ID: 950031811

View in Genome Browser
Species Human (GRCh38)
Location 3:9858737-9858759
Sequence TGTGCCCTAGAAAGCTGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950031806_950031811 25 Left 950031806 3:9858689-9858711 CCTTCTGAAACCTAAACTACATT No data
Right 950031811 3:9858737-9858759 TGTGCCCTAGAAAGCTGTGAAGG No data
950031805_950031811 26 Left 950031805 3:9858688-9858710 CCCTTCTGAAACCTAAACTACAT No data
Right 950031811 3:9858737-9858759 TGTGCCCTAGAAAGCTGTGAAGG No data
950031808_950031811 15 Left 950031808 3:9858699-9858721 CCTAAACTACATTCTGGCCTGAG No data
Right 950031811 3:9858737-9858759 TGTGCCCTAGAAAGCTGTGAAGG No data
950031810_950031811 -8 Left 950031810 3:9858722-9858744 CCATTTTGCACTGTCTGTGCCCT No data
Right 950031811 3:9858737-9858759 TGTGCCCTAGAAAGCTGTGAAGG No data
950031809_950031811 -2 Left 950031809 3:9858716-9858738 CCTGAGCCATTTTGCACTGTCTG No data
Right 950031811 3:9858737-9858759 TGTGCCCTAGAAAGCTGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950031811 Original CRISPR TGTGCCCTAGAAAGCTGTGA AGG Intergenic
No off target data available for this crispr