ID: 950033385

View in Genome Browser
Species Human (GRCh38)
Location 3:9866799-9866821
Sequence TCATGGTGCTCTCTACCTTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 2, 1: 0, 2: 0, 3: 19, 4: 204}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950033385_950033389 8 Left 950033385 3:9866799-9866821 CCAGAAGGTAGAGAGCACCATGA 0: 2
1: 0
2: 0
3: 19
4: 204
Right 950033389 3:9866830-9866852 CCTGCGAGGCCAGATTGCTAAGG 0: 1
1: 0
2: 0
3: 6
4: 68
950033385_950033390 9 Left 950033385 3:9866799-9866821 CCAGAAGGTAGAGAGCACCATGA 0: 2
1: 0
2: 0
3: 19
4: 204
Right 950033390 3:9866831-9866853 CTGCGAGGCCAGATTGCTAAGGG 0: 1
1: 0
2: 1
3: 5
4: 85
950033385_950033387 -6 Left 950033385 3:9866799-9866821 CCAGAAGGTAGAGAGCACCATGA 0: 2
1: 0
2: 0
3: 19
4: 204
Right 950033387 3:9866816-9866838 CCATGAAAGTACAGCCTGCGAGG 0: 1
1: 1
2: 0
3: 8
4: 63
950033385_950033393 28 Left 950033385 3:9866799-9866821 CCAGAAGGTAGAGAGCACCATGA 0: 2
1: 0
2: 0
3: 19
4: 204
Right 950033393 3:9866850-9866872 AGGGGCAGACTTCATGCCAATGG 0: 2
1: 0
2: 0
3: 7
4: 149
950033385_950033391 10 Left 950033385 3:9866799-9866821 CCAGAAGGTAGAGAGCACCATGA 0: 2
1: 0
2: 0
3: 19
4: 204
Right 950033391 3:9866832-9866854 TGCGAGGCCAGATTGCTAAGGGG 0: 1
1: 0
2: 1
3: 5
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950033385 Original CRISPR TCATGGTGCTCTCTACCTTC TGG (reversed) Exonic
900186365 1:1334984-1335006 TCATGATGCTGTCTACCCACTGG - Exonic
901549963 1:9988864-9988886 TCATGCTGGTCTCTAACTCCTGG + Intergenic
902435843 1:16397729-16397751 TCAGGGTGCTCCCCACCTGCAGG + Exonic
903188160 1:21640980-21641002 TCATGGTAATCTCCACCTCCTGG + Intronic
906117052 1:43364003-43364025 TCATGCTGTTCTCCAACTTCTGG - Exonic
907172739 1:52485017-52485039 TCATGGTGCTCACATACTTCTGG - Intronic
907768630 1:57437302-57437324 TCATGTAGCCCTATACCTTCTGG - Intronic
908524310 1:64973043-64973065 TCACTGTGGCCTCTACCTTCTGG - Intergenic
909205546 1:72752471-72752493 TCATGGTACTCTCTCCATTGGGG - Intergenic
909696571 1:78474148-78474170 CCATGCTGCTCTCTAACTCCTGG - Intronic
910647068 1:89525209-89525231 TCGTTGTGCTCCCTGCCTTCGGG + Intronic
912139225 1:106701434-106701456 TCATATGGCTGTCTACCTTCTGG - Intergenic
912286157 1:108371793-108371815 TCAGGCTGCTCTCAAACTTCTGG - Intergenic
913317908 1:117567801-117567823 TCATGATGCTCCCTACCTTTGGG + Intergenic
913489732 1:119367789-119367811 TCATTTTGCTCTCTAACTACAGG + Intergenic
914456831 1:147844214-147844236 TCATCTTGATCTCTGCCTTCAGG - Intergenic
915081421 1:153355215-153355237 TCATGGAGCTCTCAACTTTCAGG - Intergenic
915563390 1:156700586-156700608 TCTTGGGGCCCTCTCCCTTCAGG + Exonic
915587232 1:156850627-156850649 TCACTGTAATCTCTACCTTCTGG + Intronic
917751087 1:178054113-178054135 TCAGGCTGCTCTCTAACTTCTGG - Intergenic
918185977 1:182128159-182128181 ACATTGTGCTCTCTACCTGGAGG - Intergenic
920279828 1:204834465-204834487 TCCTGCTGCTCTCTTCCTCCAGG + Intronic
920383293 1:205548466-205548488 TCATGGTGGTGTCTCCTTTCTGG - Intergenic
920939651 1:210469741-210469763 TCATAGTGGCCTCTACCTCCTGG + Intronic
923237693 1:232050123-232050145 TCATTGTGGTCTCAAACTTCTGG - Intergenic
923405097 1:233652041-233652063 TCATGGTGGCCTCTGCCTTGGGG - Intronic
923685099 1:236148201-236148223 TTATGGTGCCTTCTACCTCCAGG + Intronic
1065501775 10:26390472-26390494 TCATTCTACTCTCTACCTCCAGG - Intergenic
1067775155 10:49158579-49158601 TCCTGGTGTGCTCTACCTTCTGG - Intronic
1067798542 10:49339425-49339447 TCATGTTTTTCTCTACATTCTGG - Intergenic
1069450484 10:68513332-68513354 TCATGGTATCCTCTGCCTTCTGG - Intronic
1070739656 10:78894383-78894405 TCATGGAGCTCACAACCTACAGG + Intergenic
1071666783 10:87566493-87566515 TCATTGTAGTCTCTACCTCCTGG - Intergenic
1072294452 10:93995444-93995466 CCTTTCTGCTCTCTACCTTCTGG + Intronic
1073808971 10:107131642-107131664 TCATGGTAACCTCTACCTCCCGG - Intronic
1074253709 10:111779463-111779485 TCTTGGTGGTCTCTATGTTCTGG + Intergenic
1074315614 10:112359085-112359107 ACACGGTGTGCTCTACCTTCAGG - Intergenic
1074442059 10:113486663-113486685 CCTTCGTGCTCTCTGCCTTCTGG - Intergenic
1075405556 10:122193389-122193411 TCCTGGTGCTCTCTGCCAGCTGG + Intronic
1075455481 10:122582214-122582236 GCATGGGCCTCTCTGCCTTCTGG - Intronic
1075457604 10:122594917-122594939 GCATGGGCCTCTCTGCCTTCTGG - Intronic
1075458677 10:122601411-122601433 GCATGGTCCTCTCTGCCTTCTGG - Intronic
1075459308 10:122605470-122605492 GCATGGTCCTCTCTGCCTTCTGG - Intronic
1075459940 10:122609529-122609551 GCATGGTCCTCTCTGCCTTCTGG - Intronic
1075460572 10:122613588-122613610 GCATGGTCCTCTCTGCCTTCTGG - Intronic
1077236878 11:1486135-1486157 TCTTGGTGTCCTCGACCTTCGGG - Intronic
1079357669 11:19743457-19743479 TCCTGGTGCTTTCTCCCTCCTGG + Intronic
1080505281 11:32906620-32906642 TCAGGGTGGTCTCAAACTTCTGG + Intronic
1083178305 11:60967097-60967119 TCTAGGTCCTCTCTTCCTTCTGG + Intergenic
1083674758 11:64319107-64319129 TCATCCTGCTCTCAACCTTTGGG + Intronic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1085980703 11:81720295-81720317 TCATGCTGCTCTCAAACTCCTGG - Intergenic
1086292128 11:85323687-85323709 TCATACTACTCTCTACCTTCAGG + Intronic
1087175438 11:95091039-95091061 TCATGGTGTTCTGTCCCGTCTGG + Intronic
1089532756 11:119141854-119141876 TCACTGTGATCTCTACCTCCTGG - Intergenic
1091898101 12:4120720-4120742 TCATGGATCTCTCTAGTTTCTGG - Intergenic
1092065147 12:5583946-5583968 GCATGGTGCTCCGTGCCTTCAGG - Intronic
1102121757 12:110447561-110447583 TCAGGGTGGTCTCGATCTTCTGG - Intronic
1102296016 12:111737255-111737277 TCACTGTAATCTCTACCTTCTGG + Intronic
1102546671 12:113662309-113662331 TCATGGCAACCTCTACCTTCTGG + Intergenic
1102750759 12:115291846-115291868 TCATGTTACTCTCTACCATGGGG - Intergenic
1102786748 12:115611320-115611342 TCATGGTGCTCACTATCTATTGG + Intergenic
1104927799 12:132322625-132322647 CCATGGTGCTTCCTACGTTCTGG - Intronic
1106355050 13:28973876-28973898 TGATGGTGCTCTCTGCTGTCGGG + Intronic
1107037222 13:35914106-35914128 CCAGGGTGGTCTCTAACTTCTGG - Intronic
1108353576 13:49609444-49609466 TCATGGTGGCCTCTACCTCCTGG + Intergenic
1109416572 13:62048164-62048186 TCATGGCTCTCTCTTCATTCAGG + Intergenic
1112391147 13:98985405-98985427 TCGTGGAGCTTTCTACCTGCGGG - Intronic
1115545757 14:34463414-34463436 TCAGGCTGGTCTCGACCTTCTGG - Intergenic
1116378195 14:44230540-44230562 TCATTGTGCTCTTTAGCTCCAGG - Intergenic
1117568799 14:57024466-57024488 TCATTGTGACCTCAACCTTCTGG - Intergenic
1118566851 14:67150763-67150785 TCAAGTTGGTCTCTAACTTCTGG + Intronic
1119160186 14:72446047-72446069 TCAGGCTGGTCTCTAACTTCTGG - Intronic
1119824630 14:77647215-77647237 ACATGGTTCTCTCTTCCCTCTGG - Intergenic
1122514300 14:102296169-102296191 TCACTGTACTCTCCACCTTCTGG - Intronic
1123873760 15:24602648-24602670 TCAGGCTGCTCTCAAACTTCTGG + Intergenic
1124203841 15:27700673-27700695 TCATTTTACTCTCTACCTCCAGG + Intergenic
1127778468 15:62289317-62289339 TCATGGTGGTCTCGAACTCCTGG - Intergenic
1129168632 15:73794255-73794277 TCATGGTGCCCACTGCCTCCTGG + Intergenic
1129859044 15:78846493-78846515 TCATTGTACCCTCTACCTCCCGG + Intronic
1132749567 16:1451280-1451302 TCATTGTGGCCTCAACCTTCTGG + Intronic
1134254230 16:12598566-12598588 TCATTGTACCCTCTACCTCCTGG + Intergenic
1137787341 16:51150336-51150358 TCGTGGTGCTCCCTACTTCCAGG - Intronic
1138148743 16:54636228-54636250 TCATTGTGCTACCTTCCTTCGGG + Intergenic
1143486366 17:7257178-7257200 TCAGGGTGGTCTCAAACTTCTGG + Intronic
1147776242 17:42903629-42903651 TCATTGTGACCTCTACCTCCTGG - Intronic
1148667438 17:49385117-49385139 CCTTGGTCCTCTCTTCCTTCTGG - Intronic
1149182169 17:53952182-53952204 TCATTTTTCTCTCTGCCTTCTGG - Intergenic
1151686854 17:75652566-75652588 TCAGGGTGCTCCCTACCTGCAGG - Intronic
1153079251 18:1201848-1201870 TCATGGTAGTCTCTGCCTCCTGG + Intergenic
1153234699 18:2974780-2974802 CCAGGCTGCTCTCCACCTTCTGG - Intronic
1153791160 18:8580981-8581003 TCATGGTAACCTCTACCTCCTGG - Intergenic
1156467259 18:37355717-37355739 TCATGGCACTCTCTCTCTTCAGG - Intronic
1156962887 18:43054239-43054261 TCATAATCCTGTCTACCTTCAGG - Intronic
1157403290 18:47403786-47403808 TCATGGTTTTCCCTCCCTTCTGG - Intergenic
1158467206 18:57701486-57701508 TAGTGGTTCTCTCTAGCTTCTGG + Intronic
1160173311 18:76572297-76572319 TCACTGTGATCTCTACCTTCAGG - Intergenic
1162419908 19:10560219-10560241 ACATGGTGCCCTCTGCCTCCTGG + Intronic
1162446415 19:10725635-10725657 ACATGGTGGTCTCTGCCTACTGG + Intronic
1162505471 19:11081690-11081712 TCATACTGCTCTATACCCTCTGG - Intergenic
1162763866 19:12905847-12905869 TCAGGCTGCTCTCAAACTTCTGG + Intronic
1163383032 19:16981141-16981163 TCAGGCTGCTCTCTAACTTCTGG - Intronic
926208441 2:10850587-10850609 TCAAGGTGGTCTCAAACTTCTGG - Intronic
926587648 2:14706101-14706123 TCATGGTTCTCTCCAGCTTCTGG + Intergenic
926757217 2:16245798-16245820 TCACTCTGCTCTCTGCCTTCTGG + Intergenic
927360040 2:22222586-22222608 TTATGGTGCACTCTAACTTTTGG + Intergenic
928169585 2:28994856-28994878 CCATGGTGCCCCTTACCTTCGGG - Exonic
928841608 2:35612249-35612271 TCAGGGTGGTCTCCAACTTCTGG - Intergenic
930821902 2:55654485-55654507 TTCTGGAGCTCTCTACCTTTTGG + Intronic
933734651 2:85486147-85486169 TCAGGCTGCTCTCAAACTTCTGG + Intergenic
935214249 2:100963623-100963645 CCATGGTGGTCTCGAACTTCTGG + Intronic
935307016 2:101747022-101747044 TCATAGTCCACTCTACCCTCAGG - Intronic
937039611 2:118810757-118810779 TCATGGTGCTCTCTGAGGTCAGG - Intergenic
940895959 2:159081953-159081975 TCAGGGTGCTCCCCACCTGCAGG + Intronic
941698636 2:168579826-168579848 TCAAGGTGCTCTCTGCTTGCTGG + Intronic
942129029 2:172859682-172859704 CCAGGGTGCACTTTACCTTCAGG - Intronic
944869231 2:203893174-203893196 TCATTGTAACCTCTACCTTCTGG + Intergenic
947186484 2:227459803-227459825 TCATTGTGGTCTCTGCCTCCTGG - Intergenic
1168857688 20:1020224-1020246 TCAGGGAGCTCACTTCCTTCAGG - Intergenic
1169611768 20:7388913-7388935 TCAGGCTGTTCTCTAACTTCTGG - Intergenic
1171394696 20:24824378-24824400 ACATGGTACTGTCCACCTTCCGG - Intergenic
1175061467 20:56247647-56247669 CCAGGGTGCTCTCTGCCTCCAGG + Intergenic
1177953418 21:27567324-27567346 ACATGGTCATCTCTAACTTCAGG - Intergenic
1179377350 21:40862506-40862528 TCATGGCGTTCTCTGCCTTGGGG + Intergenic
1181388804 22:22564343-22564365 TCATGCTGCTCCCTACCTGAAGG - Exonic
1184182826 22:42842520-42842542 TCATGGTAATCTCTGCCTTCTGG + Intronic
1184392892 22:44215478-44215500 TCATGGTGCTTTTTCCCTTGTGG + Intronic
1184891796 22:47384160-47384182 CCATGCTGCTCTCTACTCTCAGG - Intergenic
1185157183 22:49201060-49201082 TCATTGTACTTTCTACATTCTGG + Intergenic
949193552 3:1279075-1279097 TAATGGTGATCTATCCCTTCCGG - Intronic
950033385 3:9866799-9866821 TCATGGTGCTCTCTACCTTCTGG - Exonic
950055024 3:10017579-10017601 TCATGGTGCTCTCTACCTTCTGG - Intergenic
952237666 3:31497034-31497056 TCATGTGTCTTTCTACCTTCAGG - Intergenic
954448703 3:50560273-50560295 TCATGGTGCTCTGGCCCTTGGGG + Intronic
957635402 3:82777649-82777671 TCATTCTACTCTCTACCTTCAGG - Intergenic
959083973 3:101831981-101832003 TCACTGTGTCCTCTACCTTCTGG + Intronic
960647791 3:119908666-119908688 TTATTATGCTCTCTACCCTCTGG + Intronic
963455314 3:145539275-145539297 TCATGCTGGTCTCCAACTTCCGG + Intergenic
965407605 3:168289969-168289991 TCATGGTGCTCTGTTCCCTAAGG - Intergenic
965758192 3:172046530-172046552 TCAGGCTGGTCTCTAACTTCTGG + Intronic
967709549 3:192689038-192689060 TCATTGTACTCTCTACATCCTGG - Intronic
967925705 3:194644830-194644852 TGATGGAGCTTTCTGCCTTCTGG + Intronic
969133955 4:5015014-5015036 TTATGTATCTCTCTACCTTCTGG - Exonic
970681066 4:18508858-18508880 TCATGTTGGTCTCTGCTTTCTGG - Intergenic
970883327 4:20957879-20957901 TCATGGTATTCTCTGCTTTCTGG + Intronic
971319695 4:25595459-25595481 TCATCCTTCTCTCTCCCTTCTGG + Intergenic
975821880 4:78279140-78279162 TCATGCGGCTCCCTCCCTTCAGG - Intronic
977775382 4:100913600-100913622 TGTTTCTGCTCTCTACCTTCAGG + Intergenic
980634480 4:135482073-135482095 TCATGGTCCTCACTTCATTCTGG + Intergenic
980783741 4:137525673-137525695 TCCTGGTGCTCGATACCTCCAGG + Intronic
981080646 4:140636081-140636103 TCATGGTGCTCACAACCATTAGG + Intronic
983603927 4:169563284-169563306 TCATGGTAGCCTCTACCTCCTGG - Intronic
993306202 5:86278551-86278573 TCAGGCTGCTCTCAAACTTCTGG - Intergenic
996585228 5:125079996-125080018 TCAGGCTGGTCTCAACCTTCTGG + Intergenic
996658924 5:125975800-125975822 TCATCATCCTCTCTATCTTCTGG - Intergenic
997424309 5:133792869-133792891 TCATTGTGCTCTCTGCCATTTGG - Intergenic
1000376020 5:160583209-160583231 TCATGGATTTATCTACCTTCGGG + Intronic
1001917375 5:175573167-175573189 TCATGCTGCTCTGAACCTTTGGG - Intergenic
1001965761 5:175908781-175908803 TCATGGCTCTCTCTGCCTCCAGG + Intergenic
1002251184 5:177930415-177930437 TCATGGCTCTCTCTGCCTCCAGG - Intergenic
1002855604 6:1035536-1035558 TCTTGGTGCTGTTTACCATCTGG - Intergenic
1002963658 6:1941450-1941472 TCATGGTGATCACTCCCTCCTGG - Intronic
1003306924 6:4937419-4937441 TCACTGTGCTCTCTAACTCCTGG - Intronic
1010007334 6:71010374-71010396 TCATCCTGCACTCTACCATCAGG - Intergenic
1010311231 6:74388341-74388363 TCATTCTGCTCTCTTCCTACTGG - Intergenic
1011699046 6:89938751-89938773 ACATGGGGCTCTCTTCATTCAGG - Intronic
1013237980 6:108215607-108215629 TCCTGCTGATCTCTCCCTTCTGG + Intronic
1015289516 6:131522629-131522651 TCATTCTGCTCTCTACCTCCAGG + Intergenic
1016074499 6:139779836-139779858 TCATGGTGGCCTCAACCTCCTGG + Intergenic
1017134757 6:151138672-151138694 TCAGGGTGGTCTCAAACTTCTGG - Intergenic
1019722341 7:2580684-2580706 TCCTGGTGCTCTGTCCCTGCTGG - Intronic
1022213438 7:28234283-28234305 CCAAGGTGGTCTCTAACTTCTGG + Intergenic
1023496855 7:40807146-40807168 TAATGATTCTCTCTAACTTCTGG - Intronic
1024146300 7:46520886-46520908 CCAGGCTGCTCTCTAACTTCTGG - Intergenic
1026112159 7:67466917-67466939 TCATGGAGCTGCCTACCTACTGG + Intergenic
1026309418 7:69170839-69170861 TCCTGCTGTTCTCTACCTTCAGG - Intergenic
1026924204 7:74178338-74178360 TCAGGGTGGTCTCAAACTTCTGG - Intronic
1026942926 7:74298258-74298280 TCACTGTGATCTCCACCTTCTGG + Intronic
1027554579 7:79647833-79647855 TCAAGGTGCTCTCAGTCTTCTGG + Intergenic
1028228456 7:88276856-88276878 TCAGAGTGCTCTTTAGCTTCAGG + Exonic
1028291144 7:89066315-89066337 TCATTGTGCCCTGTAGCTTCAGG - Intronic
1028520636 7:91726764-91726786 TCATTCTACTCTCTACCGTCAGG - Intronic
1028687610 7:93609783-93609805 TCCTGGTGATCTCCATCTTCAGG + Intronic
1029443118 7:100599018-100599040 TCATGGTGATCTCGAACTCCGGG - Intronic
1030267378 7:107634310-107634332 TCACTGTGGTCTCGACCTTCTGG - Intergenic
1032033877 7:128507163-128507185 TCAGGGTGATCGCTGCCTTCAGG - Intergenic
1032223170 7:130009445-130009467 TTTTGGTGCTCCCTTCCTTCAGG + Intergenic
1032710343 7:134455656-134455678 TCATGGCAACCTCTACCTTCTGG + Intronic
1032832419 7:135641557-135641579 CCAGGCTGGTCTCTACCTTCTGG - Intronic
1033248747 7:139740577-139740599 TCATGGTCCTCACTCCCTCCGGG - Intronic
1036365946 8:8120630-8120652 TCAGGTTGGTCTCGACCTTCTGG - Intergenic
1041008425 8:53518105-53518127 TGCTGGTGCTTTCTAGCTTCAGG - Intergenic
1046829170 8:118725172-118725194 ACATGGTGCCATCTAACTTCAGG + Intergenic
1048196695 8:132337277-132337299 TCATGCTGGTCTCAAACTTCTGG - Intronic
1051122771 9:13769939-13769961 ACATGGAACTTTCTACCTTCAGG - Intergenic
1051489879 9:17650444-17650466 TCATGGAGACCTCTGCCTTCCGG + Intronic
1052414027 9:28155126-28155148 ACATGGTGCTTTCCACCTTTGGG + Intronic
1052714061 9:32093566-32093588 TCATTGTTCTCTCTACCTGGTGG + Intergenic
1053616950 9:39777389-39777411 CCAGGGTGGTCTCTATCTTCTGG + Intergenic
1053875130 9:42536742-42536764 CCAGGGTGGTCTCTATCTTCTGG + Intergenic
1053897503 9:42757886-42757908 CCAGGGTGGTCTCTATCTTCTGG - Intergenic
1054236567 9:62564986-62565008 CCAGGGTGGTCTCTATCTTCTGG - Intergenic
1054267218 9:62930048-62930070 CCAGGGTGGTCTCTATCTTCTGG - Intergenic
1054550706 9:66599493-66599515 CCAGGGTGGTCTCTATCTTCTGG - Intergenic
1055998475 9:82189003-82189025 TCATCCTGCTCTCTACCTGAAGG + Intergenic
1056485495 9:87052994-87053016 TCATTGTACTCTCCACCTTCAGG - Intergenic
1057598765 9:96438994-96439016 TTATGGAGCTCTGTACTTTCTGG + Intergenic
1057805196 9:98214976-98214998 TCAGCTTGCTCTCTGCCTTCTGG + Intronic
1058790593 9:108440955-108440977 GGATGGTGGTCTCCACCTTCAGG - Intergenic
1059380179 9:113917318-113917340 TCATTGTACTCACTACCTCCCGG + Intronic
1059472646 9:114518039-114518061 TCACTGTAGTCTCTACCTTCTGG + Intergenic
1060053959 9:120397439-120397461 TCAGGCTGCTCTCAAACTTCTGG + Intronic
1188848053 X:35098516-35098538 TGTTGGTGTTCTCTACCTTAGGG - Intergenic
1190947177 X:55107038-55107060 CCATTCTCCTCTCTACCTTCAGG - Intronic
1191269479 X:58444980-58445002 CCATGGGGGTCTCTGCCTTCTGG + Intergenic
1193961727 X:87934107-87934129 ACATGGTGTTCTCTAACTCCTGG + Intergenic
1194355637 X:92881066-92881088 TCAGGCTGCTCTCTAACTCCTGG - Intergenic
1194758417 X:97765226-97765248 TCATGTTGCTGTGTACCTGCTGG - Intergenic
1198073719 X:133174694-133174716 TTATGGTGCTTTCTACTTTAAGG - Intergenic
1199768981 X:150961820-150961842 GCATGGTGCACGCTATCTTCTGG - Intergenic
1199770621 X:150973088-150973110 TCATGGTGCTCACTGTCTCCTGG + Intergenic
1200417625 Y:2929278-2929300 TCAGGGTGGTCTCTAACTCCTGG + Intronic
1200663984 Y:5998057-5998079 TCAGGCTGCTCTCTAACTCCTGG - Intergenic
1201515183 Y:14812718-14812740 TCATTTTGCTCTCTACAATCAGG + Intronic
1201896174 Y:18994743-18994765 TGCTGCTGCTCTCTAGCTTCAGG - Intergenic