ID: 950043235

View in Genome Browser
Species Human (GRCh38)
Location 3:9933491-9933513
Sequence AGCTATCCAGGGCTGGCTGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 213}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950043235_950043240 -7 Left 950043235 3:9933491-9933513 CCTTCAGCCAGCCCTGGATAGCT 0: 1
1: 0
2: 2
3: 20
4: 213
Right 950043240 3:9933507-9933529 GATAGCTACTTCCATCCCCCGGG 0: 1
1: 0
2: 0
3: 7
4: 103
950043235_950043249 14 Left 950043235 3:9933491-9933513 CCTTCAGCCAGCCCTGGATAGCT 0: 1
1: 0
2: 2
3: 20
4: 213
Right 950043249 3:9933528-9933550 GGGACTCCCGCGCCGGGACGCGG 0: 1
1: 0
2: 0
3: 10
4: 117
950043235_950043252 19 Left 950043235 3:9933491-9933513 CCTTCAGCCAGCCCTGGATAGCT 0: 1
1: 0
2: 2
3: 20
4: 213
Right 950043252 3:9933533-9933555 TCCCGCGCCGGGACGCGGGGTGG 0: 1
1: 0
2: 3
3: 16
4: 144
950043235_950043243 7 Left 950043235 3:9933491-9933513 CCTTCAGCCAGCCCTGGATAGCT 0: 1
1: 0
2: 2
3: 20
4: 213
Right 950043243 3:9933521-9933543 TCCCCCGGGGACTCCCGCGCCGG 0: 1
1: 0
2: 1
3: 8
4: 118
950043235_950043254 20 Left 950043235 3:9933491-9933513 CCTTCAGCCAGCCCTGGATAGCT 0: 1
1: 0
2: 2
3: 20
4: 213
Right 950043254 3:9933534-9933556 CCCGCGCCGGGACGCGGGGTGGG 0: 1
1: 0
2: 2
3: 18
4: 204
950043235_950043251 16 Left 950043235 3:9933491-9933513 CCTTCAGCCAGCCCTGGATAGCT 0: 1
1: 0
2: 2
3: 20
4: 213
Right 950043251 3:9933530-9933552 GACTCCCGCGCCGGGACGCGGGG 0: 1
1: 0
2: 0
3: 7
4: 67
950043235_950043245 8 Left 950043235 3:9933491-9933513 CCTTCAGCCAGCCCTGGATAGCT 0: 1
1: 0
2: 2
3: 20
4: 213
Right 950043245 3:9933522-9933544 CCCCCGGGGACTCCCGCGCCGGG 0: 1
1: 0
2: 4
3: 15
4: 216
950043235_950043241 -6 Left 950043235 3:9933491-9933513 CCTTCAGCCAGCCCTGGATAGCT 0: 1
1: 0
2: 2
3: 20
4: 213
Right 950043241 3:9933508-9933530 ATAGCTACTTCCATCCCCCGGGG 0: 1
1: 0
2: 0
3: 5
4: 55
950043235_950043257 26 Left 950043235 3:9933491-9933513 CCTTCAGCCAGCCCTGGATAGCT 0: 1
1: 0
2: 2
3: 20
4: 213
Right 950043257 3:9933540-9933562 CCGGGACGCGGGGTGGGACCAGG 0: 1
1: 0
2: 1
3: 25
4: 262
950043235_950043239 -8 Left 950043235 3:9933491-9933513 CCTTCAGCCAGCCCTGGATAGCT 0: 1
1: 0
2: 2
3: 20
4: 213
Right 950043239 3:9933506-9933528 GGATAGCTACTTCCATCCCCCGG 0: 1
1: 0
2: 0
3: 4
4: 82
950043235_950043250 15 Left 950043235 3:9933491-9933513 CCTTCAGCCAGCCCTGGATAGCT 0: 1
1: 0
2: 2
3: 20
4: 213
Right 950043250 3:9933529-9933551 GGACTCCCGCGCCGGGACGCGGG 0: 1
1: 0
2: 1
3: 11
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950043235 Original CRISPR AGCTATCCAGGGCTGGCTGA AGG (reversed) Exonic