ID: 950030927

View in Genome Browser
Species Human (GRCh38)
Location 3:9852858-9852880
Sequence ATTGATAAGCTACTGGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 4, 1: 11, 2: 20, 3: 14, 4: 116}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950030922_950030927 6 Left 950030922 3:9852829-9852851 CCGATACTGAAATTCAGCCGGCA 0: 1
1: 1
2: 11
3: 18
4: 75
Right 950030927 3:9852858-9852880 ATTGATAAGCTACTGGTGGTTGG 0: 4
1: 11
2: 20
3: 14
4: 116
950030919_950030927 29 Left 950030919 3:9852806-9852828 CCATACTGACTTTCTGGGGGTGG 0: 23
1: 6
2: 5
3: 9
4: 147
Right 950030927 3:9852858-9852880 ATTGATAAGCTACTGGTGGTTGG 0: 4
1: 11
2: 20
3: 14
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950030927 Original CRISPR ATTGATAAGCTACTGGTGGT TGG Intronic
901955750 1:12784087-12784109 ATTGATAAACTACCGGTGGTTGG + Intergenic
901979124 1:13020137-13020159 ATTGATAAACTACCGGTGGTTGG + Intronic
902002958 1:13208801-13208823 ATTGATAAACTACCGGTGGTTGG - Intergenic
902022183 1:13354565-13354587 ATTGATAAACTACCGGTGGTTGG - Intergenic
903575062 1:24334593-24334615 ATGGCTAAGCTTCTGCTGGTAGG - Intronic
904197799 1:28798925-28798947 TTTGATAAACCACTGGAGGTAGG - Intergenic
906552546 1:46677533-46677555 ATGGAGATGGTACTGGTGGTGGG + Exonic
907801395 1:57769304-57769326 ATAGAAAGGCTACTAGTGGTTGG - Intronic
909413348 1:75378808-75378830 ATTGATAAGCTACTGGCGGTTGG - Intronic
909486156 1:76176565-76176587 ATCTATAAGCTAATGCTGGTGGG - Intronic
912562023 1:110557802-110557824 ATTGATCAGTTACTGGATGTGGG + Intergenic
915402541 1:155634101-155634123 ATTGATAGGCTACTGGCGGTTGG + Intergenic
916009557 1:160692499-160692521 ATTGATAAGCTACTGGCAGTTGG - Intronic
923371409 1:233317965-233317987 ATTGCTCAGCAACTGATGGTGGG + Intergenic
1063531089 10:6831903-6831925 ATTGATAAGCTACTGGTAGTTGG + Intergenic
1070707031 10:78647225-78647247 ATTTGTAAGTTACTGGTGGTAGG - Intergenic
1072947935 10:99827182-99827204 ATTGATAAGCTACTGGCGGTTGG + Intronic
1074636934 10:115330113-115330135 ATTGATAAGTTAATTTTGGTCGG + Intronic
1078947743 11:16089723-16089745 ATTGAGAAGCTACAGTTGGATGG - Intronic
1080409879 11:32013628-32013650 AATGAGAAGCTACTCGTGTTGGG + Intronic
1083394555 11:62381065-62381087 ATTGATAGGCTACTGGCGGTTGG + Intronic
1086591294 11:88517338-88517360 TTTGATAAGCTACTGATTCTTGG + Intronic
1087723889 11:101696785-101696807 ATTGATAAGCTACTGGCGGTTGG - Intronic
1089471947 11:118728430-118728452 ATTGATAAGCTACTGGTGGTTGG + Intergenic
1097331292 12:58335171-58335193 ATTGATAAGCTACTGGTGGTTGG + Intergenic
1099074021 12:78082584-78082606 ATTGAAATGCTAATGGTGGGGGG - Intronic
1102535920 12:113581131-113581153 ATGGAGAACCTACTTGTGGTTGG + Intergenic
1104568932 12:129908507-129908529 ATTCATTAGCTGGTGGTGGTTGG - Intergenic
1105257189 13:18751579-18751601 AGTGTTAAGCCACTGGTGGACGG - Intergenic
1105259853 13:18770941-18770963 AGTGTTAAGCCACTGGTGGACGG - Intergenic
1105262533 13:18790264-18790286 AGTGTTAAGCCACTGGTGGACGG - Intergenic
1106211851 13:27656505-27656527 ATTTATAATCTAATGGGGGTGGG + Intronic
1106302970 13:28486290-28486312 TGTGAAAAGCTACTGCTGGTTGG - Intronic
1107230167 13:38099331-38099353 ATTGACAAGTCACTGGTGTTTGG - Intergenic
1110809337 13:79794225-79794247 ATTAAGATGCTTCTGGTGGTGGG + Intergenic
1114608061 14:24014264-24014286 GTTCATAAACTACTGATGGTTGG + Intergenic
1115757864 14:36547645-36547667 ATTAATATCTTACTGGTGGTTGG - Intergenic
1116677219 14:47921025-47921047 GTTGAAAAGCTACTGTGGGTTGG - Intergenic
1119274193 14:73338667-73338689 ATTGACAAACTACTGGTGTAGGG - Intronic
1128318937 15:66679319-66679341 ATTTATAAGAAACTGGGGGTTGG + Intronic
1130058004 15:80545586-80545608 ATTGATATGCAACTGGTGAGAGG + Intronic
1132008644 15:98254448-98254470 ATTAAACAGCTACTGGTGGAAGG + Intergenic
1133013342 16:2927017-2927039 ATTGATAAGCTAATGGCGGTTGG - Intronic
1136284330 16:29232373-29232395 AATGATAACCCACAGGTGGTGGG + Intergenic
1140947670 16:79785028-79785050 ATAGGTAAACTGCTGGTGGTTGG - Intergenic
1153564729 18:6408368-6408390 ATTTATAAGCTCTTGCTGGTGGG - Intronic
1154426169 18:14273860-14273882 AGTGTTAAGCCACTGGTGGACGG + Intergenic
1154431179 18:14309789-14309811 AGTGTTAAGCCACTGGTGGACGG + Intergenic
1155239905 18:23855154-23855176 ATTAATAAGATGCTGGTGGTAGG - Intronic
1156973013 18:43180605-43180627 ATAGATAAACTATTGGTGATTGG - Intergenic
1158128759 18:54129694-54129716 ATTGTTAAGCTACAGGATGTGGG - Intergenic
1158228741 18:55229854-55229876 ATTCATAAGCTGCAGGTGTTTGG - Intronic
1158888893 18:61855030-61855052 TTAAATAAGCTAATGGTGGTGGG + Intronic
1158895902 18:61912571-61912593 ATTGAGAATCTACTTGAGGTAGG - Intergenic
1163919860 19:20278406-20278428 ATTGATAGGCTACTGGCAGTTGG - Intergenic
1164153843 19:22576652-22576674 ATTGATAAGCTACTGGCGGTTGG - Intergenic
1164371190 19:27645677-27645699 ATTGATAGGCTACTGGCGGTTGG + Intergenic
1165084449 19:33333900-33333922 ATTGATAAGCTGCTTGGGCTGGG - Intergenic
1165607014 19:37114338-37114360 ATTGATAGGTTACTGGCGGTTGG + Intronic
1165692435 19:37874034-37874056 ATTGATATGCTTCTGGGGGGTGG + Intergenic
1167550633 19:50158249-50158271 TTTGGTAAGCTTCTGGGGGTGGG - Exonic
930648605 2:53939939-53939961 ATTGAGAAGCTACTTACGGTCGG + Exonic
933635200 2:84701272-84701294 ATTGATAAGCTCCAGGTAGGAGG - Exonic
935045773 2:99481129-99481151 ATTGATAATCTATTTGTGTTAGG - Intronic
935837379 2:107069697-107069719 ATTGAGTAGCTTCTGGTTGTGGG - Intergenic
936550724 2:113437526-113437548 CTTAATAAGCTACTGGCTGTAGG - Intergenic
936845791 2:116831331-116831353 ATTGAAAAACTACAGGTGGGTGG + Intergenic
936928626 2:117763617-117763639 GATGATAAGATACTGGCGGTGGG + Intergenic
941881419 2:170484136-170484158 ATTGAGAACCTACTGATGGTGGG + Intronic
946916226 2:224524961-224524983 AATAATAAGCTAATGGGGGTGGG + Intronic
1169301158 20:4443107-4443129 ATTTATAAACTGCGGGTGGTAGG + Intergenic
1169685904 20:8271370-8271392 ATTGAGATTCTACTGGAGGTAGG - Intronic
1172337523 20:34129685-34129707 ATTGATAGGGTACTGGCGGTTGG - Intergenic
1174771308 20:53303032-53303054 ATTTATAAGGTACATGTGGTTGG - Intronic
1176848601 21:13895530-13895552 AGTGTTAAGCCACTGGTGGACGG - Intergenic
1177248978 21:18568064-18568086 ATTGATAAGCTACTGGCGGTTGG + Intergenic
1180837896 22:18940396-18940418 ATTGATAGGCTACTGGCGGTTGG - Intergenic
1181535353 22:23539572-23539594 ATTGATAAACTACCAGCGGTTGG - Intergenic
950030927 3:9852858-9852880 ATTGATAAGCTACTGGTGGTTGG + Intronic
952316395 3:32236449-32236471 TATGATAAGCTCATGGTGGTTGG - Intergenic
952871056 3:37901820-37901842 ATATTTAAGCTACTTGTGGTTGG - Intronic
956441966 3:69289482-69289504 ATTGTTGAGCTACAGGTTGTGGG - Intronic
957069151 3:75552155-75552177 GTTGATAAACTACCGATGGTTGG - Intergenic
959070033 3:101693616-101693638 ATTGATAAGCTACTGGCGGTTGG - Intergenic
960028183 3:113031699-113031721 ATTGATAGGCTACTGGCGGTTGG + Intergenic
961296881 3:125892016-125892038 ATTGATAAGCTTCTGGCGGTTGG - Intergenic
963696045 3:148566833-148566855 ATTGATAAGCTACTGGCGGTTGG + Intergenic
964648252 3:158981946-158981968 ATTGATGAGCTGATGGTGGATGG + Intronic
966319644 3:178686888-178686910 ATTCATAATCTACAGTTGGTTGG - Intronic
967026615 3:185569987-185570009 ATTGATAGGCTACTGGCGGTTGG + Intergenic
969001367 4:3985117-3985139 GTTGATAAACTACCGATGGTTGG + Intergenic
969752647 4:9123582-9123604 GTTGATAAACTACCGATGGTTGG - Intergenic
969812551 4:9659745-9659767 GTTGATAAACTACCGATGGTTGG - Intergenic
977086650 4:92607455-92607477 ATTATTAAGTTACTGGGGGTGGG + Intronic
979655526 4:123188968-123188990 ATTGAAAAGCAACTGGGTGTTGG + Intronic
980311398 4:131134294-131134316 ATTGATAACATGCTTGTGGTTGG - Intergenic
982876743 4:160660341-160660363 ATTGATAAGCTACTGGCGGTTGG - Intergenic
983215339 4:164997395-164997417 ATTGATAAGCTACTGGTGGTTGG - Intergenic
983895106 4:173072867-173072889 ATTAATAAGCTATTGTGGGTGGG + Intergenic
986364657 5:7018677-7018699 TTTAATAAGCTACTTGAGGTGGG + Intergenic
987330191 5:16850249-16850271 ATAAATAAGCAACTGGAGGTTGG - Intronic
988380749 5:30494371-30494393 ATTGATAGGCTACTGGCGGTTGG + Intergenic
989837178 5:46007461-46007483 ATTGCTAAGCTACTGGTGGTTGG + Intergenic
993675093 5:90807330-90807352 AGTGAAAAGATACTGGTGTTAGG - Intronic
998908431 5:146931957-146931979 ATGGATATGCTGCTGGAGGTTGG - Intronic
999752868 5:154642783-154642805 ATTGATAAACTACCAGTGGTTGG + Intergenic
999816602 5:155183293-155183315 ATTGGGAAGCTATTAGTGGTGGG + Intergenic
999952447 5:156665141-156665163 ATTGATAGGCTACTGGCGGTTGG + Intronic
1005729602 6:28684251-28684273 ATTGATAGGCTACTGGCAGTTGG - Intergenic
1006130294 6:31865018-31865040 TTTGGGAAGCTGCTGGTGGTCGG - Exonic
1007542847 6:42665744-42665766 ATTGAAGAGCTTCTGGAGGTGGG + Intronic
1007572311 6:42901777-42901799 ACTGATAAATTACTGGTGGTTGG + Intergenic
1008084594 6:47230909-47230931 ATTGCTAAGGTTCTGGTTGTTGG + Intergenic
1008234627 6:49029156-49029178 ATTGATATGCTACTGCCTGTGGG - Intergenic
1008678603 6:53847694-53847716 ATTGATCAGCATCTCGTGGTTGG - Intronic
1010592234 6:77724630-77724652 ATTGATAGGCTACTGGCGGTTGG + Intronic
1012291211 6:97458070-97458092 TTTGAAAAGCTACAGATGGTAGG - Intergenic
1012940013 6:105405464-105405486 TTTGATAAGCAACTTGAGGTGGG - Intergenic
1017303304 6:152887449-152887471 AGTGATAAGATACTGAGGGTGGG - Intergenic
1019976907 7:4590153-4590175 ATTGATAGGCTACTGGCGGTTGG + Intergenic
1019977842 7:4598656-4598678 ATTGATAGGCTACTGGCGGTTGG + Intergenic
1020606449 7:10343940-10343962 ATTAATAATCTACTGGTGTTGGG - Intergenic
1023525497 7:41098393-41098415 ATTGAAAAAGTCCTGGTGGTGGG - Intergenic
1024828728 7:53422528-53422550 CTTGCTGAGCTGCTGGTGGTGGG + Intergenic
1029967192 7:104752046-104752068 ATTGATAGGCTACTGGCGGTTGG + Intronic
1030617443 7:111752992-111753014 GTTGATAAGCTATTGGGGGGGGG + Intronic
1033482431 7:141755240-141755262 ATTGATAGGCTACTGGCAGTTGG + Intronic
1035991281 8:4493397-4493419 ATTCTAAAGCTACTGATGGTCGG + Intronic
1036292451 8:7505601-7505623 ATTGATAGGCTACTGGCGGTTGG + Intronic
1036375862 8:8198976-8198998 GTTGATAAACTACCGATGGTTGG - Intergenic
1036853666 8:12224167-12224189 GTTGATAAACTACCGATGGTTGG + Intergenic
1036875042 8:12466677-12466699 GTTGATAAACTACCGATGGTTGG + Intergenic
1039711815 8:40062397-40062419 ATTGTTAAGATGCTGGTAGTGGG - Intergenic
1044179273 8:89168278-89168300 ATTGAAATGCTACTGGAGGAAGG - Intergenic
1046714183 8:117549230-117549252 ATTGACAAGCTACTGGGGAAGGG - Intergenic
1048947416 8:139462217-139462239 ATTGATAGGCTACTGGTGGTTGG + Intergenic
1049876602 8:145027028-145027050 GTTGATAAACTACCAGTGGTTGG + Intergenic
1049902211 9:179290-179312 CTTAATAAGCTACTGGCTGTAGG + Intergenic
1051825788 9:21217321-21217343 ATTGCTAGGCTACTGGAGATGGG + Intronic
1052610321 9:30764536-30764558 ACTGATAAAGTAATGGTGGTAGG - Intergenic
1052633805 9:31073575-31073597 ATTGATACACTACTGGTGGGAGG + Intergenic
1053596832 9:39571348-39571370 ATTGTTAAGCTACAGGGTGTGGG + Intergenic
1053665753 9:40316491-40316513 AGTGTTAAGCCACTGGTGGACGG + Intronic
1053745240 9:41189579-41189601 CTTAATAAGCTACTGGCTGTAGG + Intronic
1053915336 9:42941537-42941559 AGTGTTAAGCCACTGGTGGACGG + Intergenic
1054376909 9:64456521-64456543 AGTGTTAAGCCACTGGTGGACGG + Intergenic
1054482031 9:65675634-65675656 CTTAATAAGCTACTGGCTGTAGG - Intronic
1054518860 9:66059793-66059815 AGTGTTAAGCCACTGGTGGACGG - Intergenic
1054569420 9:66793654-66793676 ATTGTTAAGCTACAGGGTGTGGG - Intergenic
1054683107 9:68241689-68241711 CTTAATAAGCTACTGGCTGTAGG - Exonic
1055497413 9:76869246-76869268 ATAGATAAGCGACTGGAAGTGGG + Intronic
1057245143 9:93449029-93449051 ATTGAGTAGCTATTGATGGTGGG - Intronic
1060044677 9:120330365-120330387 ATTGGTAAGCTACTTGTGACTGG - Intergenic
1060649748 9:125315165-125315187 ATTGATAAAGTGATGGTGGTTGG + Intronic
1061242494 9:129382721-129382743 ATTGGGAAGCTATTGGTGGGAGG - Intergenic
1061628211 9:131854905-131854927 AGTGATGAGCTCCTGCTGGTGGG + Intergenic
1062487634 9:136787947-136787969 ATTGATAGGCTACCGGCAGTTGG + Intergenic
1202781368 9_KI270718v1_random:363-385 CTTAATAAGCTACTGGCTGTAGG + Intergenic
1203488852 Un_GL000224v1:84645-84667 TTTGATAAGTTCCTGGTAGTGGG - Intergenic
1203501473 Un_KI270741v1:26540-26562 TTTGATAAGTTCCTGGTAGTGGG - Intergenic
1185589903 X:1269236-1269258 ATTGCTAAGCTACAGGGCGTTGG + Intronic
1188789470 X:34390381-34390403 ATTGAACAACTACTGGTGGTAGG + Intergenic
1196797249 X:119512388-119512410 TTTGATAAGCTATTTGTGGAGGG - Intergenic
1197563932 X:128057698-128057720 ATTAATAATCTAGTGTTGGTTGG - Intergenic
1200753107 Y:6965067-6965089 GTTGATAAGCTGCCGGTGGTTGG + Intronic