ID: 950040910

View in Genome Browser
Species Human (GRCh38)
Location 3:9918446-9918468
Sequence AAGGCCTGGCCTGCCGCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 257}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950040901_950040910 3 Left 950040901 3:9918420-9918442 CCTGGCTGGCCCAACTGCCCCAT 0: 1
1: 0
2: 1
3: 24
4: 236
Right 950040910 3:9918446-9918468 AAGGCCTGGCCTGCCGCTCCTGG 0: 1
1: 0
2: 2
3: 18
4: 257
950040903_950040910 -6 Left 950040903 3:9918429-9918451 CCCAACTGCCCCATGCCAAGGCC 0: 1
1: 0
2: 0
3: 19
4: 205
Right 950040910 3:9918446-9918468 AAGGCCTGGCCTGCCGCTCCTGG 0: 1
1: 0
2: 2
3: 18
4: 257
950040904_950040910 -7 Left 950040904 3:9918430-9918452 CCAACTGCCCCATGCCAAGGCCT 0: 1
1: 0
2: 3
3: 35
4: 285
Right 950040910 3:9918446-9918468 AAGGCCTGGCCTGCCGCTCCTGG 0: 1
1: 0
2: 2
3: 18
4: 257
950040898_950040910 23 Left 950040898 3:9918400-9918422 CCTAGGAATGGTGAGGAGAACCT 0: 1
1: 0
2: 2
3: 18
4: 192
Right 950040910 3:9918446-9918468 AAGGCCTGGCCTGCCGCTCCTGG 0: 1
1: 0
2: 2
3: 18
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950040910 Original CRISPR AAGGCCTGGCCTGCCGCTCC TGG Intronic
900090610 1:918754-918776 AAGGCCTTGCCTGCAGCACAGGG - Intergenic
900132216 1:1091981-1092003 AGGGCCTTACCTGCCCCTCCAGG + Exonic
900418791 1:2546762-2546784 AAGGCCTGGCGCGCCGCCTCCGG + Intergenic
900705155 1:4075944-4075966 CACGCCTGGGCTGCCTCTCCTGG + Intergenic
900790146 1:4674611-4674633 AAGGCCTGGCCAGCCACTCCTGG - Intronic
900932675 1:5746966-5746988 CAGGTCTGGGCTGCCGCTCAGGG - Intergenic
900974583 1:6009058-6009080 AGAGCGTGGCCTGCAGCTCCTGG - Intronic
901787482 1:11634331-11634353 AAGGCCCTGCCTCCCTCTCCAGG - Intergenic
901919912 1:12528511-12528533 AAGGCCTGGCCAGCTGCCCAGGG + Intergenic
902375413 1:16027953-16027975 AAGGCCTGGACTGCGGCCCCTGG + Intronic
902380377 1:16049750-16049772 AAGGCCTGGACTGCGGCCCCTGG + Intronic
903999733 1:27332147-27332169 AAGGCCTGGCCCGCCCCGGCAGG - Intronic
904190165 1:28737204-28737226 AGGCCCGGGCCCGCCGCTCCTGG + Intronic
904272847 1:29361911-29361933 AAGTCCTGGCCCGCATCTCCAGG - Intergenic
904503130 1:30929202-30929224 CAGGCCTGGTCTACCACTCCAGG + Intergenic
905240355 1:36577016-36577038 AGGGCCTGGCCTGCTGGTGCGGG + Intergenic
906526588 1:46496837-46496859 GAGCCCTGGCTTGCTGCTCCCGG + Intergenic
907809080 1:57850642-57850664 AAGGCCTGGCCTGCAAGTGCCGG + Intronic
911449318 1:98044937-98044959 AAGGCGTGGGCTGGGGCTCCAGG - Intergenic
911467845 1:98277299-98277321 GAGGCCTGGCCTGCCACACCAGG - Intergenic
912834781 1:112986495-112986517 GAGGCTTGGGCTGCTGCTCCAGG - Intergenic
914921185 1:151848318-151848340 AAGGCCTGGGCTGGGGCTGCTGG + Intronic
915486804 1:156227010-156227032 AAGGCCTGGGCTGCCCACCCTGG - Intronic
917817333 1:178724884-178724906 ACCGCCTGGCCACCCGCTCCCGG - Intergenic
920390319 1:205596217-205596239 AAGGCATGGCCATCCTCTCCTGG + Intronic
923460675 1:234206847-234206869 AAGACCTTGCCTGCAGGTCCCGG + Intronic
924246180 1:242087275-242087297 AAAGCCTGGGATGCGGCTCCTGG + Exonic
1067091393 10:43267221-43267243 AAAGCCTGGCCGCCCTCTCCCGG - Intergenic
1069733912 10:70638864-70638886 CAGGCATGAGCTGCCGCTCCCGG + Intergenic
1069857934 10:71451917-71451939 AGCGCCTGGCCTGAGGCTCCAGG - Intronic
1070204535 10:74243251-74243273 AGGACCTGGCCGGCTGCTCCAGG - Intronic
1070801685 10:79247626-79247648 AAGGCCTGGCCTCACCCTACGGG - Intronic
1070816791 10:79329355-79329377 AGGGCCAGGCCTACCTCTCCTGG - Intergenic
1070829118 10:79407915-79407937 GAGGGCTGGCCTGGCTCTCCTGG + Intronic
1071563785 10:86661427-86661449 AGGGCCTGGCCTGCCGATGGGGG + Intronic
1071814718 10:89220686-89220708 AGAGCCTGGCCTGAGGCTCCTGG - Intronic
1072692430 10:97580812-97580834 AGGGCCTGGCCTCTGGCTCCAGG - Intronic
1075968725 10:126635019-126635041 AAGGCCTGGCCAACCGCCTCAGG + Intronic
1076165880 10:128282177-128282199 AACGCATGGCCTGCTGCTCCTGG + Intergenic
1076564563 10:131389310-131389332 CTTGCCTGGCCTGCCTCTCCTGG + Intergenic
1076841067 10:133045510-133045532 AGGGCCAGGCCTGGAGCTCCCGG - Intergenic
1076915756 10:133422575-133422597 AAGGCCTGGACAGCCCCTCAGGG + Exonic
1077250750 11:1559583-1559605 AAGCCCTGGCCTCCTGGTCCTGG - Intronic
1077473171 11:2774360-2774382 AAGGAAGGGCCTGCTGCTCCTGG - Intronic
1077505910 11:2929861-2929883 AAGTCCAGCCCTGCCGCTCTCGG + Intergenic
1077547874 11:3183714-3183736 CAGGCCGGGCCTGCAGCTTCTGG + Intergenic
1077582209 11:3423509-3423531 AAGGCCTGACCGGACGATCCCGG - Intergenic
1078861677 11:15253757-15253779 ATGACCTGTCCTGCCTCTCCAGG + Intergenic
1081283902 11:41245424-41245446 AAGGCATGGCAGGCAGCTCCAGG + Intronic
1083780152 11:64913554-64913576 AAGGGCTGGCCTGAGCCTCCGGG - Intronic
1084239132 11:67806326-67806348 AAGGCCTGACCCGACGATCCCGG - Intergenic
1084833307 11:71786515-71786537 AAGGCCTGACCCGACGATCCCGG + Intergenic
1086324556 11:85685335-85685357 GCAGCCTGGCCTGCAGCTCCTGG + Exonic
1087369805 11:97269374-97269396 AAGTCCTGGACTGCAGCTCTAGG - Intergenic
1088128952 11:106464060-106464082 AAGGCATGTCCTGTCACTCCTGG - Intergenic
1089012887 11:115145056-115145078 CAGGCAGGGCCTGCAGCTCCAGG + Intergenic
1089138316 11:116266943-116266965 CAGGCGTGGGCTGCCGCACCTGG - Intergenic
1090239531 11:125172220-125172242 AAGGCCTTACCTGGTGCTCCTGG - Intronic
1091342306 11:134825353-134825375 AAGGGTGGGCCTGCCTCTCCCGG + Intergenic
1091510805 12:1123715-1123737 CAGGCGTGGGCTGCCGCGCCCGG - Intronic
1091723982 12:2833183-2833205 AAGGCGGGACCTGCCACTCCGGG + Intronic
1091989594 12:4944239-4944261 AAGGGCTGGCCTGCTCCTCTTGG + Intergenic
1092884831 12:12915855-12915877 CAGGGCTGGCCTGCCCCTGCAGG - Exonic
1093438034 12:19159815-19159837 AAGGCCTTGCCTGTCTCTACGGG - Intronic
1095294755 12:40515275-40515297 ATGTCCTGGCCTGTTGCTCCTGG - Intronic
1096513704 12:52145363-52145385 AAGCCCAGGCCTGCCACTCAGGG - Intergenic
1101800752 12:108020012-108020034 ATGGCCTGGCCTCATGCTCCTGG - Intergenic
1104011452 12:124933325-124933347 CAGGCCTGAGCTGCCGCACCGGG - Intergenic
1104196486 12:126543960-126543982 AAGGCTTGGACTTCTGCTCCTGG + Intergenic
1104614533 12:130256927-130256949 CAGGGCTGGCCGGCTGCTCCGGG + Intergenic
1105547999 13:21365819-21365841 GAGCCCTGACCTGCCCCTCCAGG + Intergenic
1107455002 13:40546635-40546657 ACAGCCTGGCCTCCTGCTCCAGG - Intergenic
1112310450 13:98313415-98313437 AAGCCCTGGCATCCCGCTCCTGG - Intronic
1113088789 13:106595799-106595821 GAGGCCTGGCCGCCTGCTCCTGG - Intergenic
1113418958 13:110155105-110155127 AAAGCCTGGCCTGCCCTGCCTGG - Intronic
1114416342 14:22547237-22547259 CAGGCCTGGCCTGCCACTCAAGG - Intergenic
1118256690 14:64211586-64211608 AAGGCCTGGCCTGGCCCCTCAGG + Intronic
1119322971 14:73742427-73742449 GAGGCGGGGCCTGCGGCTCCAGG + Intronic
1119892643 14:78194539-78194561 AGGGCCTGGCCTGCCGGGCCTGG + Intergenic
1121883603 14:97522764-97522786 AAGGCCTTGCCTGATGCTTCCGG + Intergenic
1122143798 14:99677023-99677045 AAGGCCTGCCCAGCCACCCCTGG - Exonic
1122172111 14:99885294-99885316 ATGGTCTAGCCTGCTGCTCCTGG + Intronic
1122271022 14:100568519-100568541 TGGGCCTGGCTTGCCCCTCCCGG + Intronic
1122273553 14:100579503-100579525 AGGGCCTGGGCTGCCACCCCTGG - Intronic
1122692179 14:103536635-103536657 CAAGCCTGCCCTGCCCCTCCTGG + Exonic
1123487848 15:20756840-20756862 AAGGCATGGACCGCCGCACCCGG + Intergenic
1123544347 15:21325916-21325938 AAGGCATGGACCGCCGCACCCGG + Intergenic
1124252382 15:28115399-28115421 GAGGCCCCGCCTGCCGCCCCAGG + Intronic
1124618886 15:31262805-31262827 AAGGGCTTGCCTGCCACACCAGG - Intergenic
1124900466 15:33817989-33818011 AGGGCAAGGCCTGCAGCTCCAGG + Intronic
1127395839 15:58543327-58543349 AAGGCCTTGCCTGTGCCTCCCGG - Intronic
1128649332 15:69399033-69399055 GAGGCCTGGCCTGCTGCCCTCGG + Intronic
1128780651 15:70356737-70356759 AAAGCCCAGCCTGCCCCTCCTGG + Intergenic
1130649482 15:85754092-85754114 AAGCCATGGCCTGACCCTCCGGG + Intergenic
1131860651 15:96649923-96649945 CAGGCCAGACCTGCCTCTCCTGG + Intergenic
1132346327 15:101111305-101111327 TCGGCGTGGCCTGCCTCTCCTGG + Intergenic
1202952692 15_KI270727v1_random:53188-53210 AAGGCATGGACCGCCGCACCCGG + Intergenic
1132672083 16:1106156-1106178 AGGGCCTGGCCTGGGGGTCCTGG - Intergenic
1133784480 16:8963711-8963733 GAGGCCTGGCCGGCCGCGGCGGG + Intronic
1135528269 16:23230436-23230458 CAGGGCTGGCCTGGAGCTCCTGG - Intergenic
1137383930 16:48024179-48024201 AGGGCCTGGCATGCAGCTTCTGG - Intergenic
1137505331 16:49049479-49049501 AACACCTGGGCTGCCACTCCCGG + Intergenic
1140133051 16:72180961-72180983 CAGGCCTGAGCTACCGCTCCCGG - Intergenic
1140776093 16:78250042-78250064 AAGGCCAGGTCTGTCCCTCCAGG - Intronic
1142004764 16:87684436-87684458 AAGGCCTGGCCTGGCTCCCCGGG + Intronic
1142401892 16:89863277-89863299 GAGGCCTGGCCTGCAGCAGCAGG + Intronic
1143209999 17:5179093-5179115 GAGGCCTGCCCTGCTGCTGCTGG - Intergenic
1146008932 17:29179377-29179399 AATGCCTGGCCTGTCCCTGCGGG + Intronic
1146174039 17:30653465-30653487 ACGGCCAGGGCTGCAGCTCCAGG + Intergenic
1146347494 17:32069492-32069514 ACGGCCAGGGCTGCAGCTCCAGG + Intergenic
1148680829 17:49472631-49472653 AAGGCGTGGCCACCCCCTCCTGG - Intronic
1148859964 17:50599658-50599680 AACTCTTGGCCTCCCGCTCCAGG - Exonic
1148891690 17:50812186-50812208 CAGGCGTGAGCTGCCGCTCCTGG + Intergenic
1151924648 17:77186159-77186181 AGGCCCTGGCCTTCCTCTCCAGG - Intronic
1152003777 17:77664184-77664206 AAGGCAGGGCCTGCAGCTCCCGG + Intergenic
1152260280 17:79263093-79263115 CAGGCCTAGCGTGCCCCTCCAGG + Intronic
1152585696 17:81188548-81188570 TAAGCCTGGCCAGCCCCTCCTGG + Intergenic
1152612270 17:81321723-81321745 AGGGCCTGTCCTGCAGCTACTGG + Intronic
1152654190 17:81512496-81512518 AAGGCCCGGCCTTCGGTTCCAGG - Exonic
1152832906 17:82509697-82509719 CAGGCGTGGGCCGCCGCTCCCGG + Intergenic
1153777309 18:8465411-8465433 CAGGCGTGAGCTGCCGCTCCAGG - Intergenic
1156309272 18:35907794-35907816 AAGGCCTGGCCTGCAACACCTGG - Intergenic
1157947031 18:51991899-51991921 GAAGCCTGGCCTGCATCTCCAGG - Intergenic
1160680213 19:408827-408849 AACGCCTGGCCCTCCGGTCCAGG - Intronic
1162391651 19:10393582-10393604 AAGGCCTGGGCTCCCCCGCCGGG + Intronic
1162988372 19:14286565-14286587 ACGGCCAGGGCTGCAGCTCCAGG - Intergenic
1163780929 19:19247666-19247688 CAGGCCTGAGCTGCCGCACCCGG + Intronic
1164616048 19:29667349-29667371 AGGGCCTGGTCTCCAGCTCCCGG + Intronic
1164941506 19:32254970-32254992 CAGCCCTGGCCAGCAGCTCCAGG + Intergenic
1165318588 19:35072587-35072609 GAGACCTGGCCTGCCACACCTGG - Intergenic
1165432940 19:35782685-35782707 AAGTCCCGCCCTGCCCCTCCTGG - Intronic
1167661433 19:50798138-50798160 ACCGCCTGGCCTGGTGCTCCAGG - Exonic
927053329 2:19350252-19350274 AAGTCCTGGGCCGCCCCTCCAGG + Intergenic
927399488 2:22694780-22694802 AAGGCCTGTCATGCCGCACAGGG + Intergenic
927612236 2:24552640-24552662 AAGGCGTGACCCACCGCTCCCGG + Intronic
927697313 2:25247158-25247180 AAGGCCTGGCTTGTCCCCCCAGG - Exonic
929243942 2:39681953-39681975 AAGGCCAGGCCTACAGCTCCTGG - Intronic
929533885 2:42768543-42768565 GAGGCCTGGCCTGCTGCTCTTGG - Intronic
930960974 2:57261139-57261161 CAGGCGTGAGCTGCCGCTCCTGG + Intergenic
934972630 2:98775319-98775341 AAGTCCTGGCCAGTCTCTCCCGG + Intergenic
935698001 2:105786661-105786683 GTGGCCTGGCCTGACTCTCCTGG + Intronic
936153051 2:110032095-110032117 AAGGCTGGGCCTGCCACTCAAGG + Intergenic
936191629 2:110339317-110339339 AAGGCTGGGCCTGCCACTCAAGG - Intergenic
936661585 2:114549383-114549405 TAGGCGTGAGCTGCCGCTCCAGG - Intronic
937155172 2:119713962-119713984 ATGACCCGGCCTGCCGCTTCAGG + Intergenic
938311183 2:130288900-130288922 AAGTCCTGGCCAGGCGCCCCCGG - Intergenic
938661548 2:133492037-133492059 AAGGCCTTCCCAGCCACTCCAGG + Intronic
944148427 2:196531378-196531400 CAGGCCTGAGCTGCCGCACCTGG - Intronic
944505318 2:200404866-200404888 AAGGCTTGGCCAGCCTCTCCGGG - Intronic
947073474 2:226317120-226317142 ATGTCCTGGCCTCCTGCTCCAGG + Intergenic
947273151 2:228361799-228361821 TAGGCCTGAGCTGCCGCACCAGG + Intergenic
947832993 2:233154972-233154994 GAGACCTGGCCTGCCACACCGGG + Intronic
947866418 2:233400747-233400769 AAGGCCTGAGCTGCTGTTCCCGG + Intronic
948257458 2:236578442-236578464 ACGGCCAGGCCTCCCGCTGCAGG + Intronic
948689193 2:239691298-239691320 CAGCCCTGGGCTGCTGCTCCTGG - Intergenic
948886310 2:240886885-240886907 GAGGCCTGCCCTGCCCCACCAGG + Exonic
948945107 2:241215396-241215418 AGGGCCTCGCCTCCCGCTCAAGG + Intronic
949017187 2:241720142-241720164 AAAGCCTGGCCTGCCGGGGCGGG + Intronic
949065467 2:241987711-241987733 AGGCCCTGGGCTGCAGCTCCTGG + Intergenic
1168903151 20:1382970-1382992 GAGACCTGGCCAGCAGCTCCTGG + Intronic
1172170735 20:32930415-32930437 CAGGCCTCGCCTGCCGCACACGG + Intronic
1172484635 20:35290968-35290990 AAGCCCTGGCCTCCGACTCCAGG - Intronic
1172671265 20:36635784-36635806 AAGCCCTGGCCTTGCACTCCCGG + Intronic
1172852079 20:37973764-37973786 GAGGCCTGACCTGCCTCTCTTGG + Intergenic
1174360727 20:50027593-50027615 AAGGCCAGGCCTGCAGCCCTGGG + Intergenic
1175399232 20:58691566-58691588 AAAGCCTGGCTTGTGGCTCCCGG + Intronic
1175918026 20:62436519-62436541 AGGGCCTGGCCATCCGCGCCTGG - Intergenic
1176415898 21:6474633-6474655 CAGGCCTGTCCTGCTGCCCCCGG + Intergenic
1178677995 21:34647280-34647302 AAGTCCTTGCCTGCCTCTCCAGG + Intergenic
1179537791 21:42063441-42063463 AATGCCTGGCCTCCAGCCCCAGG - Intronic
1179691398 21:43082967-43082989 CAGGCCTGTCCTGCTGCCCCCGG + Intergenic
1179726671 21:43344831-43344853 AAGCCCCTGCCTGCCGCCCCCGG - Intergenic
1179862434 21:44197351-44197373 AGGTCCTGGCCTGCCGCCCAGGG + Intergenic
1180707153 22:17816995-17817017 TAGGCCTGCCCAGCCCCTCCTGG + Intronic
1180873192 22:19159482-19159504 AAGGCATGACCAGCCACTCCCGG + Intergenic
1181038275 22:20180165-20180187 CAGGCCTGCCCTGCCACCCCCGG + Intergenic
1181496014 22:23287944-23287966 ACGGCCTGGCATGTCGCTTCCGG - Intronic
1181552474 22:23648634-23648656 CAGGCATGAGCTGCCGCTCCTGG + Intergenic
1181735218 22:24876281-24876303 AAGGCTTGGCCTCCTGCTCTGGG + Intronic
1183828344 22:40405343-40405365 AAGGAGTGGCCTCCCGCTACGGG + Intronic
1183828364 22:40405401-40405423 AAGGAGTGGCCTCCCACTCCGGG + Intronic
1183864138 22:40690730-40690752 CAGGCCTGGCCTGCTGTCCCAGG + Intergenic
1184011567 22:41752616-41752638 AAAACCTGGCCTTCAGCTCCAGG - Exonic
1184301426 22:43563031-43563053 AGGTCCTGGCCTGCGGCACCAGG + Intronic
1185182170 22:49369789-49369811 CAGGCCTGGGCTGCCCCTTCAGG - Intergenic
950040910 3:9918446-9918468 AAGGCCTGGCCTGCCGCTCCTGG + Intronic
952918043 3:38264375-38264397 AAGGCCTGACATGCTGCTCAGGG - Intergenic
953055450 3:39383976-39383998 CAGGGCTGGCCTGCAGCTCCTGG - Intronic
953192598 3:40701595-40701617 GAGGCCTGGTCTGCCTCTCAAGG - Intergenic
953792342 3:45957882-45957904 CAGGCCTGGGCTGCCCTTCCGGG - Intronic
954164126 3:48742508-48742530 CAGGCGTGAGCTGCCGCTCCGGG - Intergenic
954303788 3:49714984-49715006 CAGGCCTGTCCTGCTGCTGCGGG + Intronic
954539071 3:51381912-51381934 AGGGCCTGGGCTCCCACTCCTGG - Exonic
955047934 3:55377336-55377358 AGGGCCAGGCCTGTCCCTCCTGG - Intergenic
955525453 3:59815208-59815230 GTGGCCTGGGCTGCAGCTCCAGG - Intronic
956272802 3:67465684-67465706 ATGGCCAGGCCAGCCTCTCCTGG + Intronic
956420198 3:69079930-69079952 GGGGCCTGGCGGGCCGCTCCCGG - Intronic
961858157 3:129893360-129893382 CGGGCCTGGCCTCCCGCTCGCGG - Intronic
963169008 3:142232346-142232368 AAGGCCTGGACTCCCTCTCCTGG + Intergenic
963871157 3:150415534-150415556 AAGGCATGAGCTACCGCTCCTGG - Intronic
968012172 3:195290224-195290246 CAGGCATGCCCTGCCACTCCCGG - Intronic
968506278 4:972794-972816 AGGGCCCGGCCTGGCTCTCCAGG + Intronic
968606746 4:1539187-1539209 GAGACCTGGCCTGCCGCACTTGG + Intergenic
969244659 4:5924617-5924639 AAGACCTGGGCTGCTGCTCCAGG - Intronic
969606800 4:8205928-8205950 AAGGCCTGCACGGCCCCTCCCGG + Intronic
970730385 4:19096649-19096671 AAGACTTGGCCTGCCACTTCAGG - Intergenic
971039781 4:22738843-22738865 AAGGCCTGTCCTGCTGTTCAGGG + Intergenic
973631513 4:52824981-52825003 ATGGCCTGGCCTGCTGCTCGAGG - Intergenic
980984569 4:139683115-139683137 AAAGCCTGGACTGCTGGTCCAGG - Intronic
984852974 4:184169498-184169520 AATCCCAGGCCTGCTGCTCCAGG - Intronic
985617608 5:933236-933258 AGGGCCTGACCTGCTGCTCAGGG - Intergenic
986044666 5:4025457-4025479 AAGGCCAGGCCAGGCTCTCCAGG - Intergenic
994318409 5:98360860-98360882 AAGGCCTGCCATGCTCCTCCAGG - Intergenic
997199885 5:132003496-132003518 AGGCCCTCCCCTGCCGCTCCTGG - Intronic
998528330 5:142862660-142862682 AAGGACTGCTCTGCCTCTCCAGG - Intronic
998548579 5:143053471-143053493 ATGACCTGGCCTGCCTCACCAGG + Intronic
1002060585 5:176623481-176623503 GAGGCCTGGCCTCCGTCTCCTGG + Intronic
1002106640 5:176882478-176882500 AGGGCCTGGCAGGCCGGTCCAGG - Intronic
1002467319 5:179414056-179414078 AAGGCCAGGCCTGGGGCTCTCGG + Intergenic
1002504172 5:179667385-179667407 CAGGCATGAGCTGCCGCTCCTGG + Intergenic
1004427183 6:15514318-15514340 AGGGCCTGACCTGCCTCCCCGGG + Intronic
1006147710 6:31969235-31969257 AAGGCCTGCCTTCCTGCTCCAGG - Intronic
1006186188 6:32182890-32182912 AAGGCCTGGGCTGAAGCTACAGG + Exonic
1006342879 6:33456178-33456200 ACGGCCTGGCCTGCTCCCCCAGG - Exonic
1007718858 6:43873471-43873493 AAGGCCTGCCCTGCCCTTCTTGG - Intergenic
1009246430 6:61244265-61244287 CAGGCCTGAGCAGCCGCTCCCGG - Intergenic
1009623487 6:66105603-66105625 AAGGCGTGGCCTGACGCTCCTGG + Intergenic
1019517732 7:1447144-1447166 TATGCCTGGACTGCCACTCCAGG - Intronic
1020027752 7:4911131-4911153 CAGGCCTGGCTTACCGCTCATGG + Exonic
1021840034 7:24714816-24714838 CAGGCCTGGGCTGCCACTCTAGG - Intronic
1022641624 7:32190850-32190872 AAAGCCTGGCCTGACTCCCCAGG - Intronic
1022804859 7:33811478-33811500 AAGGCCTGGCCTGCCCAACGTGG + Intergenic
1024307615 7:47941342-47941364 CAGCCCTGGCCTGGAGCTCCTGG - Intronic
1025853863 7:65262238-65262260 AAGGCCTGGTCTTCAGCCCCTGG - Intergenic
1034531805 7:151700615-151700637 AATGCCAGGCCTGCCGGTCTGGG + Intronic
1035286953 7:157812813-157812835 CAGCCCTGGGCTACCGCTCCGGG - Intronic
1036694817 8:10967585-10967607 AGAGCCTGGCCTCCAGCTCCAGG - Intronic
1037673728 8:21037049-21037071 CACTGCTGGCCTGCCGCTCCGGG - Intergenic
1037778243 8:21849598-21849620 GAGTCCTGCCCTGCCCCTCCCGG - Intergenic
1038446117 8:27605404-27605426 AGGGCCTGGCCTGGCTCACCAGG - Intronic
1040592196 8:48803821-48803843 AAAGCCTGGTCCCCCGCTCCAGG - Intergenic
1041437555 8:57859192-57859214 AAGACCTGACCTGCAGCTGCTGG + Intergenic
1043753523 8:83970957-83970979 CAGGCCTGGCGTGGGGCTCCGGG + Intergenic
1043995630 8:86811682-86811704 AAGGCATGGGCTACCGCACCCGG + Intergenic
1044822013 8:96161096-96161118 AAAGGCTGGCCCGCCGCGCCAGG + Intergenic
1045467777 8:102485773-102485795 CTGGCCTGCCCTGCCGCCCCGGG - Intergenic
1047225714 8:122954001-122954023 TAGGCCTGGCCAGCCTCTGCAGG - Exonic
1047499613 8:125431110-125431132 CAGCCCCCGCCTGCCGCTCCGGG + Exonic
1047898810 8:129397493-129397515 CAGGCCTGTCCTGCAGTTCCTGG - Intergenic
1047999381 8:130365124-130365146 AAGGCCAAGCCTGGGGCTCCAGG - Intronic
1048133036 8:131718541-131718563 AAGACCTGATCTGCTGCTCCAGG - Intergenic
1048239536 8:132727531-132727553 CAGGCCTGACCTGCCGTGCCCGG + Intronic
1049200133 8:141336036-141336058 AAAGACTGACCTGCCCCTCCAGG - Intergenic
1049279322 8:141736399-141736421 AAGGTCTGGGGAGCCGCTCCAGG - Intergenic
1049434214 8:142579094-142579116 AGGGCCTGGCCTGGGGCTCGGGG - Intergenic
1049620556 8:143596545-143596567 ATGGCCTGGCCTGCCTCCCTGGG + Intronic
1049741100 8:144241393-144241415 AGGGCCTCGCCTGCTGCTTCGGG + Exonic
1051756700 9:20408586-20408608 AAGGGCTGCCCTGGCTCTCCAGG - Intronic
1053221980 9:36319876-36319898 GAGGCCTGGCCTGCCATACCAGG - Intergenic
1056290891 9:85142850-85142872 AAGGCTTTGACTGCCACTCCAGG + Intergenic
1056665599 9:88578621-88578643 TAGGCCGGGCCGGCGGCTCCTGG - Intronic
1057042519 9:91857773-91857795 AAGGGCTGCCCTGTGGCTCCAGG - Intronic
1057091676 9:92263720-92263742 GAGGCCTGGGCTACCTCTCCTGG - Intronic
1060048326 9:120358675-120358697 CTGGCCAGGCCTGCAGCTCCAGG + Intergenic
1060053026 9:120390513-120390535 CAGGGCTCGCCTGCCCCTCCTGG - Intronic
1061501006 9:131001836-131001858 AAGGGCTGGGCAGCAGCTCCAGG - Intergenic
1061838752 9:133345729-133345751 GAAGCCTGGCCTGCCACCCCTGG + Intronic
1061930668 9:133831535-133831557 ATGGCCAGGCCTGCCCCTGCTGG - Intronic
1062121055 9:134834211-134834233 CAGGGCTCGCCTGCTGCTCCAGG + Intronic
1062180011 9:135186260-135186282 AAAGCCAGCGCTGCCGCTCCTGG - Intergenic
1062717342 9:138017850-138017872 AGGGCCTGGCCTTGCCCTCCAGG - Intronic
1185889874 X:3814552-3814574 AAGGCAGGGGCTGCCGCTCGCGG + Intergenic
1197929234 X:131678300-131678322 AGGGCCTGGCCTGGGGCCCCCGG + Intergenic
1198846773 X:140920768-140920790 CAGGCGTGACCTACCGCTCCTGG - Intergenic
1200251619 X:154557181-154557203 AACGCGTGGCCTCCCGCTTCTGG + Intronic
1200253826 X:154568865-154568887 AACGCGTGGCCTCCCGCTTCTGG + Intergenic
1200263943 X:154635543-154635565 AACGCGTGGCCTCCCGCTTCTGG - Intergenic
1200266148 X:154647235-154647257 AACGCGTGGCCTCCCGCTTCTGG - Intergenic