ID: 950024510

View in Genome Browser
Species Human (GRCh38)
Location 3:9810938-9810960
Sequence TTGGCTCCCTGGAACTCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 155}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950024510_950024518 12 Left 950024510 3:9810938-9810960 CCTGGTGAGTTCCAGGGAGCCAA 0: 1
1: 0
2: 1
3: 13
4: 155
Right 950024518 3:9810973-9810995 CTTTCGGTCTTGATCTCGGTTGG 0: 1
1: 0
2: 0
3: 8
4: 107
950024510_950024519 13 Left 950024510 3:9810938-9810960 CCTGGTGAGTTCCAGGGAGCCAA 0: 1
1: 0
2: 1
3: 13
4: 155
Right 950024519 3:9810974-9810996 TTTCGGTCTTGATCTCGGTTGGG 0: 1
1: 0
2: 0
3: 3
4: 85
950024510_950024516 8 Left 950024510 3:9810938-9810960 CCTGGTGAGTTCCAGGGAGCCAA 0: 1
1: 0
2: 1
3: 13
4: 155
Right 950024516 3:9810969-9810991 GTGCCTTTCGGTCTTGATCTCGG 0: 1
1: 0
2: 0
3: 8
4: 56
950024510_950024513 -4 Left 950024510 3:9810938-9810960 CCTGGTGAGTTCCAGGGAGCCAA 0: 1
1: 0
2: 1
3: 13
4: 155
Right 950024513 3:9810957-9810979 CCAAACCCAGCAGTGCCTTTCGG 0: 1
1: 0
2: 1
3: 16
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950024510 Original CRISPR TTGGCTCCCTGGAACTCACC AGG (reversed) Intronic
901743532 1:11357689-11357711 CTGTCTCCCTTGAACTCAACAGG - Intergenic
902734476 1:18391120-18391142 TAGGCTGCCTGGCACCCACCTGG - Intergenic
902948103 1:19858210-19858232 TTGGGTCCCTGGATATCAACAGG + Intergenic
904081633 1:27876113-27876135 GTGGCTCCCTGGAGATCACCCGG - Intronic
908654323 1:66371893-66371915 TTGGGTCCCTGGAAATCATGAGG + Intronic
910845637 1:91602240-91602262 TTGGCTCCTTCTATCTCACCGGG - Intergenic
914745852 1:150500514-150500536 TTGGCTCACTGCAACTTCCCAGG - Intronic
917943481 1:179946408-179946430 TTGGCTCACTGAAACTTCCCAGG - Intergenic
920311189 1:205049233-205049255 TTGTTTCCCTGAAACCCACCAGG - Intronic
922706711 1:227794201-227794223 CTGGCTCCCAGGAAATCCCCAGG + Intergenic
1064436517 10:15315705-15315727 TTACCTCCCTGGGATTCACCTGG + Intronic
1067027827 10:42859240-42859262 CTGCCTCCCTGAAACCCACCAGG + Intergenic
1067414211 10:46091480-46091502 TGGGCTCCCTGGAGCCCTCCTGG + Intergenic
1067434262 10:46265995-46266017 TGGGCTCCCTGGAGCCCTCCTGG + Intergenic
1067581677 10:47450400-47450422 TGGGCTCCCTAGAACCCTCCTGG - Intergenic
1067776304 10:49167225-49167247 AAGGCTCCCTGAAGCTCACCTGG + Intronic
1070549480 10:77479928-77479950 TTGGCTCCGTGGGACACACAAGG - Intronic
1072747238 10:97949363-97949385 TTGGCTCCCTGGCCCTGCCCAGG - Intronic
1073768633 10:106710514-106710536 TTGAGACCCTGGATCTCACCTGG + Intronic
1076224643 10:128764438-128764460 TTCTCACCGTGGAACTCACCTGG + Intergenic
1076642434 10:131927746-131927768 TTGGCTTTCTGTAACTAACCTGG + Intronic
1076684625 10:132192488-132192510 TTTGCTCCCTGGCACTCCCGAGG + Intronic
1077461479 11:2712926-2712948 TCAGCTCCCTGGAAGACACCCGG + Intronic
1078530682 11:12134557-12134579 TTGGCTTCCTGGGTCTCACTGGG + Intronic
1083841093 11:65304682-65304704 TTTGCTCCCTCCACCTCACCTGG - Intronic
1087748789 11:101981906-101981928 TTGGCTCACTTGAACTTAGCAGG - Exonic
1088582773 11:111331523-111331545 TTGGCTTCTTGGAGCTCATCAGG - Intergenic
1089615973 11:119694970-119694992 TCGGCTCCCTGCAACTCCACAGG + Intronic
1091660300 12:2378276-2378298 TAGGATGCCTGGAACTCTCCTGG - Intronic
1092935403 12:13357999-13358021 TTGGCCCACTGGAACTTACTTGG + Intergenic
1096107454 12:49004945-49004967 ATGGGTAACTGGAACTCACCTGG + Exonic
1098190137 12:67939147-67939169 ATTGCTCCCTGGAACTCATCAGG - Intergenic
1101440803 12:104703097-104703119 CTGGCTCATGGGAACTCACCGGG + Intronic
1105458472 13:20562757-20562779 TTGGCTCACTGCAACTTCCCAGG + Intergenic
1107383196 13:39878492-39878514 TTGGCTCACTGCAACCCTCCTGG + Intergenic
1108407833 13:50123213-50123235 TTGCCTCCCTGCAGCTAACCTGG + Intronic
1112238641 13:97659193-97659215 TTGGCTCCCTTTAAGTCAACAGG + Intergenic
1112285262 13:98098268-98098290 TTGGTTCCTTAGAACTCCCCAGG - Intergenic
1113417525 13:110139888-110139910 TTGCATCCCTGGACCTCACTCGG + Intergenic
1114995942 14:28351913-28351935 TTGGCTCCAAGGAGCCCACCTGG + Intergenic
1118331279 14:64817802-64817824 TTGGCTGCCAGGAACTCCCCAGG - Intronic
1118765447 14:68906614-68906636 TGGGGTCCCTGGAACTCACGTGG - Intronic
1121237463 14:92403001-92403023 TTGGGTCCCTGGTCCCCACCTGG - Intronic
1124880829 15:33640999-33641021 ATGGCTCTCTAGAATTCACCTGG - Intronic
1126351055 15:47745198-47745220 CAGGCTTCCTGGTACTCACCTGG + Intronic
1130652103 15:85767998-85768020 TGGGCTGCCAGGGACTCACCTGG + Exonic
1131368876 15:91863252-91863274 CTGTCCCCCTGGAACTCAGCTGG + Intronic
1131577228 15:93604214-93604236 TTGGCTGCCTGGAACTGTCCTGG + Intergenic
1133435167 16:5772975-5772997 AAGGCTTCCTGGAACACACCAGG - Intergenic
1135203415 16:20460501-20460523 TTGGCTGCCTGGGAGTTACCAGG - Intronic
1135215589 16:20564437-20564459 TTGGCTGCCTGGGAGTTACCAGG + Intronic
1135476093 16:22776596-22776618 TAGGCTCCCTGGGACTCCCATGG + Intergenic
1136553181 16:30992659-30992681 TGGTGTCCCTGGACCTCACCGGG - Exonic
1136856817 16:33665739-33665761 CTGCCTCCCTGAAACCCACCAGG - Intergenic
1142236924 16:88926810-88926832 TGGGCTCCCAGGAGCTCACAAGG + Intronic
1203118390 16_KI270728v1_random:1514214-1514236 CTGCCTCCCTGAAACCCACCAGG - Intergenic
1142509646 17:385796-385818 CTCGCTCCCCGGAACTCACCCGG + Intronic
1143159640 17:4860741-4860763 TCTGCTCCCTAGAACTGACCAGG - Intronic
1143331670 17:6141376-6141398 TCTGCTCCCTGGCTCTCACCCGG - Intergenic
1146241680 17:31234599-31234621 TTGGCTCACTGCAACCCTCCTGG - Intronic
1147295107 17:39476182-39476204 TTGGCTCACTGCAACTTCCCAGG + Intronic
1148403654 17:47390430-47390452 TTGGCTAACTGGAATTCATCTGG - Intronic
1150300262 17:64041965-64041987 TTGGGTCACTAGAAATCACCTGG + Exonic
1152286322 17:79415238-79415260 CTGGCTCTTTGGAACTCATCTGG - Intronic
1155787409 18:29917813-29917835 TTGGCTCACTGCAACCCTCCTGG + Intergenic
1157269120 18:46256947-46256969 TTGGCTGCCTGTATCTCATCTGG + Intronic
1158901369 18:61965007-61965029 GTGCCTTCCTGGAACACACCAGG + Intergenic
1159850876 18:73526073-73526095 TGGGCTCACTGGGACTGACCTGG + Intergenic
1159854212 18:73565000-73565022 TTGGCTCCGTTGAAATCACAAGG - Intergenic
1160240567 18:77119654-77119676 TCGGCTCCCTGGGGCTCACCAGG - Intronic
1161530512 19:4786430-4786452 TTGGCTCACTGCAACTTCCCAGG + Intergenic
1162964207 19:14148421-14148443 TCAGCCCCCTGGAACTCTCCTGG + Exonic
1163398120 19:17075871-17075893 GAGGCTGCCTGGTACTCACCTGG - Exonic
1168141686 19:54392332-54392354 TGGAGTCCCTGGAACTCAGCGGG + Intergenic
1168449880 19:56458136-56458158 TTGGTTCTCTGTCACTCACCAGG + Exonic
927194987 2:20540795-20540817 TTTGCCCCCTGGAGCTCCCCAGG - Intergenic
927427304 2:22995561-22995583 TTGGGCTCCTGGAGCTCACCTGG + Intergenic
927991085 2:27447604-27447626 TTGCCTCACTGGACTTCACCAGG + Exonic
931667074 2:64617373-64617395 TTGTCCCCCTTGGACTCACCTGG + Intergenic
933775962 2:85771398-85771420 TTTCCTCTCTGGCACTCACCGGG - Intronic
934166714 2:89300600-89300622 TTGATTCCCTGAAACTTACCTGG - Intergenic
934200567 2:89881857-89881879 TTGATTCCCTGAAACTTACCTGG + Intergenic
935346448 2:102112545-102112567 TTGAGTACCTGGAATTCACCAGG - Intronic
938058434 2:128233720-128233742 CTGGCTCCCCTGAAGTCACCAGG + Intergenic
938092319 2:128441719-128441741 ACGGCTCCCTGGGACTCACCAGG - Intergenic
938401790 2:130999226-130999248 TTGGCTCACTGCAATTCTCCTGG + Intronic
947023479 2:225710382-225710404 TAGGTTCCCTGGGACACACCTGG - Intergenic
947612542 2:231532867-231532889 TTGGCTCTCAGGGACTCAGCAGG - Intergenic
947714652 2:232333508-232333530 CTGGCTCCCTGGTCCTCAGCAGG + Intronic
948669903 2:239561659-239561681 CTGGCTCCCAGGAAGGCACCGGG - Intergenic
948775014 2:240281884-240281906 TTGTATCCCTGGATCTCACTTGG - Intergenic
948793044 2:240388989-240389011 GCGGCTCCCAGGATCTCACCTGG - Intergenic
948909868 2:240997787-240997809 TCTGATTCCTGGAACTCACCCGG - Intergenic
1169525505 20:6420897-6420919 CTGCCTCCCTGGAAGTAACCAGG - Intergenic
1169616577 20:7454332-7454354 TTGACTGCCTGTAACTCACAAGG + Intergenic
1171373602 20:24676827-24676849 TAATCTCCCTGGACCTCACCAGG - Intergenic
1175778794 20:61669231-61669253 CTGGCTCCCTTTAACTCTCCAGG - Intronic
1176371114 21:6061817-6061839 TGGGCCTCCTGGAACTCCCCTGG - Intergenic
1179494712 21:41764272-41764294 CTGGCTCCCTGCAGCTCCCCTGG - Intronic
1179752405 21:43476724-43476746 TGGGCCTCCTGGAACTCCCCTGG + Intergenic
1181856311 22:25783798-25783820 TAGGGTCCCTGAAACTCATCTGG - Intronic
1182119786 22:27779221-27779243 TGTGCTCCCTGGCACTCAGCAGG + Intronic
1183073503 22:35412310-35412332 TTTGGACCCTGGAACACACCAGG + Intronic
1183347771 22:37317429-37317451 TTTGCATCATGGAACTCACCTGG - Intergenic
1184424102 22:44399060-44399082 TTGGCTCCCTGTCCCTCCCCTGG + Intergenic
1185270563 22:49927753-49927775 TTGGACCCCTGAAACCCACCTGG - Intergenic
1185387721 22:50543952-50543974 TCGGCTCACTGCAACTCCCCGGG + Intergenic
949976666 3:9467121-9467143 TTGGCTCCCTGCAACCTCCCAGG - Intronic
950024510 3:9810938-9810960 TTGGCTCCCTGGAACTCACCAGG - Intronic
950575721 3:13830947-13830969 TGGGCTCAATGGAACACACCTGG + Intronic
951059627 3:18189919-18189941 TTGGCTCCCTGCACCCCACCAGG - Intronic
951425576 3:22540838-22540860 TTGGAAGCCTGCAACTCACCTGG - Intergenic
953196511 3:40739248-40739270 TTCACTCCCTGGAACTTACAAGG + Intergenic
957468613 3:80628225-80628247 TTGGCTTCCTGGATTTAACCTGG + Intergenic
960469680 3:118047232-118047254 TTGGCTCACTGCAACACGCCCGG - Intergenic
960511132 3:118550757-118550779 TTTGCACCCTGCAACTTACCTGG - Intergenic
963703717 3:148659212-148659234 TTGTCTCCCTGGTATTCAGCTGG - Intergenic
967970517 3:194995628-194995650 TTGGCTCCCATGAAATCCCCAGG - Intergenic
967970705 3:194997000-194997022 TTGGCTTCCGGGAACTTAACTGG + Intergenic
968313512 3:197703493-197703515 CTGGGTCCCTGGAGCTCAGCAGG - Intronic
971810301 4:31416685-31416707 TTGGCTGCCTGGAACTCAGCAGG - Intergenic
972179577 4:36447026-36447048 TTGGTTCTCTGGAAGTCAGCTGG + Intergenic
972771266 4:42199367-42199389 TTGGCTTCCTGGAACTCCATTGG + Intergenic
973271899 4:48270063-48270085 GACGCTCCCTGAAACTCACCGGG - Intergenic
976301364 4:83518566-83518588 TGGGGTCCCTGGAACTCATGAGG - Intronic
976542333 4:86293252-86293274 TAAGCTACCTGGAACTCACAAGG - Intronic
978312308 4:107397875-107397897 TTGGCTACCTTGAACTTAACTGG - Intergenic
986010481 5:3710155-3710177 TTAGCTCCCTGGAACCTTCCTGG - Intergenic
990312306 5:54551815-54551837 TGGGGTCCCTGGAGCACACCGGG + Intergenic
993233310 5:85268265-85268287 TGGGCTACATGGAATTCACCTGG - Intergenic
995917104 5:117261214-117261236 TTGGCACCCTGGACCATACCTGG + Intergenic
998423071 5:142005140-142005162 TTGGATCCCTGGGACTGACAGGG - Intronic
1000154636 5:158538637-158538659 TTGGCTCCCAGGACTTCAACAGG + Intergenic
1000186022 5:158858893-158858915 CTGTCTCCCTGTCACTCACCCGG - Intronic
1001192389 5:169643210-169643232 TTGTCTCCCTGCACCCCACCAGG + Intronic
1001951538 5:175820093-175820115 TTGGCTCCCTGCACATCACTGGG - Intronic
1005238750 6:23798384-23798406 ATGGCTCCTTGGAGCTCACAAGG + Intergenic
1005424108 6:25683204-25683226 TCTGCTCCCTGGATCCCACCTGG + Intronic
1007015387 6:38461027-38461049 TTGCCTCCCTGGTTCTAACCAGG + Intronic
1007072755 6:39048915-39048937 CGGGGTCCCTGGATCTCACCTGG - Exonic
1014798382 6:125749922-125749944 GTGGCTCCCTGGAAATCCCGAGG + Intronic
1015466023 6:133549601-133549623 TTGGGTGCCTGGAACTGAGCTGG - Intergenic
1022242557 7:28527111-28527133 ATGGCTCACTGCAACTAACCAGG - Intronic
1024210940 7:47203184-47203206 TTGGCTCACTTGAACTTAGCAGG + Intergenic
1024594761 7:50922729-50922751 GTGGCTACCTGGATCTCACCTGG + Intergenic
1029668788 7:102014138-102014160 TCAGGTCCCTGGAACTCTCCTGG + Intronic
1029976898 7:104843381-104843403 TTGGCTCCCTGAAACACAGAGGG - Intronic
1030695401 7:112579981-112580003 TTTGGTCCCTCAAACTCACCTGG - Intergenic
1032332828 7:130995918-130995940 CTGGGTACCTGGAACTCTCCAGG + Intergenic
1034991220 7:155549167-155549189 TTGGCTCCCTGGATCCCTCAAGG + Intergenic
1040015612 8:42696676-42696698 GTGGCTCCCTTGACCCCACCAGG - Intergenic
1041396244 8:57394738-57394760 TCAGCTCTCTGGAACTAACCAGG - Intergenic
1045508702 8:102796719-102796741 TTGGCTCACTGCAACCCCCCAGG - Intergenic
1045558866 8:103241271-103241293 TTGGCTGCCTGGAACTTCCATGG - Intergenic
1045571375 8:103371803-103371825 TCGGCTCCCTCGGACTCACCAGG - Exonic
1047470037 8:125161720-125161742 TTGGCTCACTGCAACCCTCCTGG - Intronic
1049140522 8:140950018-140950040 TTGGGTCTCTTCAACTCACCAGG + Intronic
1049454004 8:142677878-142677900 CTGCCTCCCTGGAACCCACTGGG - Intronic
1050105082 9:2157257-2157279 TTGGCTTCCAGGATCTCAGCAGG + Intronic
1051499989 9:17765851-17765873 TTGGCTGCCTGGAACTGAGCTGG - Intronic
1054828757 9:69600088-69600110 TTGCCTCCCTGGTAATGACCAGG + Intronic
1057210288 9:93197594-93197616 TTGGCTCACTGGAACCCTCTTGG + Intronic
1057869361 9:98707263-98707285 CTGGCTTCCTGGGACTCTCCGGG - Intronic
1058365499 9:104203889-104203911 TTGTTTCCCAGGAACTTACCTGG + Intergenic
1060925788 9:127454338-127454360 CTGCCTCCGTGGAACTCACTAGG + Intronic
1061921658 9:133785757-133785779 CTGCCGCCCTGGAACTCACATGG + Exonic
1062354791 9:136156874-136156896 TGGCCTCCCCCGAACTCACCAGG + Intergenic
1062416564 9:136454185-136454207 TTGGCTTCCTGGAGCCCTCCGGG - Exonic
1195156503 X:102128387-102128409 TTGGCTCACTGGAAATCAACTGG - Intergenic
1199508138 X:148589444-148589466 GTGCCTGCCTGGAAATCACCTGG + Intronic