ID: 950036701

View in Genome Browser
Species Human (GRCh38)
Location 3:9890998-9891020
Sequence GCTCCACCCCTTGTTCCGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 85}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950036694_950036701 -6 Left 950036694 3:9890981-9891003 CCCCGTGGCCCCCGCGAGCTCCA 0: 1
1: 0
2: 0
3: 5
4: 133
Right 950036701 3:9890998-9891020 GCTCCACCCCTTGTTCCGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 85
950036687_950036701 15 Left 950036687 3:9890960-9890982 CCTGTCCCCCATCCTGGAAAGCC 0: 1
1: 0
2: 0
3: 27
4: 322
Right 950036701 3:9890998-9891020 GCTCCACCCCTTGTTCCGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 85
950036692_950036701 7 Left 950036692 3:9890968-9890990 CCATCCTGGAAAGCCCCGTGGCC 0: 1
1: 1
2: 1
3: 11
4: 147
Right 950036701 3:9890998-9891020 GCTCCACCCCTTGTTCCGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 85
950036695_950036701 -7 Left 950036695 3:9890982-9891004 CCCGTGGCCCCCGCGAGCTCCAC 0: 1
1: 0
2: 0
3: 8
4: 143
Right 950036701 3:9890998-9891020 GCTCCACCCCTTGTTCCGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 85
950036691_950036701 8 Left 950036691 3:9890967-9890989 CCCATCCTGGAAAGCCCCGTGGC 0: 1
1: 0
2: 0
3: 7
4: 87
Right 950036701 3:9890998-9891020 GCTCCACCCCTTGTTCCGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 85
950036693_950036701 3 Left 950036693 3:9890972-9890994 CCTGGAAAGCCCCGTGGCCCCCG 0: 1
1: 0
2: 2
3: 15
4: 186
Right 950036701 3:9890998-9891020 GCTCCACCCCTTGTTCCGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 85
950036696_950036701 -8 Left 950036696 3:9890983-9891005 CCGTGGCCCCCGCGAGCTCCACC 0: 1
1: 0
2: 2
3: 18
4: 241
Right 950036701 3:9890998-9891020 GCTCCACCCCTTGTTCCGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 85
950036689_950036701 9 Left 950036689 3:9890966-9890988 CCCCATCCTGGAAAGCCCCGTGG 0: 1
1: 0
2: 1
3: 16
4: 150
Right 950036701 3:9890998-9891020 GCTCCACCCCTTGTTCCGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 85
950036688_950036701 10 Left 950036688 3:9890965-9890987 CCCCCATCCTGGAAAGCCCCGTG 0: 1
1: 0
2: 2
3: 11
4: 122
Right 950036701 3:9890998-9891020 GCTCCACCCCTTGTTCCGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950036701 Original CRISPR GCTCCACCCCTTGTTCCGCC CGG Intronic
901674735 1:10876487-10876509 ACTCCATCCCTTGTTCTGCGTGG + Intergenic
902933362 1:19746560-19746582 GCTGCACCCCTTGTTGCCGCTGG - Exonic
905181023 1:36166742-36166764 GCTCCAGTCTTTGTTCCCCCTGG - Intronic
906482100 1:46205828-46205850 GCCCCACCCCTTGTCCTTCCTGG - Intronic
923310560 1:232730622-232730644 GCCCCATCTCTTGTTCCTCCTGG + Intergenic
923402974 1:233633130-233633152 TCTCCACCCCATGTTTCTCCAGG - Intronic
924625423 1:245693308-245693330 GCTCCAGACCTTGGCCCGCCTGG + Intronic
1063374884 10:5548358-5548380 TCTCCACCCCCTCTTCAGCCCGG - Intergenic
1066441726 10:35445687-35445709 GCTCCACCCCTCCTTCCCTCTGG - Intronic
1067277647 10:44849370-44849392 CCTCCACCTTTTGTTCCGTCTGG - Intergenic
1070783059 10:79148550-79148572 GCTCCACCCCTTTTCCGGACAGG - Intronic
1071299403 10:84245175-84245197 GCTGCACCCCAGGTTCTGCCTGG - Intronic
1071852826 10:89592693-89592715 GCTCCACCCCTTTTTGTGCCTGG + Intronic
1072706303 10:97683608-97683630 GCTCCACCCCTGCCTCCACCAGG - Intronic
1072721726 10:97785028-97785050 TCTCCTCCCCCTGCTCCGCCGGG - Intergenic
1078066408 11:8081736-8081758 GCTCCACCCCCTTATCTGCCAGG + Intronic
1082806583 11:57455595-57455617 GTTCCACACCTTGTTCTGCCTGG - Intergenic
1083678619 11:64341262-64341284 GCTCCACCGCTTCTTCTGCAAGG - Exonic
1084074358 11:66761676-66761698 TGTCCACCCCTTGGTCCGCAAGG + Intronic
1096977253 12:55706694-55706716 CCTCCACCCCTTACTCCTCCTGG + Intronic
1099011564 12:77297365-77297387 GCTCCACCCCTTGTTTCGGGGGG - Intergenic
1101927308 12:108983476-108983498 GCTCCACCCCTTGGCCCCCTGGG + Intronic
1104967985 12:132517957-132517979 GCTCCACCACATTTGCCGCCTGG - Intronic
1107469701 13:40680775-40680797 GCTCTACTCCTTATTCCTCCAGG + Intergenic
1114301505 14:21383464-21383486 ATTCCACCCCTGGTCCCGCCAGG - Intronic
1123571751 15:21618564-21618586 GCTCCACCCCATCTTACCCCTGG - Intergenic
1123608367 15:22061160-22061182 GCTCCACCCCATCTTACCCCTGG - Intergenic
1125781480 15:42273204-42273226 GCCCCACCCCTTGCTCCTCTAGG + Intronic
1127478222 15:59354719-59354741 GCTCCACCCCTTGTGGGGACAGG + Intronic
1128527294 15:68421316-68421338 GCTCCACCCCTGGGGCCTCCGGG - Intronic
1129237220 15:74230881-74230903 GCTCTAACCCTGGTTCTGCCAGG - Intergenic
1202980606 15_KI270727v1_random:352959-352981 GCTCCACCCCATCTTACCCCTGG - Intergenic
1132766693 16:1537940-1537962 GCTTCACCCCCTGCTCGGCCAGG + Intronic
1133636985 16:7676595-7676617 ATTCCACCCCTTGTTTCTCCAGG + Intronic
1136380393 16:29891660-29891682 GCTGCACCCATTGATCAGCCAGG - Intronic
1142260499 16:89040521-89040543 GCTCTAGCCCTTGCTCCCCCAGG - Intergenic
1142364939 16:89645237-89645259 GCTCCTCCCCTTGGGCAGCCTGG - Exonic
1147565614 17:41534843-41534865 CCCCCACCCCTGGGTCCGCCAGG + Intergenic
1148153002 17:45407286-45407308 TCTCCACCCCTTTTTTTGCCTGG + Intronic
1156316344 18:35972483-35972505 GTTCCACCCCTTGGCCTGCCGGG - Exonic
1158321461 18:56268650-56268672 GCTCCACCACTTGTCCCTTCAGG + Intergenic
1162572751 19:11482357-11482379 TCCCCACCCCGTGTTCCTCCCGG + Intronic
1165809317 19:38601294-38601316 GCTCCGCCCCTGTTTCAGCCTGG + Intronic
1165888376 19:39095741-39095763 GCCCCACCCCTACTTCTGCCTGG + Intronic
1167337599 19:48896342-48896364 GCTCCACCCCTTCATCCACTAGG + Intronic
1168075503 19:53978985-53979007 ACCCCACCCCTTTTTTCGCCTGG - Intronic
1168280314 19:55302199-55302221 GCCCCTCCCCTATTTCCGCCAGG - Intronic
928462618 2:31489269-31489291 CCTCCACCCCTTGTGCTTCCTGG - Intergenic
930780021 2:55215577-55215599 GCTCCACCCCTGGGACCGCAAGG - Intronic
933991646 2:87638336-87638358 GGTCCTCCCCATGCTCCGCCGGG - Intergenic
936302197 2:111312486-111312508 GGTCCTCCCCATGCTCCGCCGGG + Intergenic
937469928 2:122166053-122166075 GCTCTACCTCTCTTTCCGCCAGG + Intergenic
947572303 2:231245821-231245843 TCTTCACCCCCTGTTCCCCCTGG + Intronic
1168805926 20:672320-672342 GCTGCACCCTCTGTTCTGCCTGG + Intronic
1169971355 20:11272119-11272141 CCGCCTCCCTTTGTTCCGCCGGG + Intergenic
1172029286 20:31970077-31970099 GCTCCGCCCCCTTTTCCTCCAGG - Intronic
1175243131 20:57564361-57564383 GCTCCACTCCTTATTCTTCCAGG - Exonic
1181045473 22:20212170-20212192 GCTCCACCCCGTGTCCTCCCAGG + Intergenic
1181485947 22:23231905-23231927 GCTCCACTCCTTGGTTCCCCTGG + Intronic
1183951837 22:41356829-41356851 GGGCCACCCCATGTCCCGCCAGG - Intronic
950014266 3:9744809-9744831 GCTCCACCCCTTGCTTCCCTCGG - Intronic
950036701 3:9890998-9891020 GCTCCACCCCTTGTTCCGCCCGG + Intronic
950579367 3:13852506-13852528 GACCCACTCCTTGTTCCGACCGG - Intronic
955347438 3:58171597-58171619 GCTCCAGCCCTTCATCAGCCTGG + Intronic
961009203 3:123424687-123424709 TCTCCACCCCATGTTCAGCCTGG + Intronic
962465122 3:135650459-135650481 GCCCCACCTCTTGTTTCCCCAGG + Intergenic
969528097 4:7714295-7714317 GCTCCTCCCCTTGATGCACCAGG - Exonic
974441378 4:61922798-61922820 GCTCAAACCCTAGTTCAGCCTGG + Intronic
975425041 4:74215455-74215477 CCTCTACCCCTTGTTCTTCCTGG + Intronic
989212115 5:38866497-38866519 GCTGCACCAGTTGTTCCCCCGGG + Intronic
996035151 5:118750546-118750568 ACTCCAGACCTTGTTCAGCCTGG - Intergenic
999489911 5:152039566-152039588 CCTCGACCCCTTGTTCTTCCTGG + Intergenic
1003015010 6:2461463-2461485 GCTCCAAACCTTGTTCCCTCAGG + Intergenic
1013330426 6:109094957-109094979 GCCCCTCCCCTTTCTCCGCCCGG + Intergenic
1015133014 6:129835611-129835633 GCCCCACCCCTTGTGCTTCCCGG - Intronic
1019442069 7:1052519-1052541 GCTCCCCCACTTCTTCCGCCAGG - Intronic
1025829569 7:65038052-65038074 GCCCCACCCCTTTCTCCCCCGGG + Intergenic
1025916806 7:65873001-65873023 GCCCCACCCCTTTCTCCCCCGGG + Intergenic
1026806682 7:73433648-73433670 GCCCCACCCCGTGCTCCGCGTGG + Intergenic
1038488815 8:27955107-27955129 GCCCCACCCCATGTTCATCCAGG + Intronic
1039647360 8:39302751-39302773 GCTCCACCCCTAGCTCCAGCTGG - Intergenic
1048445324 8:134488876-134488898 GCTACACCCTTTGCTCTGCCCGG - Intronic
1048552819 8:135449381-135449403 ACGCCACACCTTGTTCTGCCTGG + Intergenic
1049675723 8:143888036-143888058 GCTCCACCCCTTGCTCCAAGGGG - Intergenic
1051889038 9:21924646-21924668 GCTCCACTCTTGGTTCCTCCAGG - Intronic
1052020702 9:23522353-23522375 CCTCCACCCCCTGTACTGCCAGG + Intergenic
1055349581 9:75372584-75372606 GCTCAATCCCTTGTTCTGCGTGG - Intergenic
1062503695 9:136862178-136862200 GCTGGACCCCTTGTTCCGTTCGG + Exonic
1062601702 9:137321262-137321284 GCTCCACCCCATGGTCCTCAAGG - Intronic
1190265670 X:48826331-48826353 GCACGACCCCTTGCTCCCCCGGG + Intergenic
1191920024 X:66246041-66246063 GCACAACCCCATGTTCCCCCAGG - Intronic