ID: 950037077

View in Genome Browser
Species Human (GRCh38)
Location 3:9893966-9893988
Sequence ATAGAGAAGTAGACTGGGTA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 1, 2: 1, 3: 24, 4: 348}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950037072_950037077 0 Left 950037072 3:9893943-9893965 CCTTGAGAAACCTAGCAGTGGCC 0: 1
1: 0
2: 0
3: 14
4: 116
Right 950037077 3:9893966-9893988 ATAGAGAAGTAGACTGGGTATGG 0: 1
1: 1
2: 1
3: 24
4: 348
950037073_950037077 -10 Left 950037073 3:9893953-9893975 CCTAGCAGTGGCCATAGAGAAGT 0: 1
1: 0
2: 1
3: 20
4: 170
Right 950037077 3:9893966-9893988 ATAGAGAAGTAGACTGGGTATGG 0: 1
1: 1
2: 1
3: 24
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950037077 Original CRISPR ATAGAGAAGTAGACTGGGTA TGG Exonic
901783934 1:11612184-11612206 AGAGAGAAGAAGACAGGGGAAGG + Intergenic
902365986 1:15974869-15974891 ATAAAGAAGCAGACTGGGCCGGG - Intronic
902429266 1:16350454-16350476 ATAGAAAAGGAGGCTGGGCACGG + Intronic
904192699 1:28759663-28759685 AAAGATAAGGGGACTGGGTACGG + Intronic
905727288 1:40264039-40264061 AATGAGAAGTGGGCTGGGTACGG + Intronic
906536228 1:46552328-46552350 GTAGAGAAGAGGACTTGGTAGGG + Intergenic
907110157 1:51919867-51919889 AGGGAGAAGCAGACTGGGTGTGG + Exonic
907960194 1:59272223-59272245 ATAGTGAAGAAGACTGTGTTTGG + Intergenic
908367935 1:63445748-63445770 ATAGAAAAATAAGCTGGGTATGG - Intronic
909509254 1:76432745-76432767 ATACAAAAGTAGGCTGGGCATGG - Intronic
910509996 1:87992786-87992808 ATACAGAAATTGGCTGGGTACGG + Intergenic
910830331 1:91454855-91454877 ATGGAGGAGTACACTGGATAGGG - Intergenic
911478036 1:98398016-98398038 ATAGAGCAGTATAGTGGGAAAGG + Intergenic
911593824 1:99778653-99778675 ATACAGAAGTTAACTGGGTGCGG - Intergenic
912142253 1:106744936-106744958 AAGGAGAAGTAGACTGGGATTGG + Intergenic
913092713 1:115490463-115490485 ATAGAAAAGTCGGCTGGGCATGG + Intergenic
914813378 1:151045973-151045995 ATGTAGAAGTAGAGTGGTTAAGG - Intronic
914882515 1:151558619-151558641 ATAGACAACTAGGCTGGGTTGGG - Intronic
916339430 1:163712697-163712719 ATTGAGAAGAAGCCTGGGCATGG + Intergenic
919501292 1:198341142-198341164 TTACAGAAGTAGTCTGGGAATGG - Intergenic
919998792 1:202778910-202778932 ATAGAGATCTAGGCTGGGTGCGG - Intronic
920161343 1:204000457-204000479 ATGGTGAAGAAGACTGGGTGTGG + Intergenic
920181952 1:204137481-204137503 AGAGAGAGGTAGACTGGTTAAGG + Intronic
921038796 1:211409020-211409042 AAAGAGAAGAAGTCTGGGCATGG + Intergenic
921969546 1:221132759-221132781 AAGGAGAAGTTCACTGGGTATGG + Intergenic
922019185 1:221686343-221686365 ATATATAAGGAGACTGAGTAAGG - Intergenic
923776529 1:236983594-236983616 AAAGAGAAGATGACTCGGTATGG + Intergenic
924802674 1:247338844-247338866 ATGGGGAAGTAGACTTTGTACGG + Intergenic
1064606984 10:17052464-17052486 AGAGAGAAGTAGGCTGGGTGCGG + Intronic
1065602415 10:27383105-27383127 ATACAGAAGTAGACTGACTTTGG - Intergenic
1065931908 10:30487389-30487411 ATAAAGAAATAGGCTGGGTGTGG - Intergenic
1067204882 10:44204074-44204096 ATAGAGATGGTGGCTGGGTACGG + Intergenic
1067983535 10:51115547-51115569 ATAAAGAAGAAGGCTGGGTGTGG + Intronic
1068080246 10:52310564-52310586 ATACAGCAGTAGACTGGGCGCGG + Intergenic
1068194747 10:53701587-53701609 AGAGAAAAGTAGACTTGATATGG + Intergenic
1069883573 10:71609271-71609293 AGAGAGAAGTGGACTGGGAGGGG - Intronic
1070354533 10:75626806-75626828 ACAGAGAAGTGGACAGGCTAAGG + Intronic
1070795292 10:79212890-79212912 ACGGAGAACTTGACTGGGTATGG - Intronic
1070992410 10:80744128-80744150 AAAGAGAAGTAGGCTGGGCGCGG + Intergenic
1071479322 10:86052693-86052715 ATAGAGAAGAAGAATGGGAAAGG + Intronic
1072402985 10:95124618-95124640 ATAGGGAAGTAGAGAGGGAAGGG + Intergenic
1072719961 10:97774241-97774263 TTAGAAAAGTTAACTGGGTATGG + Intergenic
1072900551 10:99403207-99403229 ATGGAGAGGAAGACTGGGTGGGG + Intronic
1073276720 10:102318185-102318207 ATAAATAAATAGACTGGGCATGG - Intronic
1073294033 10:102427846-102427868 AGAGAGATATAGACAGGGTAAGG - Intronic
1073546882 10:104356939-104356961 ATAATGAAGAAGAATGGGTATGG - Intronic
1074001791 10:109380821-109380843 ACAGAGAAGTGGAGTGGGTATGG - Intergenic
1074181067 10:111064012-111064034 AAAGAAAACTAGGCTGGGTACGG + Intergenic
1074263872 10:111881738-111881760 ATAGAGAAGTGGGCTGGGGACGG + Intergenic
1076282948 10:129265271-129265293 TTAGAGGAGTAGGCTGGGCATGG + Intergenic
1077510890 11:2961820-2961842 ATAGAAAAGTAGGCTGGGTGTGG - Intronic
1077884449 11:6376092-6376114 ATAGTGAAGGATACTGGGTTAGG + Intergenic
1078091091 11:8265164-8265186 ATAGAGAAAGAGACTTGCTAAGG - Intronic
1079866724 11:25745394-25745416 ATAGAAAAGTTGACTTGGAAGGG - Intergenic
1080134886 11:28843151-28843173 ACAGAGAAGTAGACTGTTTGGGG - Intergenic
1081498284 11:43638381-43638403 GTAGGAAAGTAGAGTGGGTAAGG + Intronic
1082016328 11:47491151-47491173 ATAAAGAAATAGGCTGGGCACGG - Intronic
1083017998 11:59476372-59476394 AGAGAAAAGTAGACTGAGTGAGG - Intergenic
1083082031 11:60104026-60104048 AAACAGAAGTAGACTGTGGATGG - Intergenic
1084899373 11:72298245-72298267 TGGGAGAACTAGACTGGGTAGGG + Intronic
1086158364 11:83693536-83693558 AAAGGGAAGTGGACAGGGTACGG - Intronic
1086321452 11:85651871-85651893 AAAGAGTAGTAGGCTGGGCATGG + Intronic
1087135759 11:94717143-94717165 AAAGAAAAGTTGACTGGCTAGGG - Intronic
1088423611 11:109675832-109675854 ATGGAGAAGAAGTCTGGGGAGGG + Intergenic
1088888499 11:114026459-114026481 ATAGAAAAGTGGGCTGGGTATGG + Intergenic
1089991822 11:122868716-122868738 AAAAAGAAGGAGGCTGGGTACGG + Intronic
1090159247 11:124474931-124474953 ACTCATAAGTAGACTGGGTATGG - Intergenic
1090342474 11:126036978-126037000 ATAAAGTTGTAGGCTGGGTATGG - Intronic
1090480225 11:127061407-127061429 ATAGGGAAGTGCACTGGGCAAGG - Intergenic
1091851681 12:3704606-3704628 ATAGAAAAGAAGAATGGGTCTGG + Intronic
1094341686 12:29419146-29419168 TTAGAAATGTAGACTGGGCATGG - Intronic
1094655356 12:32414260-32414282 AAAAAGAAGTAGGCTGGGTGCGG - Intronic
1095627922 12:44340032-44340054 ATAGAGAAGTTAACTGGATTAGG + Intronic
1096263321 12:50106076-50106098 TTGGAGAAGTAGACTGGTTGAGG + Intronic
1096665648 12:53162277-53162299 ATAAATAAATAGGCTGGGTACGG + Intronic
1096998071 12:55852151-55852173 ATAGACAAATAGGCTGGGTGAGG + Intergenic
1098140233 12:67443535-67443557 GTAGAGAAGAAGGCTGGGAATGG + Intergenic
1098716870 12:73839775-73839797 AGAATGAAGTAGACTGAGTAGGG + Intergenic
1100256750 12:92890918-92890940 AGAGAAAAAAAGACTGGGTAAGG + Intronic
1100262983 12:92950281-92950303 AAAGAAAAGAAGAATGGGTACGG + Intergenic
1100552998 12:95664346-95664368 ATAAATAAATAGACTGGGCATGG - Intronic
1100992480 12:100266451-100266473 TTAGAGAGGTAGACTGTCTATGG - Intronic
1101256513 12:102982876-102982898 TTAGAGAAGTGGAGTGGGGAAGG + Intergenic
1102411365 12:112722473-112722495 ATGAAGAAGTAGACTGAATATGG - Intronic
1103096759 12:118138221-118138243 ACAGAGAAGTAGACCTGGTTTGG + Intronic
1104869227 12:131982678-131982700 ATAGAGAACTGGGCTGGGTTTGG + Intronic
1105373888 13:19825748-19825770 ATAGAGAATGAGGCTGGGTGTGG + Intronic
1106195090 13:27486730-27486752 ATAGATAAGTTGAGTGGGTATGG - Intergenic
1109057627 13:57571992-57572014 AAAAAAAAGTTGACTGGGTATGG - Intergenic
1111689779 13:91549111-91549133 ATAGAAAAATTGGCTGGGTATGG + Intronic
1112082108 13:95983020-95983042 AAGGAGAAGTGGCCTGGGTATGG - Intronic
1112499246 13:99929844-99929866 ATATAAAAGTTGACTGGGCACGG - Intergenic
1112565207 13:100546518-100546540 ATAAGGAAATAGACTGGGTGCGG + Intronic
1114642767 14:24235205-24235227 CTAGAGATGGAGACAGGGTAGGG + Intronic
1114799857 14:25761205-25761227 AGAGTGAAGGAGACTGAGTATGG - Intergenic
1115178063 14:30588072-30588094 ATAGAGTAGTAGACTGGCCTGGG + Intronic
1115215370 14:31008667-31008689 CTAGAGAGGTGGACTGAGTAGGG + Intronic
1117895657 14:60483876-60483898 ATAGAGAAAAAAAATGGGTATGG + Intronic
1119676290 14:76557862-76557884 AGAGAGTGGTAGGCTGGGTATGG + Intergenic
1119927875 14:78513883-78513905 ATACAGAGGTAGACTAGTTATGG - Intronic
1120784126 14:88515227-88515249 ATAGAGAAGTTGTATCGGTAAGG - Intronic
1121042775 14:90762422-90762444 CTAGCGAAGGAGACTGGTTAAGG - Intronic
1121047743 14:90800284-90800306 AGAGAGAAATAGACTGAGTGGGG + Intronic
1121075634 14:91065951-91065973 ATGGAGAAGTAGAGAGGGTGGGG + Intronic
1121097360 14:91226967-91226989 ATTGAGAAGGAGGCTGGGCATGG + Intergenic
1123176544 14:106424452-106424474 ATATGAAAATAGACTGGGTAAGG - Intergenic
1123974521 15:25540605-25540627 ATAGATATGTAGGCTGGGTTGGG + Intergenic
1124141776 15:27083614-27083636 ATAGAAAAGTTGGCTGGGCACGG - Intronic
1125193215 15:37017453-37017475 ATTTAGAAGTGAACTGGGTATGG + Intronic
1125462291 15:39919259-39919281 ATGGGGAAGTAGAGTGGGTTTGG + Intronic
1126460160 15:48906503-48906525 ATTGAGAAGGGGAGTGGGTAGGG - Intronic
1127073769 15:55307070-55307092 ATAGATAAAATGACTGGGTAGGG + Intronic
1127803710 15:62499458-62499480 ATAGAGAAATGGCCTGGATATGG + Intronic
1128093162 15:64932792-64932814 AAAGAAAAGTAGGCTGGGCAAGG + Intronic
1131262424 15:90894292-90894314 ATACAAAAATAGACTGGGCACGG + Intronic
1131957546 15:97752558-97752580 ATAGTGAAATGGACTGGGTCAGG + Intergenic
1202970842 15_KI270727v1_random:236916-236938 AAAAAGAAGTAGGCTGGGCATGG + Intergenic
1133563970 16:6975419-6975441 ATACAGAAATTAACTGGGTATGG - Intronic
1134230192 16:12422974-12422996 ATAATGAAGTAGACAGGGTGGGG - Intronic
1135050921 16:19192431-19192453 AAAGAAATGTAGACTGGGTGTGG + Intronic
1135412569 16:22246229-22246251 GTACAGAAGAAGACTGGGCATGG + Intronic
1135975140 16:27103763-27103785 AAAGAAAAGAAAACTGGGTATGG + Intergenic
1138000647 16:53275599-53275621 ATGGAGAAGAAAACTGGGAAAGG - Intronic
1139897212 16:70297202-70297224 ATAAATAAATAGACTGGGCACGG - Intronic
1140032007 16:71346382-71346404 ATAGAGAAGTAGATTCTGTGGGG - Intergenic
1140589625 16:76336178-76336200 ATAGAAAATTAGATTGGGTTGGG + Intronic
1141637976 16:85325257-85325279 ATTGAGATCTAGACTGGATACGG - Intergenic
1143049071 17:4107752-4107774 ATAAAGAAATAGGCTGGGCATGG + Intronic
1144831164 17:18131904-18131926 ATAAAGCAGTGGACGGGGTAGGG - Intronic
1145766070 17:27458931-27458953 TTAGAGAAGGAGACTTGGTTGGG + Intronic
1146435597 17:32843178-32843200 AAATAGACGTAGACTGGGCATGG - Intronic
1146487824 17:33258409-33258431 ACAGAGAAGGAGGATGGGTAGGG + Intronic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1147544360 17:41389054-41389076 ATAAAGAAATAAACTGGGAAAGG + Intronic
1147657582 17:42099307-42099329 AAAGAGAAGTACACTGTCTATGG + Intergenic
1148401325 17:47364198-47364220 ATAGAGAAGTAGAGTTGCCAAGG - Intronic
1149270836 17:54975722-54975744 TTAGAGAAGTAGGCAGGGTCTGG - Intronic
1149939337 17:60846224-60846246 ATAAAGAAGTAGAATGGGGCTGG - Intronic
1150330518 17:64290642-64290664 GAAGAGAAATAGACTGGGTGTGG + Intergenic
1150895797 17:69209117-69209139 ATACAGAAGTAGACAAGGTTTGG + Intronic
1150984663 17:70182300-70182322 GTAGAGAAGTAGAATGGCTGGGG + Intergenic
1151574463 17:74945249-74945271 AAAGAGATGTACACTGGGTCCGG - Intronic
1154073141 18:11173509-11173531 ATAGAGAAAAAGGCTGGGCACGG + Intergenic
1154959169 18:21290666-21290688 ATACAAAAGTTGACTGGGTGTGG + Intronic
1155075020 18:22347052-22347074 ATAGAGAAGGACACTGTGTGCGG - Intergenic
1155081992 18:22419506-22419528 ATAAAGAACTAGGCTGGGTGCGG + Intergenic
1155467549 18:26154903-26154925 ATAAAAAAGTAGGCTGGGTGTGG - Intronic
1156389988 18:36641285-36641307 ATATATCAGTAGACTGTGTAAGG + Intronic
1156429669 18:37058420-37058442 ATAAACAAGTAGGCTGGGCATGG + Intronic
1157267810 18:46243911-46243933 ATGCTGAAGTAGACTGAGTAAGG + Intronic
1157847286 18:51015767-51015789 ATAGAGAATTAGATTGGGGGAGG - Intronic
1158171318 18:54603851-54603873 ATAAAAAAGAAGACTGGGTGCGG - Intergenic
1159445207 18:68533890-68533912 ATAGTGAAGTGGATGGGGTACGG - Intergenic
1161796364 19:6388949-6388971 ATAAATAAGTAGGCTGGGCACGG + Intronic
1162511035 19:11118603-11118625 AAAGAGATTTAAACTGGGTATGG + Intronic
1162557474 19:11396459-11396481 ATAGAGAAATTGGCTGGGTGCGG - Intronic
1163009660 19:14417136-14417158 AAAGAGAAGTAACCAGGGTAGGG + Intronic
1163603506 19:18262137-18262159 ATAGATAGGTAGCCTGGGTTTGG + Intronic
1164000483 19:21093783-21093805 AAAAAGAAGTTAACTGGGTATGG - Intronic
1164185297 19:22861732-22861754 ATAGAAAAATTAACTGGGTATGG + Intergenic
1164442214 19:28287870-28287892 AGAGAGAAGGGGACTGGGAAGGG + Intergenic
1164962108 19:32442540-32442562 AGAGAGAAGCAGACTGCCTAGGG + Intronic
1165087257 19:33359225-33359247 AGAGAGAAGTAAACAGTGTAAGG - Intergenic
1165777009 19:38410702-38410724 ATAGAAAAATAGGCTGGGTGTGG - Intronic
1166644894 19:44524574-44524596 ATAAAGAAAAAGAGTGGGTAGGG - Intronic
1167646695 19:50709839-50709861 ATAGAGAATTAGACCAGGCACGG - Intronic
1168067489 19:53926755-53926777 ATAGAAAAATTGACTGGGCATGG + Intronic
1168091085 19:54084829-54084851 ATAGAGAAGGCGGCTGGGCATGG + Intergenic
925660203 2:6194363-6194385 ATACAGAAGTATACAGGGTTTGG + Intergenic
927530087 2:23789087-23789109 ACAGTGAAATAGACTTGGTAGGG - Intronic
927652019 2:24919012-24919034 CTAGAGAAGTGGACTGGGAACGG + Exonic
927775902 2:25902937-25902959 ATAGAAATGTAGGCTGGGCACGG - Intergenic
927812806 2:26189438-26189460 ATAAATAGGTAGACTAGGTAAGG - Exonic
929714167 2:44293634-44293656 TGAGAGAAGCAGGCTGGGTAAGG + Intronic
929724393 2:44409030-44409052 ATATAGAAGCAGGCTGGGTGCGG - Intronic
931096247 2:58943844-58943866 AGAGAGAAGTAGAGAGGGAAGGG - Intergenic
931401006 2:61931383-61931405 ATAGACAAGTTGAATGGGTCTGG + Intronic
934018654 2:87919681-87919703 ATAGAGAAGTAGTGTGGGAAAGG + Intergenic
934486908 2:94724595-94724617 ATAGAGCAGTAGACCTGGTCAGG + Intergenic
934488534 2:94739311-94739333 ATAGAGCAGTAGACCTGGTCAGG - Intergenic
937219602 2:120334668-120334690 AAGGAGAAGCAGACTGGTTAGGG - Intergenic
937448338 2:121977234-121977256 ACAGAAAAGCAGAGTGGGTAAGG - Intergenic
940112014 2:150165438-150165460 AAAGAGAGGTGGACTGGGGATGG + Intergenic
941428111 2:165375525-165375547 ATATAGAAGTAGTCAGGGAAGGG + Intronic
944407973 2:199407028-199407050 ATAGAAAAGTTGGCTGGGTGTGG + Intronic
944635986 2:201676607-201676629 ATAAAAAAGTAGGCTGGGTGTGG + Intronic
946650443 2:221887483-221887505 AGGGAGAAGAAGAATGGGTAGGG + Intergenic
1169176659 20:3522342-3522364 CTAGAGAGGTAGTCTGGCTATGG - Intronic
1172675972 20:36672536-36672558 ATAGAAAAGTAGGCTGGGCGTGG + Intronic
1174717349 20:52773725-52773747 ATAGAGAAATTGGCTGGGTATGG - Intergenic
1175152914 20:56949154-56949176 ATAGAAATGTAGGCTGGGTGCGG - Intergenic
1175590483 20:60186354-60186376 ATAGAAAACAAGGCTGGGTACGG - Intergenic
1176428295 21:6561897-6561919 ATAGATAAGTTGGCTGGTTATGG - Intergenic
1177755172 21:25337800-25337822 ATAGATAAGAAGACTGGAGAAGG + Intergenic
1179703785 21:43170213-43170235 ATAGATAAGTTGGCTGGTTATGG - Intronic
1179935886 21:44603064-44603086 ACAGAGAAGGAGGCTGGGTGAGG + Intronic
1180090730 21:45532723-45532745 ATAGAGAAGCTGGCTGGGTGTGG - Intronic
1180846785 22:18987322-18987344 ATAAATAAGTAGGCTGGGCACGG + Intergenic
1181021118 22:20103473-20103495 TTAGAGAAGAAAACTGGATAAGG - Intronic
1181094821 22:20497710-20497732 GTAGAGACGAAGACTGAGTAGGG + Intronic
1185253449 22:49817962-49817984 TTAGAAAAGTTGACTGGGTGCGG - Intronic
949531768 3:4962769-4962791 ACAGACAAATTGACTGGGTATGG + Intergenic
950037077 3:9893966-9893988 ATAGAGAAGTAGACTGGGTATGG + Exonic
950856845 3:16113741-16113763 ATTCAGAAGGAGACAGGGTATGG - Intergenic
951261776 3:20518242-20518264 ATAGAAAAGAAAACTGGATAGGG - Intergenic
951362021 3:21736703-21736725 ATAGAGAAGTAGACTGGGGAGGG + Intronic
951641342 3:24839550-24839572 ATACAGAAGTTAGCTGGGTATGG + Intergenic
951806956 3:26656010-26656032 ATAGAGAAGTAGATGAGGTCAGG - Intronic
951909887 3:27738670-27738692 ATAGTGATGTAGGCTGGGTGTGG - Intergenic
952417674 3:33104299-33104321 ATAAAGAAATAGGCTGGGTGCGG - Intergenic
952910746 3:38182635-38182657 AGAGAGAGGTAGACTAGTTAGGG - Intronic
953074082 3:39551622-39551644 ATAGAGAGGCAGTCTGGCTATGG - Intergenic
953211767 3:40881647-40881669 AAAAAGAACTAGACTGGGCACGG - Intergenic
953875376 3:46663665-46663687 ATAGAGGAGGAGGCTGGGTCGGG + Intergenic
954009751 3:47625523-47625545 ATATAGAAGTAGGCTGGGCACGG - Intronic
954079006 3:48201808-48201830 ATACAAAATTAGACTGGGCACGG + Intergenic
956443691 3:69305138-69305160 ATATACAAGTCCACTGGGTAGGG - Intronic
956720426 3:72112823-72112845 AAAGAAAAGGAGTCTGGGTAGGG - Intergenic
958681963 3:97342792-97342814 ATAGATACGGAGACTGGGTTAGG - Intronic
959058061 3:101587980-101588002 ATGGAGAAATTGACTGGGCATGG + Intronic
960274938 3:115718058-115718080 AAAGGGAAGTAGACTGGGAAAGG - Intronic
960419687 3:117428427-117428449 ATGGGGAAGTAGGCTGGGCATGG - Intergenic
961018847 3:123487247-123487269 AGAGAGAAGTGGGCTGGGCACGG + Intergenic
961082320 3:124036945-124036967 CTAGAATAGTAGGCTGGGTAGGG - Intergenic
961115353 3:124324359-124324381 ATAGAGAGGAAGAATGGGGAGGG - Intronic
961836749 3:129667894-129667916 ATAGAGGAGTTGACGGGGTATGG + Intronic
962338773 3:134563268-134563290 AGAGAGAAGTAGTCTGGATCAGG - Exonic
962430490 3:135314282-135314304 AAAGAGAAGCAGACTGGCTTGGG + Intergenic
962930373 3:140030428-140030450 AGACAGAAGGAGAGTGGGTAGGG + Intronic
963524004 3:146393316-146393338 ATAGAAATGTAGGCTGGGCACGG - Intronic
965577055 3:170228307-170228329 ATACAGAAAGAGGCTGGGTATGG + Intronic
966738008 3:183205418-183205440 AAATAGAATTAGACTGGGGATGG + Intronic
966846014 3:184130387-184130409 ATAGAAAAATTGGCTGGGTATGG + Intergenic
967658516 3:192077010-192077032 ATAGAAAAGAAGACATGGTATGG - Intergenic
967669899 3:192220309-192220331 ATAGGGAAGTAGAATGGTGAAGG - Intronic
969937301 4:10695034-10695056 ATGGAGGAGTGGACTGGGAAAGG + Intergenic
971161418 4:24137617-24137639 ATGGACCAGTAGACTGGGCAAGG - Intergenic
971598962 4:28568524-28568546 ATATAGAAGTTGCCTGGGTTTGG + Intergenic
972392469 4:38626678-38626700 ATAAAGAATTAGGCTGGGCACGG - Intergenic
972489728 4:39575883-39575905 AAAAAAAAGTAGGCTGGGTATGG - Intronic
974018800 4:56675007-56675029 GTAGAGAAGTTGGCTGGGCATGG - Intronic
976300526 4:83511559-83511581 ATACAAAAATAGGCTGGGTATGG - Intronic
977024081 4:91793284-91793306 ATAGATAAATAGACAGGTTAGGG - Intergenic
977463423 4:97355235-97355257 GTAGAAAAGGAGACTGGGCACGG + Intronic
977940136 4:102848661-102848683 ATAAATAAATAGGCTGGGTATGG + Intronic
978413918 4:108455559-108455581 ACAGAGAAGAGGACTGGGGATGG - Intergenic
979398657 4:120220440-120220462 AAAGAAAATTAGGCTGGGTATGG - Intergenic
980265407 4:130508222-130508244 ATAGAGAAGTGGAGAAGGTAGGG - Intergenic
981737757 4:147970795-147970817 ATAAAGATGTAGACTGAGCATGG + Intronic
982427011 4:155276141-155276163 ATAGACATGTAGTCTGGATATGG + Intergenic
982775505 4:159437535-159437557 ATAGAGAATTCGGCTGGGCACGG - Intergenic
983911757 4:173247709-173247731 ATAGAGAAGTAGATTTGTAAAGG + Intronic
984600562 4:181721621-181721643 AAAAAGAAGTGGAGTGGGTAGGG + Intergenic
986642544 5:9886622-9886644 ATATAAAAATAGACTGGGAACGG - Intergenic
987275712 5:16360239-16360261 ATAGAAGAGTAGACAAGGTATGG + Intergenic
987494496 5:18626469-18626491 ATAAAGAACTAGACTAGATAGGG - Intergenic
987783668 5:22470706-22470728 ATAGAAAAGAAGACTGGGCAAGG - Intronic
988214408 5:28252651-28252673 ATAGATAATTAGACAGGGCAGGG - Intergenic
989372679 5:40725664-40725686 AGAGGGAAGGAGACTGGGAAAGG - Intronic
989800719 5:45535305-45535327 ATAGAGAAGCAGGCTGGGCATGG + Intronic
990563775 5:57008784-57008806 ATAGAGAAGTTAGCTGGGCATGG + Intergenic
990836949 5:60032350-60032372 ATAGAGAAGTAGAAGTTGTATGG - Intronic
991298910 5:65108473-65108495 ATAGATGATTAGGCTGGGTACGG - Intergenic
991341457 5:65615190-65615212 ATAGAGAAATAGGCTGGGCACGG - Intronic
991719738 5:69484301-69484323 ATAGAAATGTTGACTGGGCATGG - Intergenic
991914649 5:71593888-71593910 ATAGTGAAGAAGACTGGATTTGG + Intronic
992652650 5:78875821-78875843 ATACAAAAGTTGACTGGGTGTGG - Intronic
993002893 5:82400011-82400033 TAAGAGAAGTAGAATGGGCAAGG - Intergenic
993564663 5:89458310-89458332 ATATAAAAGCAGACTGGGCAAGG - Intergenic
993807665 5:92432516-92432538 AAAGAGAAGTAGGCTTGGTGTGG + Intergenic
993854367 5:93055158-93055180 ATAGAGATGGAGAATGGGAATGG - Intergenic
994083926 5:95738234-95738256 ATAGGGAAGTAGAGGGGATATGG - Intronic
994763748 5:103889717-103889739 ATACAGAAATAGATTGGTTATGG - Intergenic
994909104 5:105878742-105878764 ATAGAATAGTATACTGAGTAGGG + Intergenic
995849156 5:116526217-116526239 ATAGAAAAGTGGAGTGGGGAGGG - Intronic
996605904 5:125321730-125321752 ATAGAGAAGTAAACAAGATAAGG - Intergenic
996963205 5:129276181-129276203 ATAGAAAAGGAGGCTGGGCATGG - Intergenic
999154198 5:149446678-149446700 ATTCAGAAGTAGGCTGGGTGCGG + Intergenic
999674045 5:153981367-153981389 AAAGAGAAGAAGACAGGGTCTGG - Intergenic
999799217 5:155017737-155017759 AGAGAGCAGTAGTCTGGGGATGG - Exonic
999881851 5:155873503-155873525 ATAGACATGTAGACTTGGAAGGG + Intronic
1000880265 5:166689334-166689356 AAAGTGAAATAGACTGGGTATGG - Intergenic
1001591751 5:172870362-172870384 TTAGAGAAGTGGGCTGGGTGTGG - Intronic
1001670998 5:173473878-173473900 AAAGAGGAGGAGACTGGGAAAGG + Intergenic
1002130988 5:177081626-177081648 AGAAAGAACAAGACTGGGTAGGG + Intergenic
1002437455 5:179240389-179240411 TAAGAGAAGGAGGCTGGGTAAGG + Intronic
1003252003 6:4436983-4437005 ATAAAGAAGTACATAGGGTAAGG - Intergenic
1003463080 6:6350688-6350710 ATATAGAAATAGACGGGGCATGG + Intergenic
1003786939 6:9497295-9497317 ATAGAGTAGTAGATTGTGTAAGG + Intergenic
1005188296 6:23187651-23187673 ATTGAGAAGTAGTTTGGGTGAGG - Intergenic
1005572507 6:27158796-27158818 AGAGCCAAGTAGACTGGGTGAGG + Intergenic
1006690565 6:35880430-35880452 ATAGAGGAGGAGGCTGGGCACGG + Intronic
1006943012 6:37765455-37765477 ATAAAGCAGTAGACTGGCAAAGG + Intergenic
1007587088 6:42997834-42997856 ATACAGAAGTTGGCTGGGCATGG - Intronic
1009653089 6:66501453-66501475 AAAGACCAGTAGGCTGGGTAAGG - Intergenic
1010242596 6:73630279-73630301 GAAGAGAAATAGGCTGGGTACGG - Intronic
1010907825 6:81514745-81514767 AAAGAAAAGTAGGCCGGGTACGG + Intronic
1011283793 6:85703483-85703505 ATAAACAAATAGAATGGGTAAGG - Intergenic
1011650524 6:89502353-89502375 AAAGAGAAATAGACTGGGCATGG + Intronic
1011996119 6:93590267-93590289 AAAGAGTAGTAGGCTGGGTGTGG - Intergenic
1014435698 6:121418727-121418749 AGAGTAAATTAGACTGGGTATGG + Intergenic
1014742576 6:125163424-125163446 ATAAAGAAGTAAATTGGGCATGG + Intronic
1014788858 6:125648129-125648151 AGAGAAAAGTAGCCTGGTTAAGG + Intergenic
1015108933 6:129569407-129569429 CTAGAGAGGTAGGCTGGCTACGG - Intergenic
1017522706 6:155216097-155216119 AAATAGAAGAGGACTGGGTACGG - Intronic
1017931952 6:158963490-158963512 AAAGAGAAAGAGACTGGGAAGGG - Intergenic
1020887889 7:13842262-13842284 CCAGAGAAGTGGACTGGGCAGGG - Intergenic
1023003312 7:35835520-35835542 ACTGAGCAGTAGACTGGGTTTGG - Intronic
1023063703 7:36353769-36353791 ATAAACAAGGAGGCTGGGTATGG - Intronic
1023909958 7:44546832-44546854 ATAGAAAAGCAGGCTGGGCATGG + Intergenic
1023972580 7:45002281-45002303 ATGCAGAATTAGGCTGGGTATGG + Intronic
1024496495 7:50053305-50053327 TTAGAAAAGTAGACTGAGAATGG - Intronic
1024718563 7:52108112-52108134 AGAGAGTAATAGGCTGGGTACGG - Intergenic
1026680388 7:72462338-72462360 ATAGAGAAATAAGCTGGGCATGG - Intergenic
1028810036 7:95075538-95075560 ATGGAGAGGTAGGCTGGGCATGG + Intronic
1028845950 7:95480185-95480207 CAAGAAAAGTAAACTGGGTAAGG - Intronic
1029310958 7:99663804-99663826 ATAAAGAAGGAGATTGGGGAAGG - Intronic
1029631712 7:101755763-101755785 AGACATATGTAGACTGGGTATGG - Intergenic
1030298089 7:107948658-107948680 AAAGAGGAGTATACTGGGTGAGG + Intronic
1031550495 7:123105841-123105863 ATAGGGAAGAATACTGAGTAGGG + Intergenic
1037299757 8:17439302-17439324 ATATAGAAATAGGCTGGGTGTGG - Intergenic
1037512775 8:19600368-19600390 ATAGAGAAGTAGGCTGGGTGCGG - Intronic
1038786233 8:30619228-30619250 CTATTGAAGTAGACTGGGCACGG - Intronic
1038846935 8:31238730-31238752 CTAGAGAAGTAGATTGGGATTGG + Intergenic
1039254503 8:35704537-35704559 ACAGAGAAGGGGACTGCGTAGGG + Intronic
1041065363 8:54077503-54077525 ATAAAAAAGTAGTCTGGGCACGG + Intronic
1041075754 8:54168227-54168249 ATACAGAAGTTAACTGGGCATGG + Intergenic
1042138345 8:65653772-65653794 TTACAAAAGTAGGCTGGGTATGG + Intronic
1042145965 8:65730635-65730657 ACAGAGAACTAGGCTGGGCATGG + Intronic
1042247678 8:66724268-66724290 AAGGAGAAATAGGCTGGGTATGG - Intronic
1042492643 8:69417486-69417508 ATTAAAAAGTAGACTGGGTCTGG - Intergenic
1042497443 8:69470906-69470928 ATAGAAAACTAGAGTGGTTAGGG - Intronic
1043943596 8:86225015-86225037 ATAGGGAAGCAGACTGGACATGG - Intronic
1043970197 8:86520030-86520052 ATAGAGATGGAGACTGAGTTTGG + Intronic
1044041005 8:87368343-87368365 ATAAAAAAGTAGATTGGGCATGG + Intronic
1044694821 8:94912504-94912526 ATAAACCAGTAGACTGGGTGCGG + Intronic
1045598394 8:103684289-103684311 ATAGAGAAGTAGGCAGTCTATGG + Intronic
1045943780 8:107770931-107770953 GCAGAGAAGTAGCCTGGGTCTGG + Intergenic
1046162974 8:110391289-110391311 ACAGAGAAATAGATTGGGAAGGG + Intergenic
1049866843 8:144944503-144944525 ATAGAGAACTAGGCTGGGCATGG - Intronic
1051106509 9:13587024-13587046 AGAGAGAAGGAGAATGGGGAGGG - Intergenic
1051277784 9:15414037-15414059 ATATAGAATTAGACTGGGCGCGG - Intergenic
1053669254 9:40345053-40345075 ATAGAGCAGTAGACCTGGTCAGG + Intergenic
1053670886 9:40359734-40359756 ATAGAGCAGTAGACCTGGTCAGG - Intergenic
1053919056 9:42971293-42971315 ATAGAGCAGTAGACCTGGTCAGG + Intergenic
1053920688 9:42986107-42986129 ATAGAGCAGTAGACCTGGTCAGG - Intergenic
1054380387 9:64485075-64485097 ATAGAGCAGTAGACCTGGTCAGG + Intergenic
1054382006 9:64499796-64499818 ATAGAGCAGTAGACCTGGTCAGG - Intergenic
1054513727 9:66016567-66016589 ATAGAGCAGTAGACCTGGTCAGG + Intergenic
1054515362 9:66031237-66031259 ATAGAGCAGTAGACCTGGTCAGG - Intergenic
1057055813 9:91959858-91959880 AGAGAGAAGCAGGCTGGGCACGG - Intergenic
1057738900 9:97694125-97694147 ATGGAGAAATATACTGTGTATGG + Intronic
1058610107 9:106766732-106766754 TCTGAGAAGTAGAATGGGTATGG + Intergenic
1059220179 9:112608496-112608518 ATAGAGAATTTGGCTGGGTGTGG + Intronic
1059754869 9:117283173-117283195 ATAGCGAAGTAGAATGAGCATGG - Intronic
1060122891 9:121011947-121011969 ATAGAGTAGAAGGCTGGGAAGGG + Intronic
1061404100 9:130384193-130384215 ACACAGAAGGACACTGGGTAGGG - Intronic
1061458880 9:130720273-130720295 ATAGAGAAGGGGACAGGGAATGG + Intronic
1186421248 X:9428402-9428424 ATAGGAAAGTAGACTGGGCGCGG + Intergenic
1188521328 X:31041636-31041658 ATAGAGATGTAGAACAGGTAAGG + Intergenic
1189819885 X:44859847-44859869 ATGGAGAAGTCGGCTGGGTGCGG - Intergenic
1190048705 X:47133146-47133168 AAAAAGAAGTAGACTGGGGCCGG + Intergenic
1190842197 X:54155618-54155640 ATAGAGCAGTAGCTTGGGTGGGG + Intronic
1190857913 X:54315334-54315356 ATATAGAAGTGGACAGTGTAGGG - Intronic
1192272869 X:69599839-69599861 AGAGAGAAGTTGACTGGGGTTGG + Intergenic
1192425355 X:71070082-71070104 TTAGAAAGGTAGACTGGCTAGGG + Intronic
1192753173 X:74016313-74016335 TTAGAGAAGTAGGCCGGGCATGG + Intergenic
1195675226 X:107502713-107502735 ATAGAGAAATGGCCTGGGAATGG + Intergenic
1195677158 X:107515399-107515421 ATTGAGAAGTTGAGTAGGTAAGG + Intergenic
1196431152 X:115627140-115627162 CTAGAAAAGTAGGCTGGGCACGG - Intronic
1196436184 X:115676686-115676708 ATAAAGAAGCAGCTTGGGTACGG + Intergenic
1196467074 X:115983413-115983435 CTAGAGAGGTAGACTGGCTAAGG - Intergenic
1197401674 X:125999859-125999881 ATATAAAACTACACTGGGTATGG - Intergenic
1198163189 X:134027871-134027893 ATAGAAAATGAGACTGGGTGCGG + Intergenic
1199125877 X:144119457-144119479 ATAGAGAAGTAGTGTGGGAAAGG - Intergenic