ID: 950043232

View in Genome Browser
Species Human (GRCh38)
Location 3:9933485-9933507
Sequence CCAGGGCTGGCTGAAGGGCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 767
Summary {0: 1, 1: 0, 2: 3, 3: 82, 4: 681}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950043232_950043240 -1 Left 950043232 3:9933485-9933507 CCGGGCCCTTCAGCCAGCCCTGG 0: 1
1: 0
2: 3
3: 82
4: 681
Right 950043240 3:9933507-9933529 GATAGCTACTTCCATCCCCCGGG 0: 1
1: 0
2: 0
3: 7
4: 103
950043232_950043251 22 Left 950043232 3:9933485-9933507 CCGGGCCCTTCAGCCAGCCCTGG 0: 1
1: 0
2: 3
3: 82
4: 681
Right 950043251 3:9933530-9933552 GACTCCCGCGCCGGGACGCGGGG 0: 1
1: 0
2: 0
3: 7
4: 67
950043232_950043252 25 Left 950043232 3:9933485-9933507 CCGGGCCCTTCAGCCAGCCCTGG 0: 1
1: 0
2: 3
3: 82
4: 681
Right 950043252 3:9933533-9933555 TCCCGCGCCGGGACGCGGGGTGG 0: 1
1: 0
2: 3
3: 16
4: 144
950043232_950043249 20 Left 950043232 3:9933485-9933507 CCGGGCCCTTCAGCCAGCCCTGG 0: 1
1: 0
2: 3
3: 82
4: 681
Right 950043249 3:9933528-9933550 GGGACTCCCGCGCCGGGACGCGG 0: 1
1: 0
2: 0
3: 10
4: 117
950043232_950043243 13 Left 950043232 3:9933485-9933507 CCGGGCCCTTCAGCCAGCCCTGG 0: 1
1: 0
2: 3
3: 82
4: 681
Right 950043243 3:9933521-9933543 TCCCCCGGGGACTCCCGCGCCGG 0: 1
1: 0
2: 1
3: 8
4: 118
950043232_950043241 0 Left 950043232 3:9933485-9933507 CCGGGCCCTTCAGCCAGCCCTGG 0: 1
1: 0
2: 3
3: 82
4: 681
Right 950043241 3:9933508-9933530 ATAGCTACTTCCATCCCCCGGGG 0: 1
1: 0
2: 0
3: 5
4: 55
950043232_950043245 14 Left 950043232 3:9933485-9933507 CCGGGCCCTTCAGCCAGCCCTGG 0: 1
1: 0
2: 3
3: 82
4: 681
Right 950043245 3:9933522-9933544 CCCCCGGGGACTCCCGCGCCGGG 0: 1
1: 0
2: 4
3: 15
4: 216
950043232_950043239 -2 Left 950043232 3:9933485-9933507 CCGGGCCCTTCAGCCAGCCCTGG 0: 1
1: 0
2: 3
3: 82
4: 681
Right 950043239 3:9933506-9933528 GGATAGCTACTTCCATCCCCCGG 0: 1
1: 0
2: 0
3: 4
4: 82
950043232_950043254 26 Left 950043232 3:9933485-9933507 CCGGGCCCTTCAGCCAGCCCTGG 0: 1
1: 0
2: 3
3: 82
4: 681
Right 950043254 3:9933534-9933556 CCCGCGCCGGGACGCGGGGTGGG 0: 1
1: 0
2: 2
3: 18
4: 204
950043232_950043250 21 Left 950043232 3:9933485-9933507 CCGGGCCCTTCAGCCAGCCCTGG 0: 1
1: 0
2: 3
3: 82
4: 681
Right 950043250 3:9933529-9933551 GGACTCCCGCGCCGGGACGCGGG 0: 1
1: 0
2: 1
3: 11
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950043232 Original CRISPR CCAGGGCTGGCTGAAGGGCC CGG (reversed) Exonic