ID: 950039519

View in Genome Browser
Species Human (GRCh38)
Location 3:9911024-9911046
Sequence CTCGAGAGTCAGATGGGGTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 153}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950039514_950039519 -10 Left 950039514 3:9911011-9911033 CCGAATGCCACAGCTCGAGAGTC 0: 1
1: 0
2: 0
3: 5
4: 67
Right 950039519 3:9911024-9911046 CTCGAGAGTCAGATGGGGTGAGG 0: 1
1: 0
2: 0
3: 17
4: 153
950039510_950039519 7 Left 950039510 3:9910994-9911016 CCCTTTGCAAAGACCTCCCGAAT 0: 1
1: 0
2: 0
3: 9
4: 99
Right 950039519 3:9911024-9911046 CTCGAGAGTCAGATGGGGTGAGG 0: 1
1: 0
2: 0
3: 17
4: 153
950039509_950039519 27 Left 950039509 3:9910974-9910996 CCAGAGGCACGACTGGCATACCC 0: 1
1: 0
2: 0
3: 5
4: 50
Right 950039519 3:9911024-9911046 CTCGAGAGTCAGATGGGGTGAGG 0: 1
1: 0
2: 0
3: 17
4: 153
950039512_950039519 -6 Left 950039512 3:9911007-9911029 CCTCCCGAATGCCACAGCTCGAG 0: 1
1: 0
2: 0
3: 3
4: 47
Right 950039519 3:9911024-9911046 CTCGAGAGTCAGATGGGGTGAGG 0: 1
1: 0
2: 0
3: 17
4: 153
950039511_950039519 6 Left 950039511 3:9910995-9911017 CCTTTGCAAAGACCTCCCGAATG 0: 1
1: 0
2: 1
3: 6
4: 88
Right 950039519 3:9911024-9911046 CTCGAGAGTCAGATGGGGTGAGG 0: 1
1: 0
2: 0
3: 17
4: 153
950039513_950039519 -9 Left 950039513 3:9911010-9911032 CCCGAATGCCACAGCTCGAGAGT 0: 1
1: 0
2: 0
3: 5
4: 78
Right 950039519 3:9911024-9911046 CTCGAGAGTCAGATGGGGTGAGG 0: 1
1: 0
2: 0
3: 17
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950039519 Original CRISPR CTCGAGAGTCAGATGGGGTG AGG Exonic
900178572 1:1301679-1301701 CTTGAGAGTGAGGTGGGGAGGGG - Intronic
900731952 1:4267953-4267975 CACTAGAGGCTGATGGGGTGCGG + Intergenic
900761507 1:4474907-4474929 CTCGGGAGTCAGATGGATTTGGG + Intergenic
903281109 1:22250485-22250507 CTGGTGACTCAGATGGGGAGGGG + Intergenic
903385816 1:22925690-22925712 CTCGAGAGGCTGAGGTGGTGAGG - Intergenic
905527461 1:38649824-38649846 CTAGACAGACATATGGGGTGAGG + Intergenic
905888127 1:41502667-41502689 CTGGAGACTCCGGTGGGGTGTGG - Intergenic
905924402 1:41739578-41739600 CAAGAGAGGCAGAGGGGGTGGGG - Intronic
906642248 1:47448512-47448534 GCCTAGAGTCAGGTGGGGTGAGG - Intergenic
907203418 1:52747804-52747826 CTCTAGAGTCAGATTGCTTGGGG + Intronic
910540529 1:88350858-88350880 CTGGTGAGCCAGATGGGGTGGGG + Intergenic
910912161 1:92247567-92247589 CTTGAGAGTGAGATGGAGAGTGG + Intronic
911052031 1:93680002-93680024 CTGGAGAGTCAGATGGAGAGAGG + Intronic
915987646 1:160482268-160482290 CTTGAGGGTGGGATGGGGTGTGG + Intergenic
916041714 1:160967156-160967178 GTAGAGAGTGAGAGGGGGTGAGG - Intergenic
916662522 1:166935643-166935665 CTGGAGAGTCCGAGGGAGTGGGG - Intronic
917241693 1:172955705-172955727 CTGAATAGTCTGATGGGGTGGGG + Intergenic
918081513 1:181211241-181211263 CTCCAGAGTGAGATGGGGAAAGG - Intergenic
919834808 1:201566269-201566291 CTCCAAAGTGAGCTGGGGTGTGG - Intergenic
920259383 1:204678631-204678653 CTGGAGAGTCAGAGGCGGCGTGG - Intronic
920279343 1:204830997-204831019 CTCCAGCGTGAGAGGGGGTGGGG + Intronic
921277607 1:213535429-213535451 CTCTAGACTTAGATGAGGTGGGG - Intergenic
922162713 1:223090157-223090179 CTGGAGAGCCAGATGAGGGGAGG - Intergenic
922982516 1:229839719-229839741 CCCCAGAGTAAGACGGGGTGTGG - Intergenic
924419050 1:243890027-243890049 CTTGGGAGTGAGATGGGGTGGGG + Intergenic
1063154181 10:3363263-3363285 CTCCAGAGTCCAGTGGGGTGAGG - Intergenic
1063166531 10:3468461-3468483 ATTCAGAGTCAGATGTGGTGTGG - Intergenic
1063186996 10:3660569-3660591 GTCGAAAGTCAGATGGGGGCAGG + Intergenic
1065423677 10:25576202-25576224 CTGGAGACTCAGAAGGGGTTAGG - Intronic
1069884848 10:71617225-71617247 CTGTAGCGTCAGATGGGGTGCGG - Intronic
1073763605 10:106657442-106657464 TTGGAGAGTCAGAAAGGGTGAGG + Intronic
1075072253 10:119327077-119327099 GCTGAGAGTCAGGTGGGGTGGGG + Intronic
1075519117 10:123133551-123133573 CGCTAGACTCAGATGGGGAGGGG - Intergenic
1076429354 10:130391000-130391022 CTCCAGAGGCAGAGGGAGTGAGG + Intergenic
1076737943 10:132467088-132467110 CTCCAGGGCCAGCTGGGGTGGGG - Intergenic
1076884529 10:133255650-133255672 CTCCAGGGACAGATGGGGTGGGG + Intergenic
1081527150 11:43934994-43935016 CTGGGGAAGCAGATGGGGTGGGG - Intronic
1081569655 11:44281725-44281747 CCCCAGTGTCAGATGAGGTGGGG - Intronic
1083863248 11:65437769-65437791 GTAGTCAGTCAGATGGGGTGGGG - Intergenic
1083947537 11:65932682-65932704 CTCAAGAGTCAGATCACGTGGGG - Intergenic
1084544636 11:69808725-69808747 CTCTAGAGTGAGATGGGGCAGGG - Intergenic
1089813606 11:121152564-121152586 CTGGAGATTCAGATGGGCGGTGG + Intronic
1097913486 12:64995435-64995457 CCCTAGGGTCAGATGGAGTGTGG - Intergenic
1098889573 12:75995619-75995641 CTACAGGGACAGATGGGGTGGGG - Intergenic
1103164710 12:118760556-118760578 CTCTAGAGAAAGACGGGGTGTGG + Intergenic
1106325241 13:28683063-28683085 GTCGAGAGTGAGATCGGGAGTGG + Intergenic
1108152343 13:47549381-47549403 CTCAAGAGCCAAATGGGTTGTGG - Intergenic
1110356122 13:74569745-74569767 CTGGAGGGTCACATGGGCTGTGG + Intergenic
1112099223 13:96168910-96168932 TGGGAGAGTGAGATGGGGTGAGG - Intronic
1117807660 14:59511341-59511363 CTTCAGAGTCAGATAGGCTGGGG - Intronic
1119767707 14:77200708-77200730 GCCGAGAGGCAGATGGGGAGCGG - Intronic
1120979128 14:90275570-90275592 CTGGAGAAGCAGCTGGGGTGGGG - Exonic
1122246946 14:100410088-100410110 CTGGAAACTCAGATGGGGTTTGG - Intronic
1124160338 15:27262518-27262540 CTCAATACTCAGATGGGGTAGGG - Intronic
1124407456 15:29404888-29404910 TTTGAGAGTGAGATTGGGTGGGG - Intronic
1126549952 15:49917624-49917646 CTGGAGAATCAGATGGTGTTGGG + Intronic
1127174578 15:56339816-56339838 CTCACAAGTCAGAAGGGGTGAGG - Intronic
1128422988 15:67512381-67512403 CTTGACAGTGAGATGGGGTATGG + Intergenic
1129264079 15:74384676-74384698 AGCTAGAGCCAGATGGGGTGGGG - Intergenic
1130105963 15:80928686-80928708 CTCTAGAGTCAGAGTGGGAGGGG + Intronic
1130536191 15:84786654-84786676 CTGATGCGTCAGATGGGGTGTGG + Intronic
1133026230 16:2990064-2990086 CTGGAGAGACAGATGAGGTGAGG - Intergenic
1133476823 16:6131559-6131581 CTTGAGAGTCATCTGGGGAGTGG - Intronic
1142007395 16:87696016-87696038 CTCCAGAGCCAGTTGGCGTGAGG + Intronic
1146636365 17:34508465-34508487 CTGGAGATTCAGATGTGGGGAGG - Intergenic
1147153792 17:38533198-38533220 CTGGAGAGTAGGGTGGGGTGGGG + Exonic
1147268820 17:39252259-39252281 CTCGAAAGTCAGATTGCCTGAGG - Intergenic
1148859426 17:50596357-50596379 CTGGAGAGGCAGAGGTGGTGGGG + Intronic
1149356287 17:55843392-55843414 CTGGAGAGGTAGATGGGGAGGGG - Intergenic
1150600077 17:66643254-66643276 CTGAAGAGTCAGCTGGGATGGGG + Intronic
1151920226 17:77149044-77149066 CTGGAGAGACAGATGGGGAATGG - Intronic
1152520358 17:80852648-80852670 CTGGAGGGGCAGATGGGGTATGG - Intronic
1153182755 18:2454258-2454280 CTCGAGAAGCAGATGGGATAAGG + Intergenic
1155574689 18:27231802-27231824 CAGGGGAGGCAGATGGGGTGGGG + Intergenic
1156778931 18:40826609-40826631 CTGGAGAGTCACATGTGGTGAGG + Intergenic
1157762505 18:50275046-50275068 CTGTAGAGGCAAATGGGGTGGGG + Intronic
1160111313 18:76034450-76034472 CTGAAGTCTCAGATGGGGTGGGG - Intergenic
1161283240 19:3456761-3456783 CTCGAGGCCCAGGTGGGGTGTGG - Intronic
1163662904 19:18589183-18589205 CTGCAGAGTCAGATGGGGCGGGG + Intronic
1164402484 19:27911465-27911487 CTCTTGAGTCAGATGGTCTGAGG + Intergenic
1165278383 19:34774281-34774303 CTGGAGGGGCAGATGGGGAGGGG - Intergenic
1167380819 19:49136960-49136982 CTCCAGAGCCAGAAGGGCTGTGG - Intronic
1168721598 19:58557665-58557687 CCTCAGAGTCAGAGGGGGTGGGG - Intronic
927397122 2:22665352-22665374 CTCGAGAGACAGTTGGGGGTAGG - Intergenic
931044822 2:58340188-58340210 CTGGAGAGCAGGATGGGGTGGGG + Intergenic
931781251 2:65580903-65580925 CCCGAGAGGAAGCTGGGGTGAGG + Intergenic
932418207 2:71586376-71586398 CTTGGGTGGCAGATGGGGTGAGG + Intronic
934776414 2:96940413-96940435 CAAGAGAGGCAGATCGGGTGGGG + Intronic
936658816 2:114519300-114519322 CTGTAGTGACAGATGGGGTGAGG - Intronic
938613359 2:132972080-132972102 CTGGAGAGTAAGAGTGGGTGTGG + Intronic
941001606 2:160208326-160208348 CTCCAGAGTAGGGTGGGGTGTGG - Intronic
942079288 2:172385123-172385145 CTAGGGAGGCAGGTGGGGTGGGG - Intergenic
947623280 2:231604394-231604416 CGGGGCAGTCAGATGGGGTGAGG + Intergenic
948884253 2:240875006-240875028 CACGGGAGTGAGACGGGGTGGGG - Intronic
1171211855 20:23323055-23323077 CTGGAGACTCAGAAGGGGTAGGG + Intergenic
1172035988 20:32010993-32011015 CTTCAGAGTCAGAAGGGGTGAGG - Intronic
1172090945 20:32432206-32432228 ATGGAGAGGCACATGGGGTGGGG + Intronic
1175236564 20:57516985-57517007 CTGGGGAGGCAGATGGAGTGTGG - Intronic
1177668112 21:24188299-24188321 GTTGAGAGACAGAAGGGGTGGGG - Intergenic
1180176374 21:46092176-46092198 CTCGGGGCCCAGATGGGGTGAGG - Intergenic
1181107291 22:20582767-20582789 CTCGAGGGCCAGGTGGGGAGGGG - Intronic
1182074168 22:27483770-27483792 CTCGAGAGCCTGAAAGGGTGAGG + Intergenic
1182468471 22:30532517-30532539 CTGCAGAGTCAGAAGGTGTGTGG - Exonic
1183605701 22:38865904-38865926 CTAGAGAGACAGGTGGGATGTGG + Exonic
1183751743 22:39724917-39724939 CTCAAGCCTCAGGTGGGGTGGGG - Intergenic
950039519 3:9911024-9911046 CTCGAGAGTCAGATGGGGTGAGG + Exonic
952955832 3:38556622-38556644 CTCGGGGGTCACATGGGGAGGGG + Intronic
954453935 3:50586793-50586815 CTGGAAAGCCAGGTGGGGTGGGG - Intergenic
957769790 3:84675862-84675884 CACCAGGGTCAGATGGGGGGTGG + Intergenic
964679572 3:159322641-159322663 CTGGAGTGTGAGGTGGGGTGGGG + Intronic
965703595 3:171483528-171483550 CTCTAAAGTCAGGTGGGCTGAGG - Intergenic
966712154 3:182981198-182981220 CCCTATAGTGAGATGGGGTGGGG + Intronic
967404309 3:189099293-189099315 CTCCAGTGTCACATGGTGTGTGG + Intronic
968161409 3:196430614-196430636 CTGGAGATTCACATGGGGCGAGG - Intronic
969848717 4:9940102-9940124 CAAGAGAGCCAGAGGGGGTGCGG + Intronic
969884097 4:10200034-10200056 CTATGGAGTCAGATGGTGTGTGG - Intergenic
972457930 4:39272476-39272498 CTCGAGAGTCAGCAGGGGCCAGG - Intronic
974384785 4:61190244-61190266 CTTGGGAGCAAGATGGGGTGGGG + Intergenic
975905354 4:79204716-79204738 CTGGAGACTCAGAAGGGGAGTGG - Intergenic
979357684 4:119724651-119724673 ATCGAGAGCCAGGAGGGGTGAGG + Intergenic
982899087 4:160975524-160975546 ATTGAGAGTCAGAGGTGGTGGGG + Intergenic
983014774 4:162599838-162599860 CTAGAGAATCTGTTGGGGTGAGG + Intergenic
992009064 5:72509227-72509249 CTTGGGAGTGAGGTGGGGTGAGG + Intergenic
992805576 5:80334091-80334113 CTTGGGGGTCAGATGGGGTAAGG - Intergenic
993028275 5:82671764-82671786 ATGGAGAATCCGATGGGGTGAGG - Intergenic
993962456 5:94316613-94316635 CAGGACAGCCAGATGGGGTGAGG - Intronic
995680985 5:114718965-114718987 ATGGAGAGACAGATGAGGTGAGG - Intergenic
996037221 5:118771897-118771919 CTCCAGAGTCAAATGGCCTGAGG + Intergenic
996094388 5:119382751-119382773 CTCTAGAGTCAGACTGGGTCAGG - Intronic
1000260261 5:159581345-159581367 CTCTGGAGTCAGATAGGCTGGGG + Intergenic
1001549515 5:172593104-172593126 CTCGGGAGGAAGATGAGGTGTGG + Intergenic
1001718834 5:173840014-173840036 CTGGAGAGTGGGTTGGGGTGGGG + Intergenic
1001831288 5:174791360-174791382 TTAGAGAGTAAGATGGGGTGGGG + Intergenic
1002569280 5:180130818-180130840 CTCCAGAGTCATATGGGCGGCGG + Intronic
1002905736 6:1447590-1447612 CTGGAGACTCAGAAGGGGGGAGG - Intergenic
1003737529 6:8893573-8893595 CTTTTGAGTCAGATGGAGTGAGG + Intergenic
1011066527 6:83332742-83332764 CTGGAGACTCAGATGGGAGGAGG + Intronic
1011435318 6:87329720-87329742 TTCAAGAGTAAGATGGGGTGAGG + Intronic
1013512314 6:110856316-110856338 CTGGAGAGTCAGGTAGTGTGAGG - Intronic
1019101362 6:169633235-169633257 ACCTGGAGTCAGATGGGGTGGGG - Intronic
1021604108 7:22393377-22393399 CTAGAGAGCCAGATCAGGTGCGG - Intergenic
1021658497 7:22895276-22895298 CTAGAGAAGCAGATGGGGTTGGG - Intergenic
1021891887 7:25194293-25194315 CTGGAGAGTCAGGAGGGCTGAGG + Intergenic
1022570317 7:31446342-31446364 CTCGCCATTCAGATCGGGTGGGG + Intergenic
1027150712 7:75731610-75731632 CTCCAGAAGCAGAAGGGGTGGGG + Intronic
1029457445 7:100678367-100678389 CACGGGACCCAGATGGGGTGAGG - Intronic
1033233980 7:139623780-139623802 CTCCAGAGTCAGAGGGGGCTGGG - Intronic
1036009140 8:4701432-4701454 CTGGAGAGTCTGATGGGGAGGGG + Intronic
1038395244 8:27241623-27241645 GCCGAGCGTCAGATGGGCTGTGG - Intronic
1039419152 8:37421186-37421208 CTGCAGAGCCAGATGGGGAGGGG - Intergenic
1039917496 8:41870913-41870935 TTCGAGAGCCAGGAGGGGTGGGG - Intronic
1046367048 8:113248037-113248059 CTTGAGAGTCAGATGCAGTGTGG - Intronic
1047899866 8:129408413-129408435 CTGGAGATTCAGAAGGGTTGGGG - Intergenic
1055249716 9:74288885-74288907 CTACACAGTCAGATGGGGTCTGG - Intergenic
1056804993 9:89721623-89721645 CTTGCAAGACAGATGGGGTGAGG + Intergenic
1057497679 9:95573731-95573753 GTTGAGAGTGAGATGGGGCGCGG - Intergenic
1059309894 9:113381072-113381094 CTGGGGAGTGAGATGGGGTGGGG - Intergenic
1060687828 9:125627719-125627741 TTGGAGGGTGAGATGGGGTGGGG - Intronic
1061888635 9:133606071-133606093 CTGGAGAGTCAGGTGGGGTCCGG - Intergenic
1062271765 9:135713077-135713099 CTCAAAAGGCAGACGGGGTGGGG + Intronic
1062479847 9:136746214-136746236 CTCGGGGGAAAGATGGGGTGGGG + Intronic
1187295791 X:17999290-17999312 CTCCTTAGTCAGATGGGCTGAGG + Intergenic
1192534389 X:71914849-71914871 CTCTTGAGTCAGATGGAGTGGGG + Intergenic
1192783781 X:74318944-74318966 ATCCAAAGTCTGATGGGGTGGGG + Intergenic
1196757225 X:119168519-119168541 GAAGAGAGACAGATGGGGTGAGG - Intergenic
1197290715 X:124653899-124653921 CTTGAAAGACAGATGGGGTGGGG - Intronic
1198233104 X:134712263-134712285 CTGGGAAGTCAGATGGGGTATGG - Intronic
1200353995 X:155528489-155528511 CTGGAGACTCAGAAGGGGAGAGG - Intronic
1200919232 Y:8598430-8598452 CAATAAAGTCAGATGGGGTGAGG + Intergenic
1202180619 Y:22136786-22136808 CAATACAGTCAGATGGGGTGAGG - Intergenic
1202210741 Y:22449613-22449635 CAATACAGTCAGATGGGGTGAGG + Intergenic