ID: 950031807

View in Genome Browser
Species Human (GRCh38)
Location 3:9858693-9858715
Sequence CTGAAACCTAAACTACATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950031799_950031807 17 Left 950031799 3:9858653-9858675 CCTTTAGCCTCAAGAAGAGCATG No data
Right 950031807 3:9858693-9858715 CTGAAACCTAAACTACATTCTGG No data
950031802_950031807 10 Left 950031802 3:9858660-9858682 CCTCAAGAAGAGCATGAGGGACC No data
Right 950031807 3:9858693-9858715 CTGAAACCTAAACTACATTCTGG No data
950031798_950031807 18 Left 950031798 3:9858652-9858674 CCCTTTAGCCTCAAGAAGAGCAT No data
Right 950031807 3:9858693-9858715 CTGAAACCTAAACTACATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950031807 Original CRISPR CTGAAACCTAAACTACATTC TGG Intergenic
No off target data available for this crispr