ID: 950043243

View in Genome Browser
Species Human (GRCh38)
Location 3:9933521-9933543
Sequence TCCCCCGGGGACTCCCGCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 118}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950043237_950043243 -4 Left 950043237 3:9933502-9933524 CCCTGGATAGCTACTTCCATCCC 0: 1
1: 0
2: 2
3: 9
4: 151
Right 950043243 3:9933521-9933543 TCCCCCGGGGACTCCCGCGCCGG 0: 1
1: 0
2: 1
3: 8
4: 118
950043232_950043243 13 Left 950043232 3:9933485-9933507 CCGGGCCCTTCAGCCAGCCCTGG 0: 1
1: 0
2: 3
3: 82
4: 681
Right 950043243 3:9933521-9933543 TCCCCCGGGGACTCCCGCGCCGG 0: 1
1: 0
2: 1
3: 8
4: 118
950043231_950043243 14 Left 950043231 3:9933484-9933506 CCCGGGCCCTTCAGCCAGCCCTG 0: 1
1: 0
2: 7
3: 64
4: 509
Right 950043243 3:9933521-9933543 TCCCCCGGGGACTCCCGCGCCGG 0: 1
1: 0
2: 1
3: 8
4: 118
950043236_950043243 0 Left 950043236 3:9933498-9933520 CCAGCCCTGGATAGCTACTTCCA 0: 1
1: 0
2: 2
3: 8
4: 145
Right 950043243 3:9933521-9933543 TCCCCCGGGGACTCCCGCGCCGG 0: 1
1: 0
2: 1
3: 8
4: 118
950043238_950043243 -5 Left 950043238 3:9933503-9933525 CCTGGATAGCTACTTCCATCCCC 0: 1
1: 0
2: 0
3: 7
4: 130
Right 950043243 3:9933521-9933543 TCCCCCGGGGACTCCCGCGCCGG 0: 1
1: 0
2: 1
3: 8
4: 118
950043234_950043243 8 Left 950043234 3:9933490-9933512 CCCTTCAGCCAGCCCTGGATAGC 0: 1
1: 0
2: 2
3: 15
4: 154
Right 950043243 3:9933521-9933543 TCCCCCGGGGACTCCCGCGCCGG 0: 1
1: 0
2: 1
3: 8
4: 118
950043235_950043243 7 Left 950043235 3:9933491-9933513 CCTTCAGCCAGCCCTGGATAGCT 0: 1
1: 0
2: 2
3: 20
4: 213
Right 950043243 3:9933521-9933543 TCCCCCGGGGACTCCCGCGCCGG 0: 1
1: 0
2: 1
3: 8
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950043243 Original CRISPR TCCCCCGGGGACTCCCGCGC CGG Exonic