ID: 950043237

View in Genome Browser
Species Human (GRCh38)
Location 3:9933502-9933524
Sequence GGGATGGAAGTAGCTATCCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 151}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950043237_950043245 -3 Left 950043237 3:9933502-9933524 CCCTGGATAGCTACTTCCATCCC 0: 1
1: 0
2: 2
3: 9
4: 151
Right 950043245 3:9933522-9933544 CCCCCGGGGACTCCCGCGCCGGG 0: 1
1: 0
2: 4
3: 15
4: 216
950043237_950043260 27 Left 950043237 3:9933502-9933524 CCCTGGATAGCTACTTCCATCCC 0: 1
1: 0
2: 2
3: 9
4: 151
Right 950043260 3:9933552-9933574 GTGGGACCAGGCGCGGGACCTGG 0: 1
1: 0
2: 2
3: 14
4: 221
950043237_950043261 28 Left 950043237 3:9933502-9933524 CCCTGGATAGCTACTTCCATCCC 0: 1
1: 0
2: 2
3: 9
4: 151
Right 950043261 3:9933553-9933575 TGGGACCAGGCGCGGGACCTGGG 0: 1
1: 0
2: 0
3: 10
4: 142
950043237_950043243 -4 Left 950043237 3:9933502-9933524 CCCTGGATAGCTACTTCCATCCC 0: 1
1: 0
2: 2
3: 9
4: 151
Right 950043243 3:9933521-9933543 TCCCCCGGGGACTCCCGCGCCGG 0: 1
1: 0
2: 1
3: 8
4: 118
950043237_950043249 3 Left 950043237 3:9933502-9933524 CCCTGGATAGCTACTTCCATCCC 0: 1
1: 0
2: 2
3: 9
4: 151
Right 950043249 3:9933528-9933550 GGGACTCCCGCGCCGGGACGCGG 0: 1
1: 0
2: 0
3: 10
4: 117
950043237_950043251 5 Left 950043237 3:9933502-9933524 CCCTGGATAGCTACTTCCATCCC 0: 1
1: 0
2: 2
3: 9
4: 151
Right 950043251 3:9933530-9933552 GACTCCCGCGCCGGGACGCGGGG 0: 1
1: 0
2: 0
3: 7
4: 67
950043237_950043250 4 Left 950043237 3:9933502-9933524 CCCTGGATAGCTACTTCCATCCC 0: 1
1: 0
2: 2
3: 9
4: 151
Right 950043250 3:9933529-9933551 GGACTCCCGCGCCGGGACGCGGG 0: 1
1: 0
2: 1
3: 11
4: 77
950043237_950043252 8 Left 950043237 3:9933502-9933524 CCCTGGATAGCTACTTCCATCCC 0: 1
1: 0
2: 2
3: 9
4: 151
Right 950043252 3:9933533-9933555 TCCCGCGCCGGGACGCGGGGTGG 0: 1
1: 0
2: 3
3: 16
4: 144
950043237_950043262 29 Left 950043237 3:9933502-9933524 CCCTGGATAGCTACTTCCATCCC 0: 1
1: 0
2: 2
3: 9
4: 151
Right 950043262 3:9933554-9933576 GGGACCAGGCGCGGGACCTGGGG 0: 1
1: 0
2: 0
3: 17
4: 220
950043237_950043258 20 Left 950043237 3:9933502-9933524 CCCTGGATAGCTACTTCCATCCC 0: 1
1: 0
2: 2
3: 9
4: 151
Right 950043258 3:9933545-9933567 ACGCGGGGTGGGACCAGGCGCGG 0: 1
1: 0
2: 2
3: 16
4: 189
950043237_950043259 21 Left 950043237 3:9933502-9933524 CCCTGGATAGCTACTTCCATCCC 0: 1
1: 0
2: 2
3: 9
4: 151
Right 950043259 3:9933546-9933568 CGCGGGGTGGGACCAGGCGCGGG 0: 1
1: 0
2: 1
3: 19
4: 215
950043237_950043254 9 Left 950043237 3:9933502-9933524 CCCTGGATAGCTACTTCCATCCC 0: 1
1: 0
2: 2
3: 9
4: 151
Right 950043254 3:9933534-9933556 CCCGCGCCGGGACGCGGGGTGGG 0: 1
1: 0
2: 2
3: 18
4: 204
950043237_950043257 15 Left 950043237 3:9933502-9933524 CCCTGGATAGCTACTTCCATCCC 0: 1
1: 0
2: 2
3: 9
4: 151
Right 950043257 3:9933540-9933562 CCGGGACGCGGGGTGGGACCAGG 0: 1
1: 0
2: 1
3: 25
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950043237 Original CRISPR GGGATGGAAGTAGCTATCCA GGG (reversed) Exonic