ID: 950031798

View in Genome Browser
Species Human (GRCh38)
Location 3:9858652-9858674
Sequence ATGCTCTTCTTGAGGCTAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950031798_950031807 18 Left 950031798 3:9858652-9858674 CCCTTTAGCCTCAAGAAGAGCAT No data
Right 950031807 3:9858693-9858715 CTGAAACCTAAACTACATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950031798 Original CRISPR ATGCTCTTCTTGAGGCTAAA GGG (reversed) Intergenic
No off target data available for this crispr