ID: 950036743

View in Genome Browser
Species Human (GRCh38)
Location 3:9891226-9891248
Sequence CCTACCACGTAATATATGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 47}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950036743 Original CRISPR CCTACCACGTAATATATGGT AGG Intronic
903003191 1:20281128-20281150 CCTACCACGTGCTAGATTGTAGG + Intergenic
919556683 1:199064065-199064087 GTTACCACTAAATATATGGTTGG - Intergenic
1065721709 10:28634127-28634149 ACAACCACCTAATATATGGTAGG - Intergenic
1070457273 10:76629856-76629878 CCTCCCACACAATATTTGGTAGG - Intergenic
1076264100 10:129095567-129095589 CCTACCACGTAGGATATTTTTGG - Intergenic
1078494072 11:11798540-11798562 CTTAACACCTAGTATATGGTAGG + Intergenic
1085821242 11:79795915-79795937 CCTACCACGTACTATCTGCTAGG + Intergenic
1092074567 12:5662319-5662341 CCTACAACTTAAGAGATGGTTGG + Intronic
1092555427 12:9555386-9555408 CCTATCACGGACTATATGTTTGG + Intergenic
1094196653 12:27756995-27757017 CCTACCATGTGATTTAGGGTGGG + Intergenic
1095207737 12:39457474-39457496 CCTTCCACAAAATAAATGGTCGG - Intergenic
1095500236 12:42829696-42829718 CCCACCATGTAATATAAGCTGGG + Intergenic
1099929442 12:89057102-89057124 CCTACTAAGTAATATATATTGGG + Intergenic
1102467814 12:113140572-113140594 CCTACAATGTACTAGATGGTAGG + Intergenic
1116744750 14:48803618-48803640 CCTAACATATAAAATATGGTTGG - Intergenic
1126418995 15:48451557-48451579 CCTACCACTTAATCACTGGTAGG + Intronic
1126959466 15:53975220-53975242 ACTACCATGTAATCTATGCTAGG + Intergenic
1130830193 15:87591423-87591445 CCTACAACTAATTATATGGTAGG + Intergenic
1134911349 16:18029452-18029474 CCTAGCACTTGATATATAGTAGG - Intergenic
1135729454 16:24882178-24882200 CCTACCACGTAGAACTTGGTGGG + Intronic
1141436607 16:84003200-84003222 CCAACCATGTGATTTATGGTGGG - Intergenic
1148912699 17:50951472-50951494 CCTATCACGTAAGAAATGCTCGG + Intergenic
1153381891 18:4449575-4449597 CCTGGCACTTAATAAATGGTGGG - Intronic
1167119250 19:47506990-47507012 CCTGGCACGTAATAAATGCTCGG - Intronic
926127389 2:10279874-10279896 CCTGCCACTTAATATATGTGGGG + Intergenic
944609187 2:201383362-201383384 CCAACCACGTGATTTAGGGTAGG + Intronic
1177664970 21:24143716-24143738 TTTACCAGGTAATATATGGTAGG - Intergenic
1183298262 22:37044716-37044738 CCTAACACATAATAGATGCTCGG + Intergenic
949692220 3:6653746-6653768 CCTAAGACTTAACATATGGTTGG - Intergenic
950036743 3:9891226-9891248 CCTACCACGTAATATATGGTAGG + Intronic
950738337 3:15029549-15029571 TCTACCACTTACTATATGGATGG + Intronic
953355513 3:42253217-42253239 CCTAACACTTAATACAGGGTTGG - Intergenic
955487949 3:59453691-59453713 CCTAGCACCTAATATATAGTAGG - Intergenic
961696185 3:128706685-128706707 CTTATCACCTAATATGTGGTAGG + Intergenic
964237435 3:154549257-154549279 CCTACCACATAATAAATGCTTGG - Intergenic
974723024 4:65766511-65766533 ATTGCCATGTAATATATGGTTGG + Intergenic
977663408 4:99616898-99616920 CCTTCCATTTAATATATGGTTGG + Intronic
979077438 4:116290544-116290566 CCTCCCACATAATATATTCTTGG + Intergenic
983928540 4:173428729-173428751 TCCACCACATAATAGATGGTGGG - Intergenic
1003854754 6:10262018-10262040 CCTTGCATATAATATATGGTGGG - Intergenic
1012635766 6:101538898-101538920 ACTACCACATAAAATTTGGTTGG - Intronic
1027684180 7:81261225-81261247 CCTACTGCCTAATATCTGGTAGG + Intergenic
1033922283 7:146409032-146409054 CCTACAACTTAGAATATGGTAGG + Intronic
1035937618 8:3859594-3859616 CCAACCATGTTATTTATGGTGGG + Intronic
1037989059 8:23307591-23307613 CCTACCATGTAATCTGTGGGTGG + Intronic
1043001594 8:74766818-74766840 TCTAAAACATAATATATGGTTGG + Intronic
1045826958 8:106409234-106409256 CACACCACAGAATATATGGTCGG - Intronic
1045827149 8:106411787-106411809 CATACCACCTTAGATATGGTGGG + Intronic
1058494362 9:105539379-105539401 CCAACCAAGTAAAATATGTTAGG - Intronic
1185663690 X:1747077-1747099 CCTCACACATTATATATGGTTGG - Intergenic
1190578855 X:51870823-51870845 CATACCATGTAATATTTGATAGG - Intronic
1192685083 X:73295620-73295642 ACTACCATTTAAGATATGGTTGG - Intergenic
1197857932 X:130937683-130937705 CCTACCACATAGTATATGTTTGG - Intergenic
1199033078 X:143023754-143023776 CATACCACATAAAATAGGGTAGG - Intergenic
1201615519 Y:15893264-15893286 CCTACCACAATATATGTGGTAGG - Intergenic