronic
1087492572 11:98846799-98846821 CTGCCCACTTCGGCCTCCTAAGG + Intergenic
1088037279 11:105333232-105333254 CTCCTCGCTGGGTCCTCACATGG - Intergenic
1088665190 11:112086945-112086967 CCCCTCACCTCGGCCTCCTAGGG - Exonic
1088922411 11:114270661-114270683 CTTCTCACTGTGTCCTCCTATGG + Intronic
1091177710 11:133576557-133576579 CAGCTCGCTGGCGCCTCCTAGGG - Intergenic
1098150066 12:67537534-67537556 CTCCTCCCTGCGTCCTCACATGG + Intergenic
1100267420 12:92990695-92990717 CTTCTCGCTGTGTCCTCATATGG + Intergenic
1101727758 12:107402431-107402453 CTCCTGACAGCTGCCTCCTAGGG + Intronic
1102823041 12:115924239-115924261 CTCCTCCCTGCGGCCTCCTGTGG - Intergenic
1108249319 13:48549274-48549296 CTTCTTGCTGTGTCCTCCTATGG - Intergenic
1108477837 13:50838877-50838899 CTTCTCGCTGCGTCCTCACATGG - Intronic
1110074864 13:71227598-71227620 CTCCTCGCTGCTGTCATCTAGGG + Intergenic
1113421127 13:110172151-110172173 CTCCTGGCTGCGGCCACCTGTGG + Intronic
1113961516 13:114128790-114128812 CTCCCCGCTGGGGCTTCCTGTGG - Intronic
1120634071 14:86929514-86929536 CTCCTCACTGCATCCTCATATGG + Intergenic
1122615113 14:103011870-103011892 CTCCCCGCCTCGGCCTCCCAAGG - Intronic
1124395957 15:29301840-29301862 CTCCTCGCTGTGTCCTCACATGG - Intronic
1126032334 15:44511623-44511645 CTCCCCGCCTCGGCCTCCCAGGG - Intronic
1127388310 15:58485205-58485227 CTCCTTGCTGCTGCCTCCCCCGG - Intronic
1128173087 15:65530341-65530363 CAGCTCGCCGCGGCCGCCTAGGG - Intergenic
1131108640 15:89750797-89750819 CTCCTCGCTGAGGCCTAGCACGG + Exonic
1132301624 15:100779647-100779669 TCCCTCTCTGAGGCCTCCTAAGG - Intergenic
1132814336 16:1818633-1818655 TTCATGGCTGCGGCCTTCTAAGG - Intronic
1133070663 16:3244610-3244632 CCCCTCGCTCCGGCCTTCTCTGG - Intronic
1134490615 16:14693216-14693238 CTGCCCGCTGCAGCCTCCTCGGG + Intronic
1134495996 16:14732333-14732355 CTGCCCGCTGCAGCCTCCTCGGG + Intronic
1135374668 16:21935050-21935072 CTGCCCGCTGCAGCCTCCTCGGG + Intergenic
1136112224 16:28070891-28070913 CTTCCCTCTGCTGCCTCCTAGGG + Intergenic
1136154800 16:28375473-28375495 CTGCCCGCTGCAGCCTCCTCGGG - Intergenic
1136208292 16:28739785-28739807 CTGCCCGCTGCAGCCTCCTCGGG + Intergenic
1136264377 16:29106422-29106444 CTGCCCGCTGCAGCCTCCTTGGG + Intergenic
1140927660 16:79599435-79599457 CTCCTCGCCGCTGCCGCCCAAGG + Exonic
1141023712 16:80523069-80523091 CTACTCACTGCGTCCTCATATGG + Intergenic
1142410273 16:89912489-89912511 CTCGTGTCTGCTGCCTCCTAAGG - Intronic
1142642555 17:1292878-1292900 CTCCGCGCTGCTGCGTCCTGGGG + Intronic
1144342031 17:14318079-14318101 CCCCTCCCTGCTGCCTCCTTGGG + Intronic
1144814655 17:18025533-18025555 CTCCTCCCTGTGCCCTACTAGGG - Intronic
1149599098 17:57881794-57881816 CTCCTCTGTGCAGCCTCCCAGGG + Intronic
1151629928 17:75303577-75303599 CTCCCCGCCTCGGCCTCCCACGG + Intergenic
1152348425 17:79769146-79769168 CTTCTCCCTGCGTCCTCATAGGG - Intergenic
1153776621 18:8459827-8459849 CTGCTCGCCTTGGCCTCCTAAGG - Intergenic
1153967018 18:10191285-10191307 CTCCTCCCTGTGTCCTCCCATGG - Intergenic
1154438987 18:14370203-14370225 CTTCTCGCTGCGTCCTCACATGG - Intergenic
1156461607 18:37324409-37324431 CTTCTCGCTGTGTCCTCCTATGG - Intronic
1156836719 18:41563774-41563796 CTCCTAGCTGCAGCATCCTTGGG - Intergenic
1157672121 18:49539559-49539581 CCACTCACTGCAGCCTCCTAAGG + Intergenic
1159554111 18:69927176-69927198 CTTCTTGCTGCGTCCTCATATGG - Intronic
1160745259 19:708563-708585 CTCCTCGCAGCGGCCTCCCCAGG + Intergenic
1161319618 19:3634866-3634888 CTCCGCGATGCGGCCTCGCAGGG - Intronic
1161738824 19:6007914-6007936 CTCCTCTCTGTGGCCTCCCTTGG - Intronic
1161804449 19:6434410-6434432 CTTCTTGCTGCGTCCTCCCATGG - Intergenic
1161919872 19:7258067-7258089 CTGCCCGCTTCGGCCTCCCAAGG + Intronic
1162046298 19:8002544-8002566 CGCCTCGCTACTGCCACCTAGGG + Intronic
1164781969 19:30900040-30900062 CTCCTGGCTGTGTCCTCATATGG - Intergenic
1165242858 19:34481707-34481729 CTCCTCGCCGCGGCCTCGCGCGG - Exonic
1166982325 19:46638761-46638783 CTCCTCCCTGCGGCCTCTCGGGG - Intergenic
1167226191 19:48242264-48242286 CTTCTTGCTGCGCCCTCCCACGG - Intronic
1168322128 19:55517047-55517069 CTCCTCCCTACGTCCTCCGATGG - Intronic
1168401034 19:56086562-56086584 ACCCTCACTGCGGCCTCCCAAGG + Intergenic
926058548 2:9790816-9790838 GTCCTCGCTGCAGCCTCATCTGG - Intergenic
927138974 2:20117211-20117233 CTCCTCGCTGTGCCCTCCTATGG - Intergenic
928361384 2:30664795-30664817 CTCCTCGCTGTGTCCTCACATGG - Intergenic
928444976 2:31325822-31325844 CTCCTGGCCTTGGCCTCCTAAGG - Intergenic
929116230 2:38446645-38446667 CTCCTCTCTGTGGCCTCCTGGGG + Intergenic
930851752 2:55968484-55968506 CTCCTCGCTGTGTCCTCACATGG - Intergenic
933745519 2:85568065-85568087 CTCCTCGCCTCAGCCTCCTGAGG + Intronic
934753154 2:96807250-96807272 CTGCCCGCATCGGCCTCCTAAGG + Intronic
937503687 2:122512118-122512140 CTCCTCACTCTGGCCACCTATGG - Intergenic
938080449 2:128367305-128367327 CTCCTCGCTGCAGCCCCCCTCGG + Intergenic
938792924 2:134692615-134692637 CTCCTCACTGCGTCCTCACACGG + Intronic
941449675 2:165644980-165645002 CTCCTTGCTGTGTCCTCATATGG + Intronic
941482538 2:166034860-166034882 CTCCTTGCTGCGTCCTCACATGG - Intronic
944051096 2:195470776-195470798 CTCCTCACTGTGTCCTCATATGG - Intergenic
945316864 2:208378623-208378645 CTTCTCGCTGTGTCCTCATAGGG - Intronic
948120028 2:235523106-235523128 CTTCTCGCTGTGGCCTCTCATGG + Intronic
948852847 2:240716825-240716847 CTCCTCACTGCGGCCTTCCAAGG + Exonic
1170595964 20:17806134-17806156 CTCCCTGCTTCGGCCTCCCATGG - Intergenic
1175261047 20:57674299-57674321 CTCCTGGCTGCGTCCTCACATGG - Intronic
1175551918 20:59822877-59822899 CTCCTCCCTGTGGCTTCCCAGGG - Intronic
1175593916 20:60215217-60215239 CTCCTCGCTGCTCCGTCCTCGGG - Intergenic
1175726386 20:61321296-61321318 CTCCTCCCTCTGCCCTCCTAAGG - Intronic
1175972990 20:62696558-62696580 CTCCTTGCTGCGGCCTTGTGAGG + Intergenic
1176245806 20:64096002-64096024 CTCCCCACTGCTGACTCCTAAGG + Intronic
1176378279 21:6097882-6097904 CTTCTTGCTGCGGCATCCCAAGG + Intergenic
1176722210 21:10402078-10402100 CTCCTCTCTGAGTCCTCCCAGGG + Intergenic
1179745193 21:43440365-43440387 CTTCTTGCTGCGGCATCCCAAGG - Intergenic
1180177708 21:46098411-46098433 CACCTCCCCGCGGCCTCCTCTGG + Intronic
1180303395 22:11054840-11054862 CTCCTCTCTGAGTCCTCCCATGG + Intergenic
1183489138 22:38107523-38107545 CTCCTCACTGCAGCCTCCCAGGG - Intronic
1184966020 22:47972896-47972918 CTCCTGGCTGCGTCCTCATGTGG + Intergenic
949517474 3:4820818-4820840 ATCCCTGCTGCGGACTCCTAAGG + Intronic
949527928 3:4923822-4923844 CTGCTCACCTCGGCCTCCTAAGG - Intergenic
950021695 3:9792390-9792412 CTCCTCGCTGCGGCCTCCTACGG + Exonic
956282253 3:67570110-67570132 CTCCTTGCTGTGTCCTCTTACGG - Intronic
959072560 3:101716333-101716355 CTGCTCGCCTCGGCCTCCCAAGG - Intergenic
960593120 3:119384533-119384555 CTTCTTTCTGCGTCCTCCTATGG + Intronic
960614548 3:119584864-119584886 CTCCTCGCTGTGTCCTCACATGG + Intronic
960703066 3:120455939-120455961 CTCCTCCCTGTGTCCTCATATGG + Intergenic
964752921 3:160068724-160068746 CTCCTCGCTGAGTCCTCACAAGG - Intergenic
965708943 3:171537136-171537158 CTCCTTGCTGTGTCCTCATATGG + Intergenic
966890328 3:184402916-184402938 CTGCCCGCTGTGGCCTCCCAAGG + Intronic
968481086 4:833408-833430 CCCCTTGCTGCGGCCTCATGTGG + Intergenic
968603012 4:1519352-1519374 CAGCTCCCTGCAGCCTCCTACGG + Intergenic
968979826 4:3841238-3841260 CTCCACGCTGCTGCCTCAGAAGG + Intergenic
969079818 4:4609698-4609720 CTTCTCGCTGTGTCCTCCCATGG - Intergenic
969431419 4:7157012-7157034 ATGCTCCCTGCGGCCTCCTGAGG + Intergenic
969593824 4:8137010-8137032 CTTCTCACTGTGTCCTCCTATGG - Intronic
969600656 4:8174111-8174133 CTCCTGGCTGTGGCCTCCCCCGG + Intergenic
970698656 4:18709224-18709246 CTTCTCACTGTGTCCTCCTATGG - Intergenic
973286269 4:48420258-48420280 CTCCTCACCTGGGCCTCCTATGG + Exonic
980028633 4:127797842-127797864 CTGCTCGCCTCGGCCTCCCAAGG + Intronic
982115336 4:152094242-152094264 CTCCTCGCTGTGTCCTCACATGG - Intergenic
982243012 4:153319483-153319505 TTGCCCGCTGCGGCCTCCCAAGG - Intronic
984389368 4:179109433-179109455 CTCCTCGCTGCATCATCCCATGG - Intergenic
984607781 4:181804984-181805006 CTCCTCCATCCAGCCTCCTATGG + Intergenic
986216018 5:5719946-5719968 CTCCTCGCCGTGTCCTCCCACGG + Intergenic
988337704 5:29927810-29927832 CTTCTCACTGCGTCCTCCCATGG + Intergenic
988710750 5:33772098-33772120 ATCCTCTCTGCGGCCTCCCAAGG + Intronic
993334102 5:86635275-86635297 CTGCTCACTTCGGCCTCCCAAGG - Intergenic
998020048 5:138761862-138761884 CCCCTCACCGCAGCCTCCTATGG + Intronic
1000908547 5:166993401-166993423 CTCCTAGGTGCAGCTTCCTACGG - Intergenic
1001253285 5:170165047-170165069 CTCCTCCCTCCCGCCTCCTCTGG - Intergenic
1002095173 5:176826350-176826372 CTGCTCCCTGCGCCCTCCCATGG - Intronic
1002566521 5:180115255-180115277 CTGCTCGCCTCGGCCTCCCAAGG + Intronic
1009324456 6:62332637-62332659 CTCCTCTCTGCATCCTCATATGG - Intergenic
1009467730 6:63993024-63993046 CTCCTTCCTGCGGCCTTGTAAGG - Intronic
1012767441 6:103386729-103386751 CTCCTCTGTGCAGCCTCCTTGGG + Intergenic
1013252269 6:108346075-108346097 CCCCTCGCTGTGGGCTACTATGG + Intronic
1013803391 6:113971161-113971183 CACCTCCCTGCGGCCTCCTGAGG - Exonic
1016508642 6:144814247-144814269 CTTCTCACTGCGTCCTCCCATGG - Intronic
1018149807 6:160927008-160927030 CTCCTCGCTGCACCCTCACATGG - Intergenic
1018696807 6:166397093-166397115 CTTCTCACTGTGTCCTCCTATGG - Intergenic
1019735675 7:2648783-2648805 CTCCTCGCTCAGGTCTCCTTGGG - Intronic
1023983255 7:45081649-45081671 CTCCTCACTGCCGCCTGCTGGGG + Exonic
1024132069 7:46363224-46363246 CTCCTCACTGCATCCTCATATGG + Intergenic
1025049668 7:55723720-55723742 CTTCTCACTGCGGTCTCCTGAGG - Intergenic
1025693866 7:63765140-63765162 TTCCTCGCCGTGGCCTCCTCGGG + Intergenic
1025924686 7:65947930-65947952 CTGCTCGCCTCGGCCTCCCAAGG + Intronic
1025976839 7:66376954-66376976 TGCCTCGCTGCGGCCTCTTGAGG - Intronic
1026045637 7:66903957-66903979 TGCCTCGCCGCGGCCTCCTGAGG + Intergenic
1026992569 7:74595628-74595650 CTCCACGCTGGGGCCTCCCCAGG + Intronic
1028773991 7:94657948-94657970 CTTCTAGATGCGGCCTCCTCAGG + Intronic
1032021008 7:128407108-128407130 CTCCTCCCTGTGTCCTCCTGTGG + Intronic
1032383420 7:131505905-131505927 CTCCTCGTGGCGGCCCTCTATGG - Exonic
1033684215 7:143623920-143623942 CTCATTGCTGCCTCCTCCTACGG + Intronic
1033687391 7:143703139-143703161 CTCATTGCTGCCTCCTCCTACGG + Exonic
1033700397 7:143833703-143833725 CTCATTGCTGCCTCCTCCTACGG - Intergenic
1033704844 7:143876445-143876467 CTCATTGCTGCCTCCTCCTATGG - Exonic
1034530572 7:151693763-151693785 CTCCTGGCTGCGTCCTCACATGG - Intronic
1037755241 8:21706124-21706146 CTCCTCCCTGCAGCTTCCCAGGG + Intronic
1038801141 8:30750226-30750248 CTGCTCGCCTCGGCCTCCCAAGG - Intronic
1040542651 8:48373831-48373853 CTTCTTGCTGGGTCCTCCTATGG + Intergenic
1041750570 8:61256269-61256291 CTGCCCGCTTCGGCCTCCCAAGG - Intronic
1042877063 8:73449316-73449338 CTTCTGGCTGCGTCCTCCCAGGG + Intronic
1045407622 8:101882396-101882418 CTTCTCGCTGTATCCTCCTATGG - Intronic
1047111486 8:121794084-121794106 CTCCTCTCTGGGGCCTCAGAGGG - Intergenic
1049793611 8:144485132-144485154 CTCCTCACTATGGCTTCCTAAGG - Intronic
1053034875 9:34816577-34816599 CTTCTCGCTGTGTCCTCCCATGG + Intergenic
1053050740 9:34958653-34958675 CTCCACGCTGGGGCTCCCTATGG - Intronic
1053489362 9:38487728-38487750 ATCCTCGCTGCGGGCACCAAGGG + Intergenic
1057294123 9:93825570-93825592 CTCCTCTCTGCAGCATCCTAGGG - Intergenic
1057669709 9:97077048-97077070 ATCCTCGCTGCGGGCACCAAGGG + Intergenic
1062213945 9:135378959-135378981 CTCCCAGAGGCGGCCTCCTACGG + Intergenic
1186285771 X:8042509-8042531 CTCCTCAATGCAGCCTCCTAAGG - Intergenic
1190155749 X:47991245-47991267 CTTCTCGCTGTGGCCTCACATGG - Intronic
1194633245 X:96312384-96312406 CTCCTCGCTGTGTCATCCCATGG + Intergenic
1195636262 X:107118834-107118856 CTCCGCGCGGCGGACTTCTAAGG + Intergenic
1195973343 X:110498173-110498195 CTTCTCGCTGTGTCCTCCCATGG + Intergenic
1199900639 X:152168634-152168656 CTCCTCCCTGCAGCCTCTGAAGG - Intronic
1200166524 X:154039370-154039392 CTGCTCACCTCGGCCTCCTAAGG - Intronic