ID: 950023674

View in Genome Browser
Species Human (GRCh38)
Location 3:9806577-9806599
Sequence TATACGTTATTGGTTGCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 83}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950023666_950023674 10 Left 950023666 3:9806544-9806566 CCACCTCCAGTGGCTGTGACTGG 0: 1
1: 1
2: 1
3: 25
4: 326
Right 950023674 3:9806577-9806599 TATACGTTATTGGTTGCTGTGGG 0: 1
1: 0
2: 0
3: 8
4: 83
950023665_950023674 13 Left 950023665 3:9806541-9806563 CCTCCACCTCCAGTGGCTGTGAC 0: 1
1: 0
2: 3
3: 39
4: 447
Right 950023674 3:9806577-9806599 TATACGTTATTGGTTGCTGTGGG 0: 1
1: 0
2: 0
3: 8
4: 83
950023668_950023674 7 Left 950023668 3:9806547-9806569 CCTCCAGTGGCTGTGACTGGTCC 0: 1
1: 1
2: 0
3: 18
4: 163
Right 950023674 3:9806577-9806599 TATACGTTATTGGTTGCTGTGGG 0: 1
1: 0
2: 0
3: 8
4: 83
950023669_950023674 4 Left 950023669 3:9806550-9806572 CCAGTGGCTGTGACTGGTCCCAG 0: 1
1: 0
2: 0
3: 21
4: 222
Right 950023674 3:9806577-9806599 TATACGTTATTGGTTGCTGTGGG 0: 1
1: 0
2: 0
3: 8
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950023674 Original CRISPR TATACGTTATTGGTTGCTGT GGG Intronic
903407241 1:23108150-23108172 AATATTTTATTGGTTGGTGTTGG - Intronic
909171692 1:72303652-72303674 TATACTTGTTTGGTTTCTGTGGG + Intergenic
909452609 1:75815169-75815191 GATATGATATTGGTAGCTGTGGG - Intronic
909998373 1:82309663-82309685 TATACTTTATTGCTTGCTGAGGG + Intergenic
911178098 1:94837472-94837494 TTTAGGTTTTTGGTTTCTGTGGG + Intronic
912056148 1:105600626-105600648 TTTACCTTATTGATTGCTGAAGG + Intergenic
916092715 1:161320719-161320741 CCTACCTTATTGGTTGCTGAGGG - Intronic
917051322 1:170927433-170927455 TATACGTTAGTAGATGCTATAGG + Intergenic
921970954 1:221148654-221148676 TATAAGCTTTTGATTGCTGTGGG + Intergenic
922037461 1:221863174-221863196 TAGACGTTCTTGGATGGTGTCGG + Intergenic
922144506 1:222926101-222926123 TGTAGGTTAGTGGTTGCTGGGGG - Intronic
1063441481 10:6076816-6076838 TATAAGTTATTGTTTGATCTTGG - Intergenic
1070677963 10:78426517-78426539 TATACGTATTTTGTTGTTGTTGG + Intergenic
1071088078 10:81887396-81887418 TATAACTTATTGATTTCTGTTGG - Intronic
1074677067 10:115863358-115863380 TATATATTTTTGGTTGCTTTTGG - Intronic
1074913249 10:117931453-117931475 TAAACATTACTCGTTGCTGTGGG - Intergenic
1081116996 11:39215197-39215219 TGTATGTTATAGGTTGCTATGGG + Intergenic
1084964731 11:72738679-72738701 TGTATGTTCTTGGTTCCTGTTGG - Intronic
1087399495 11:97647034-97647056 TATATGTTTTTGGTTTATGTAGG - Intergenic
1087605300 11:100370288-100370310 AAAAAGTTATTGGTTCCTGTTGG - Intergenic
1090588441 11:128238458-128238480 TATACATTAATAGTTACTGTGGG - Intergenic
1090592305 11:128285288-128285310 TATTAGTTATTGATTGCTATGGG - Intergenic
1091047208 11:132335218-132335240 TATATCTGATTGGTTGCTGTCGG - Exonic
1093304414 12:17495669-17495691 TGTACATTTTTGGTTTCTGTTGG + Intergenic
1094626301 12:32127577-32127599 TATAAGTTCTTGGTAGCTGATGG + Intronic
1097522293 12:60684730-60684752 TATATGTAATTGGTTGCCTTAGG + Intergenic
1102123485 12:110461795-110461817 TATCTGTTATTGATTGCTGAGGG - Intronic
1107063170 13:36183428-36183450 TATTTTTTATTGGTTGCTCTAGG - Intronic
1110435918 13:75478341-75478363 TATACTTTATTGTTTGATATGGG - Intronic
1111356017 13:87103404-87103426 TATACATTAATAGTTGCTGTAGG + Intergenic
1111750567 13:92326439-92326461 TATATGTATTTGTTTGCTGTTGG + Intronic
1111845490 13:93503296-93503318 CACAAGTTATTTGTTGCTGTGGG + Intronic
1114250655 14:20957313-20957335 TACTCGTTATAGGTTGGTGTCGG - Intergenic
1116716587 14:48434396-48434418 TATACGCCATTGTTTTCTGTGGG + Intergenic
1120579557 14:86229195-86229217 GAGACGTTATTGTTTTCTGTAGG + Intergenic
1136015079 16:27392159-27392181 TATACGTTATAGGTTTTTGTTGG - Intergenic
1140954046 16:79846130-79846152 TAAACTTTATTGTTTACTGTGGG - Intergenic
1148649386 17:49238789-49238811 TTCTTGTTATTGGTTGCTGTGGG + Intergenic
1150538772 17:66075402-66075424 TTTTCTTTATTGGTTGCTTTTGG - Intronic
1153566085 18:6418947-6418969 TATTCGGTATTGGTTGTAGTGGG - Intergenic
1156014277 18:32530411-32530433 CATGCTTTATTAGTTGCTGTAGG + Intergenic
1165221423 19:34319858-34319880 TTTAGGTTGTGGGTTGCTGTTGG - Intronic
940705018 2:157093856-157093878 TATTGTTTAGTGGTTGCTGTAGG + Intergenic
945585059 2:211651192-211651214 AATACCTTATTGCTTGCTCTAGG + Intronic
945919257 2:215738676-215738698 TTTAAGTTATTAGTTGCTTTGGG - Intergenic
1172376292 20:34443680-34443702 TTTACGTTGTTAGTTGCTGCCGG + Intronic
1173481244 20:43401308-43401330 TAAAGTTTATTGGTTGCTATTGG - Intergenic
1175805883 20:61829179-61829201 AGTACGTTATTGGCTGCTGGGGG - Intronic
1177203836 21:17988345-17988367 TATTGGTTATTGTTTCCTGTGGG + Intronic
950023674 3:9806577-9806599 TATACGTTATTGGTTGCTGTGGG + Intronic
951047021 3:18051270-18051292 TATACCTTATTGGTTACTAAAGG + Intronic
957688208 3:83532094-83532116 TATACTTTATTAATTACTGTAGG + Intergenic
961178231 3:124853698-124853720 TACAGGTAATTGGTTGCTTTTGG - Intronic
961967168 3:130917701-130917723 TATACATTATTGTTGGCTATAGG + Intronic
963287774 3:143452384-143452406 AATACATTAATTGTTGCTGTGGG + Intronic
965635889 3:170780080-170780102 GATATGTTCTGGGTTGCTGTAGG + Intronic
973537987 4:51904072-51904094 TTTAGGTATTTGGTTGCTGTGGG + Intronic
976121998 4:81793617-81793639 TATCAGATATCGGTTGCTGTGGG + Intronic
977882247 4:102218332-102218354 TCTACCTTATAGTTTGCTGTTGG + Intergenic
978475315 4:109121779-109121801 TATAAGTTTTTGGTTCCTTTCGG - Intronic
979073040 4:116235494-116235516 TATACATTATAGTTTGCTTTGGG - Intergenic
979155788 4:117388461-117388483 TATACGTTGATGGTAGCTGTTGG + Intergenic
980576068 4:134684426-134684448 GTTACGTTATTGGTTTGTGTAGG + Intergenic
981989953 4:150906692-150906714 TATTTGTTATTGGTTGTTTTTGG - Intronic
994864621 5:105251044-105251066 TATACTATTTTGGTTACTGTAGG - Intergenic
995891402 5:116956265-116956287 TTTAAATGATTGGTTGCTGTTGG - Intergenic
995978931 5:118078352-118078374 TATACGTGATTGGTTTGTGCTGG + Intergenic
996963218 5:129276337-129276359 TATACCATATTGGTTTGTGTAGG + Intergenic
1010374962 6:75157212-75157234 TGTAGGTTATTTGTGGCTGTTGG - Intronic
1012463505 6:99491009-99491031 TAAATGTTATTGGTTGTTATTGG + Intronic
1015264163 6:131273495-131273517 TTTACGTTAGTGGTTACTGTAGG + Intronic
1019877200 7:3824372-3824394 GATACATTTTTGCTTGCTGTCGG + Intronic
1021581353 7:22157208-22157230 TATACCTTATAGGTTAATGTTGG - Intronic
1029967387 7:104754336-104754358 TATACGTTAATGGTTGCCTATGG + Intronic
1030340029 7:108367466-108367488 AATATGTTAGTGGTTGCTTTAGG - Intronic
1031700507 7:124919143-124919165 TATACGGTATTGAATACTGTAGG + Intronic
1033289169 7:140067738-140067760 TATTGGTTATTGGTTGCACTAGG - Intergenic
1033298820 7:140166954-140166976 TGTTGGTTATTGTTTGCTGTTGG - Intronic
1040600115 8:48874592-48874614 TTTTCCTTAGTGGTTGCTGTAGG - Intergenic
1044906643 8:97011283-97011305 TATATGTGTTTGGTTGGTGTGGG - Intronic
1045169499 8:99648539-99648561 TATATTTTAGTGGTTGCTCTGGG + Intronic
1045216318 8:100152199-100152221 TATACGGTCTAGGTTTCTGTAGG - Intronic
1045288659 8:100813138-100813160 TAGACGTTACTGCTTGCTGTAGG - Intergenic
1046573406 8:115994871-115994893 TAGACATGATGGGTTGCTGTAGG + Intergenic
1050752218 9:8953090-8953112 TATATGCTTTTGGTTACTGTAGG + Intronic
1057101034 9:92360172-92360194 TATTTTTTATTGGCTGCTGTGGG + Intronic
1058013180 9:100000555-100000577 TATTTGTTATTGGTTGCTATTGG + Intronic
1187255317 X:17636637-17636659 TACACGGTGTTGGTAGCTGTTGG - Intronic
1197235866 X:124062057-124062079 TATACTTTTTTAGTTGCTGCAGG + Intronic
1198256292 X:134926761-134926783 TAGAAGTTTTTGGTTGCTGAGGG - Intergenic
1198406816 X:136321352-136321374 TACATGTTATTGTTTGCTTTTGG + Intronic
1198567423 X:137918592-137918614 CATACCGTATTGGATGCTGTGGG + Intergenic