ID: 950027831

View in Genome Browser
Species Human (GRCh38)
Location 3:9832987-9833009
Sequence TCTGAGGCACCTGGTCAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 165}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950027831_950027839 14 Left 950027831 3:9832987-9833009 CCTCTTTGACCAGGTGCCTCAGA 0: 1
1: 0
2: 1
3: 8
4: 165
Right 950027839 3:9833024-9833046 ATCTCTACTCTGGGTCCCGCTGG 0: 1
1: 0
2: 0
3: 9
4: 98
950027831_950027840 15 Left 950027831 3:9832987-9833009 CCTCTTTGACCAGGTGCCTCAGA 0: 1
1: 0
2: 1
3: 8
4: 165
Right 950027840 3:9833025-9833047 TCTCTACTCTGGGTCCCGCTGGG 0: 1
1: 0
2: 0
3: 15
4: 119
950027831_950027841 21 Left 950027831 3:9832987-9833009 CCTCTTTGACCAGGTGCCTCAGA 0: 1
1: 0
2: 1
3: 8
4: 165
Right 950027841 3:9833031-9833053 CTCTGGGTCCCGCTGGGCCAAGG 0: 1
1: 0
2: 4
3: 29
4: 287
950027831_950027835 5 Left 950027831 3:9832987-9833009 CCTCTTTGACCAGGTGCCTCAGA 0: 1
1: 0
2: 1
3: 8
4: 165
Right 950027835 3:9833015-9833037 ATTCCACCCATCTCTACTCTGGG 0: 1
1: 0
2: 2
3: 18
4: 148
950027831_950027834 4 Left 950027831 3:9832987-9833009 CCTCTTTGACCAGGTGCCTCAGA 0: 1
1: 0
2: 1
3: 8
4: 165
Right 950027834 3:9833014-9833036 AATTCCACCCATCTCTACTCTGG 0: 1
1: 0
2: 1
3: 8
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950027831 Original CRISPR TCTGAGGCACCTGGTCAAAG AGG (reversed) Intronic
906452213 1:45960219-45960241 TATGAGGCAGCTGGGCACAGTGG + Intronic
907866517 1:58404611-58404633 TCTGTGGCTCTTGGTCAAAGGGG - Intronic
912653822 1:111467693-111467715 TCTTTGACACCTGGTCGAAGAGG + Intergenic
912930308 1:113952857-113952879 TCTGAAGCACCAGGATAAAGAGG - Exonic
913985843 1:143565345-143565367 CCTGAGCCACCTGGTGAGAGAGG + Intergenic
916728341 1:167543697-167543719 CCAGAGGCACCCGGTCAGAGCGG + Intronic
916732060 1:167575198-167575220 TCTAAGGGTCCTGGTAAAAGGGG - Intergenic
919134319 1:193489154-193489176 TCGTAAGCACCTGGCCAAAGGGG + Intergenic
923292271 1:232557742-232557764 TCAGAGAAACCTGGTCAATGTGG + Intronic
1066808140 10:39285121-39285143 ACTGAGGCAACTGGTGAAAAGGG - Intergenic
1066810769 10:39331614-39331636 TTTGAGGCACTTGGTGAAAAAGG - Intergenic
1066811261 10:39339363-39339385 TTTGAGGCACATGGTGAAAAAGG - Intergenic
1066933377 10:41796131-41796153 TCTGAGGCCCGTGGTGAAAAAGG + Intergenic
1067783948 10:49229140-49229162 CCCGAGGCACCTGGACAAATAGG + Intergenic
1069694404 10:70376260-70376282 ACTGTGGGTCCTGGTCAAAGAGG - Intronic
1077919550 11:6632361-6632383 TCTGTGGCTCCAGGCCAAAGGGG + Exonic
1078932211 11:15921288-15921310 TCTGAGGGTCCTGGTCTCAGAGG - Intergenic
1079368119 11:19827097-19827119 GCAGAGGCACCTGGGCAGAGGGG + Intronic
1081588468 11:44404036-44404058 ACTGAAGCAGCTGGTCAAAGGGG + Intergenic
1081808078 11:45900803-45900825 TATGGGGCTCCTGGTGAAAGTGG + Intronic
1085260965 11:75204466-75204488 CCTGAGGCAGCAGGACAAAGAGG + Exonic
1091388665 12:111723-111745 GCTGAGACACCTGGACAGAGTGG + Intronic
1091496483 12:977535-977557 TGTCAGGCAGCTGGTCAAAGGGG - Intronic
1094591503 12:31826026-31826048 TCTGATGAATCTGGGCAAAGTGG - Intergenic
1095066481 12:37783456-37783478 TTTGAAGCACCTGGTGAAAACGG + Intergenic
1096229886 12:49890895-49890917 TCAGAGGCACCAGGTAAAGGAGG + Intronic
1097175929 12:57142947-57142969 TGTGAGGCCGCTGGACAAAGGGG + Intronic
1099182402 12:79483541-79483563 CCAGAGGCACCTGGGCACAGAGG + Intergenic
1100772002 12:97934070-97934092 TCTGAGGAGCCTGGTGAATGAGG + Intergenic
1103713612 12:122930339-122930361 AATGAGGCACCTGGTGAATGGGG + Intronic
1109207129 13:59495102-59495124 TCTGATGCTACTGGCCAAAGAGG - Intergenic
1109261579 13:60150766-60150788 TCTGAGGCAACTGAACAAGGAGG + Intronic
1111121530 13:83857683-83857705 TCTGAGGCTCCAGCTTAAAGAGG - Intergenic
1113464068 13:110501736-110501758 TCTGGGGCACCTGGTGACAAAGG + Exonic
1113484946 13:110646721-110646743 TCTGAGCCCCCTGCTCAGAGTGG - Intronic
1116143789 14:41037499-41037521 TCTTGGGCACCTGGGGAAAGTGG - Intergenic
1117378878 14:55140112-55140134 TCTTTGGCCCCTGGGCAAAGTGG + Intronic
1119651117 14:76383903-76383925 TCTGAGGCGCGTGGTGATAGGGG + Intronic
1123387627 15:19831656-19831678 TCTGAGGCCCCTGGTGGAAAAGG - Intergenic
1125341409 15:38679289-38679311 TCTGAGTTACTTGATCAAAGAGG - Intergenic
1129390989 15:75220883-75220905 TCTGTGTCACCTGGTGGAAGGGG - Intergenic
1129404555 15:75307212-75307234 TCTGACGAGCCTGGCCAAAGTGG + Intergenic
1129851795 15:78797829-78797851 TCTGTGTCATCTGGTCTAAGGGG + Intronic
1131417977 15:92277424-92277446 TCTGAGTCACCAGATCATAGAGG + Intergenic
1132622478 16:874378-874400 TCTGAGGCGCCTGCCCACAGCGG - Intronic
1135402370 16:22174853-22174875 TCTGGGTCACCTGGGCATAGTGG - Intronic
1137076020 16:35962969-35962991 TCTGAGGCACGGGGTGAAAATGG + Intergenic
1137076332 16:35967450-35967472 TCTGAGGCCCATGGTGAAAAAGG + Intergenic
1137096211 16:36311280-36311302 TCTGAGGCCCATGGTGAAAAAGG + Intergenic
1137097579 16:36329470-36329492 TCTGAGGCCCATGGTGAAAAAGG + Intergenic
1137097658 16:36330492-36330514 TCTGAGGCCCATGGTGAAAAAGG + Intergenic
1138556780 16:57775524-57775546 ACGGAGGCACCTGGGGAAAGCGG + Intronic
1141206554 16:81937629-81937651 TGTGAGGCAGCTGTTCAAATAGG - Intronic
1141490726 16:84370818-84370840 ACTGGGGTAACTGGTCAAAGTGG - Intronic
1142220063 16:88849901-88849923 TCAGTGGCACCTAGTCACAGTGG + Intronic
1143929657 17:10408722-10408744 TCTGAGGCTCATTCTCAAAGAGG + Intronic
1144106484 17:11990998-11991020 TCTGAGCCACATCGTGAAAGAGG - Exonic
1145417560 17:22733176-22733198 TATGAGGCATCTGGTGAAAAAGG + Intergenic
1150282251 17:63935506-63935528 TCTGAGGTACTTGGTGAATGTGG + Intergenic
1151183701 17:72348619-72348641 GCTCAGGAACTTGGTCAAAGAGG - Intergenic
1151893470 17:76964743-76964765 AGGGAGGAACCTGGTCAAAGAGG - Intergenic
1153405533 18:4734513-4734535 TCTGAGTCCCCTGATCAAACTGG - Intergenic
1154083360 18:11279326-11279348 TCAGAGCCACCTGCTCACAGTGG + Intergenic
1157569695 18:48704203-48704225 TCTGAGGCACATGGTCCCAATGG - Intronic
1161354478 19:3811195-3811217 TCAGAGGCACCAGGTCAACCCGG - Intronic
1162966104 19:14156846-14156868 CCTGAGGGTCCTGGTCCAAGGGG + Intronic
1163034524 19:14563292-14563314 CCTAAGGTCCCTGGTCAAAGGGG - Intronic
1163148339 19:15397304-15397326 TCTTAGGCACCTGGGCCCAGTGG - Intronic
1164356978 19:27447536-27447558 TCTGAGGCATATGGTGAAAAAGG + Intergenic
1166666268 19:44682432-44682454 TGTGAGGCCCCTGGGCAGAGGGG - Intronic
925785157 2:7424748-7424770 TCTGAGGCAGCTTGTGAAGGTGG - Intergenic
927070637 2:19525133-19525155 TCTGAGAGACCTGGTCATGGGGG + Intergenic
928397693 2:30955617-30955639 TCTGTTGCACAGGGTCAAAGAGG - Exonic
928495066 2:31823113-31823135 TCTGAGCCACCTCGTCATATTGG + Intergenic
932489812 2:72113566-72113588 TCTGAGACGCCAGGTCACAGGGG - Intergenic
932795637 2:74692728-74692750 TCTGAGGCTTCTGTTCAGAGGGG + Intergenic
935445940 2:103157066-103157088 TCTGAGGGAGCTGGAGAAAGTGG + Intergenic
943640355 2:190351227-190351249 TCTTAGGCACCTGGGCCATGGGG - Intronic
946189751 2:218002088-218002110 GCTGAGGCTCCTGGGTAAAGGGG - Intronic
947833465 2:233158635-233158657 TGGGAGGCAGCTGGGCAAAGTGG - Intronic
948868717 2:240787799-240787821 TCTTAGGCACATGATCAAGGTGG + Intronic
1171575342 20:26305682-26305704 TTTGAGGCATCTGGTGAAACAGG + Intergenic
1171741863 20:28904713-28904735 TTTGAGGCCCATGGTCAAAAAGG + Intergenic
1171766027 20:29278483-29278505 TTTGAGGCACGTGGTCAAAGAGG - Intergenic
1172235442 20:33369838-33369860 TCTGAGCCCCCTGGCCACAGGGG + Intronic
1173442033 20:43086213-43086235 CCTGAGGCACCTATTCACAGCGG - Intronic
1173628824 20:44494329-44494351 TCAGAGGCTCTTGGTCAGAGAGG - Exonic
1174207382 20:48850560-48850582 TCTGAGAAACCTGGCCAAATTGG + Intergenic
1175132162 20:56797485-56797507 TTTGAGGCACCGGGACACAGGGG - Intergenic
1175837419 20:62004969-62004991 TCTGAAGCACCTGGGCCCAGAGG - Intronic
1178909922 21:36666212-36666234 TCTGGTTCACCTGGTCAGAGAGG - Intergenic
1180750631 22:18121935-18121957 CCTGCGGCACCAGGTCAAAATGG + Intronic
1181039142 22:20183783-20183805 CCTGGGGCACCTGGGCACAGTGG + Intergenic
1181768190 22:25107222-25107244 TGTGAGACACCTGGTCATGGGGG - Intronic
1182146140 22:27997940-27997962 TCTGTGACATCTGGTCACAGGGG - Intronic
1185317013 22:50183664-50183686 TCTGACTCACCTGGGCAAGGTGG - Intergenic
949102062 3:157470-157492 TGAGAGGAACCTGGGCAAAGTGG + Intergenic
949542033 3:5040161-5040183 TGTGAAGCACCTGGGTAAAGAGG + Intergenic
950027831 3:9832987-9833009 TCTGAGGCACCTGGTCAAAGAGG - Intronic
950333649 3:12176950-12176972 TGTAAGGCACATGGTGAAAGGGG + Intronic
954300822 3:49699895-49699917 TCTGAGGGCCCTGGTCACATGGG - Intronic
956751007 3:72343915-72343937 CCTGATGCACCTGGTCTCAGAGG + Intergenic
958204944 3:90378385-90378407 TTTGAGGCACTTGGTGAAAATGG - Intergenic
959976629 3:112468013-112468035 GCTGTGGCACCCCGTCAAAGTGG + Intronic
960724148 3:120653447-120653469 GCTGCAGCACCTGGTCAAGGTGG + Intronic
963735687 3:149015735-149015757 TCTGAGGCATCTGCTCTAATGGG + Intronic
963935903 3:151053019-151053041 TTTGAAGCACATGGTGAAAGGGG - Intergenic
966538374 3:181061047-181061069 TCTAAGGTACCTGCTCTAAGTGG + Intergenic
967035177 3:185643650-185643672 TCTGAGGGACCTGGGCAGACAGG - Intergenic
969703116 4:8778580-8778602 CCTGTGGCCCCTGGTCAGAGAGG - Intergenic
970518928 4:16863215-16863237 TCTTTGGCACCTTTTCAAAGAGG - Intronic
971348357 4:25833075-25833097 TCAGATGCATCTTGTCAAAGGGG - Exonic
971395358 4:26222038-26222060 TCTAGGGCCCCTCGTCAAAGTGG - Intronic
971810323 4:31416882-31416904 TCAGAGGCTCCTGGACAAAATGG + Intergenic
971995541 4:33958784-33958806 TATGAGGGAAGTGGTCAAAGTGG - Intergenic
973832719 4:54778368-54778390 ACTGAGGCACATGGTCAAGGAGG - Intergenic
975612730 4:76217528-76217550 TGTGAGGCACATGGGCAGAGAGG - Intronic
977864273 4:102004324-102004346 TCTGAGGCATCAGGTAAATGAGG + Intronic
979477131 4:121171595-121171617 TCTGGGGCAGATGGTGAAAGTGG - Intronic
980154722 4:129090743-129090765 TTTTAGGAACCTGTTCAAAGAGG - Intronic
980229455 4:130030603-130030625 TCTGAGGACCCTGGTGAAATTGG - Intergenic
980264594 4:130498989-130499011 TCTGAGGCAGGTGGTCAGAAAGG - Intergenic
984431045 4:179649509-179649531 TCTGAGGAAGCAGATCAAAGTGG - Intergenic
989842261 5:46092715-46092737 TTTGAGGCCCCTGGTGAAAATGG + Intergenic
991469528 5:66953341-66953363 TCTGAGGCACCTGGGCAGACAGG - Intronic
991954439 5:71978447-71978469 ACTGAGCCACCTGCTCAGAGAGG + Intergenic
993089101 5:83401530-83401552 TCTGATGCAGCTTGTCAAGGGGG + Intergenic
995705231 5:114982059-114982081 CCTGAGGCACATGGTGGAAGGGG - Intergenic
998533033 5:142902799-142902821 TCTGAGAAACCTGGCCTAAGGGG - Intronic
1000281534 5:159786593-159786615 ACTGTGGCACCTGGTCAATAGGG - Intergenic
1000581577 5:163040879-163040901 TCAGAGCCACCTAGTCACAGTGG + Intergenic
1001282093 5:170393485-170393507 TCTGAGTCACCTCGGCACAGTGG - Intronic
1001568999 5:172718049-172718071 TCTGAGGCTTCTGGGCACAGGGG - Intergenic
1002044138 5:176532540-176532562 ACTGAGGCACCTGGCCAACATGG + Intronic
1006377085 6:33677617-33677639 TCAGAGCCACCTTGTCATAGGGG - Exonic
1007414571 6:41684197-41684219 TCTGAGGCAACTGGTCCTGGGGG - Exonic
1007691462 6:43704341-43704363 TCTGAGACAACTGGCCAGAGAGG + Intergenic
1008624193 6:53301535-53301557 TCAGAGACTCCTGGTTAAAGAGG - Intronic
1010738680 6:79472449-79472471 TCTTAACCACCTGGTCACAGAGG + Intergenic
1011729705 6:90248675-90248697 CCTGGTGCACCTGGTCACAGTGG + Intronic
1016398546 6:143653110-143653132 TCTGAGACACCTGGGGACAGAGG - Intronic
1018851356 6:167642548-167642570 TCTGAGGCACCTGCTGCAGGAGG - Intergenic
1019137558 6:169920588-169920610 TCTGTCAAACCTGGTCAAAGAGG + Intergenic
1021737213 7:23651480-23651502 TCTGAGGCATCTGGTTATAATGG + Intergenic
1021840150 7:24715803-24715825 TTTGAAGCAGTTGGTCAAAGAGG - Intronic
1022469803 7:30675168-30675190 TCTGAAGCACCTGGTGAGGGTGG + Intronic
1022558277 7:31322797-31322819 TCTTAGGCTCCATGTCAAAGGGG + Intergenic
1024822188 7:53345110-53345132 TCTGAAGACCCTGGTCAAAGGGG - Intergenic
1025518222 7:61683080-61683102 TTTGAGGCACATGGTGAAAAAGG - Intergenic
1025542548 7:62111728-62111750 TTTGAGGCACATGGTGAAAAAGG - Intergenic
1031340078 7:120589040-120589062 TCTGAGGACACAGGTCAAAGTGG + Intronic
1032073157 7:128822189-128822211 TGTGAGGTACTTGGTTAAAGGGG - Intergenic
1032094929 7:128933231-128933253 CATGAGGCACCTGGACAAGGAGG - Intergenic
1035472781 7:159120790-159120812 ACAGAGGCACCTGCTCACAGAGG - Intronic
1038318945 8:26511404-26511426 TCTGGGGCTCCTGGGCACAGGGG - Intronic
1039369100 8:36966621-36966643 TCAGAGGCACCTGATCAATAAGG + Intergenic
1042190304 8:66178934-66178956 TCAGAGACACCTGGTCAGGGAGG - Intergenic
1045694025 8:104787741-104787763 CCTGTGGCACCTGATTAAAGAGG - Intronic
1047886844 8:129260650-129260672 CCTGAGGGACCTAGTCATAGGGG - Intergenic
1048900373 8:139031808-139031830 AAAGAGGCACCTGGACAAAGAGG - Intergenic
1049427039 8:142542335-142542357 TCTGCGGCATCTGGTCAATGTGG - Exonic
1049640402 8:143712617-143712639 TCTGAGGTACCTGGCCATGGGGG - Intronic
1052337621 9:27336402-27336424 TCTGAGACACCAGGAGAAAGGGG + Intronic
1052612970 9:30799971-30799993 TCTGAGCCAGCTGGTCATATTGG + Intergenic
1056109655 9:83382498-83382520 TGTAAGGAACCTGCTCAAAGTGG + Intronic
1057024744 9:91726244-91726266 GCTGAGGCACCTGGACAGTGAGG + Intronic
1061812042 9:133167833-133167855 CCTGAAACACCAGGTCAAAGAGG - Intergenic
1061940731 9:133882509-133882531 TTTGAGGGCCCTGGTCACAGTGG - Intronic
1186733295 X:12433431-12433453 TCTGAGTTAACTGATCAAAGGGG + Intronic
1189357697 X:40323925-40323947 TCTGAGGTACCTTCTCAAAGGGG - Intergenic
1190080640 X:47354505-47354527 TCAGAGGCACCGGGGCAAACAGG - Intergenic
1191271394 X:58476485-58476507 TTTGAGGCCCCTGGTGAAAAAGG + Intergenic
1198377921 X:136057736-136057758 TGTGATGCATCTGGTCCAAGGGG + Intergenic
1199365058 X:146971414-146971436 TCGGAGGCATCTGGTGAGAGTGG - Intergenic
1199382312 X:147184357-147184379 TCGGAGGCATCTGGTGAGAGTGG + Intergenic