ID: 950043243

View in Genome Browser
Species Human (GRCh38)
Location 3:9933521-9933543
Sequence TCCCCCGGGGACTCCCGCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 118}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950043236_950043243 0 Left 950043236 3:9933498-9933520 CCAGCCCTGGATAGCTACTTCCA 0: 1
1: 0
2: 2
3: 8
4: 145
Right 950043243 3:9933521-9933543 TCCCCCGGGGACTCCCGCGCCGG 0: 1
1: 0
2: 1
3: 8
4: 118
950043235_950043243 7 Left 950043235 3:9933491-9933513 CCTTCAGCCAGCCCTGGATAGCT 0: 1
1: 0
2: 2
3: 20
4: 213
Right 950043243 3:9933521-9933543 TCCCCCGGGGACTCCCGCGCCGG 0: 1
1: 0
2: 1
3: 8
4: 118
950043237_950043243 -4 Left 950043237 3:9933502-9933524 CCCTGGATAGCTACTTCCATCCC 0: 1
1: 0
2: 2
3: 9
4: 151
Right 950043243 3:9933521-9933543 TCCCCCGGGGACTCCCGCGCCGG 0: 1
1: 0
2: 1
3: 8
4: 118
950043238_950043243 -5 Left 950043238 3:9933503-9933525 CCTGGATAGCTACTTCCATCCCC 0: 1
1: 0
2: 0
3: 7
4: 130
Right 950043243 3:9933521-9933543 TCCCCCGGGGACTCCCGCGCCGG 0: 1
1: 0
2: 1
3: 8
4: 118
950043234_950043243 8 Left 950043234 3:9933490-9933512 CCCTTCAGCCAGCCCTGGATAGC 0: 1
1: 0
2: 2
3: 15
4: 154
Right 950043243 3:9933521-9933543 TCCCCCGGGGACTCCCGCGCCGG 0: 1
1: 0
2: 1
3: 8
4: 118
950043231_950043243 14 Left 950043231 3:9933484-9933506 CCCGGGCCCTTCAGCCAGCCCTG 0: 1
1: 0
2: 7
3: 64
4: 509
Right 950043243 3:9933521-9933543 TCCCCCGGGGACTCCCGCGCCGG 0: 1
1: 0
2: 1
3: 8
4: 118
950043232_950043243 13 Left 950043232 3:9933485-9933507 CCGGGCCCTTCAGCCAGCCCTGG 0: 1
1: 0
2: 3
3: 82
4: 681
Right 950043243 3:9933521-9933543 TCCCCCGGGGACTCCCGCGCCGG 0: 1
1: 0
2: 1
3: 8
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950043243 Original CRISPR TCCCCCGGGGACTCCCGCGC CGG Exonic
900297566 1:1959630-1959652 TCCCCTGGGGTCACCCGAGCTGG - Intronic
900343722 1:2200886-2200908 TTCCCTGGGGACTCCCGAGGGGG - Intronic
901303770 1:8217699-8217721 GCTTCCGGGGACACCCGCGCAGG + Intergenic
904260906 1:29287112-29287134 TCCCCCTGGGACTCCCTCCTGGG - Intronic
906314236 1:44775950-44775972 GCTCCCGGAGACCCCCGCGCCGG - Intronic
908501031 1:64744645-64744667 TCCCCTCGAAACTCCCGCGCTGG - Intergenic
910145652 1:84077840-84077862 TCCCCCGCGGTCGCCCGGGCTGG - Intergenic
912381430 1:109249968-109249990 GCCCCCGGGGACTGGCGCCCTGG + Intergenic
915559221 1:156676751-156676773 GCCCCGCGGGCCTCCCGCGCCGG - Exonic
915593671 1:156884437-156884459 TCCCCAGGGGCCTCCAGCACTGG + Intergenic
918282769 1:183023014-183023036 GACCCCAGCGACTCCCGCGCGGG + Intergenic
918601982 1:186375160-186375182 CCCGCCGGAGACTCCCGCGGCGG + Exonic
1065102083 10:22340965-22340987 TCCCGCGGGGCCTCCCGGGGCGG - Intergenic
1069655257 10:70083138-70083160 GCCCCCGGGGTCTCCAGAGCTGG + Intronic
1070768626 10:79070072-79070094 TCCCCCGGGGCCACCGCCGCCGG - Intronic
1071579711 10:86757358-86757380 TCCCGCGGGGACTCGGGGGCGGG - Intronic
1084500849 11:69534316-69534338 TACCCCGGGGAGTGCCGCCCTGG + Intergenic
1087138195 11:94740790-94740812 TCCCGCGGGGCCTCCGGCTCAGG + Intronic
1091582559 12:1798106-1798128 GCCCCCGAGGAGTCCCGCACCGG - Intronic
1092471852 12:8787691-8787713 TCACCCGGTGAATCCCGCACCGG - Intergenic
1092473047 12:8795150-8795172 TCACCCGGTGAATCCCGCACCGG - Intergenic
1103410920 12:120710797-120710819 TCTGGCGGGGACCCCCGCGCTGG - Intronic
1103850186 12:123928068-123928090 TCCCCTGAGGACTCCTGAGCAGG - Exonic
1104568430 12:129904394-129904416 TCCCCGGGGTGCGCCCGCGCTGG - Intergenic
1118797168 14:69153503-69153525 TCCCGCGGGGACCCGCGGGCCGG + Intergenic
1122214263 14:100192960-100192982 TCTCCCTGCGGCTCCCGCGCGGG + Intergenic
1124157453 15:27238448-27238470 TCCTCCAGGGCCTCCCGCGGTGG - Intronic
1124248996 15:28095287-28095309 TCCCCCGGGCGCACCCGGGCGGG - Intronic
1132553923 16:564533-564555 GACCCCGAGGACCCCCGCGCTGG - Intronic
1132631312 16:918991-919013 TCCCACGGGGCCTCCTGGGCTGG + Intronic
1132724904 16:1334294-1334316 TCCCCCGGAGACCCCGGCCCAGG - Intronic
1133118249 16:3590496-3590518 ACCCGCGGGGACTCCCGCCCTGG + Exonic
1134062883 16:11209682-11209704 TGCCCAGGGAACTCCCGGGCTGG - Intergenic
1137036632 16:35574553-35574575 TTCCTCTGGGTCTCCCGCGCAGG + Intergenic
1141638623 16:85328816-85328838 CGCCCCGGGGCCTCCCGCGGTGG + Intergenic
1142367439 16:89657542-89657564 TCCTCCGGGGACTCGCGCGCGGG - Intronic
1145012639 17:19378554-19378576 ACCCTCGGAGACCCCCGCGCTGG + Intronic
1146052887 17:29567062-29567084 TGCCCAGGGCCCTCCCGCGCGGG + Exonic
1148676413 17:49448186-49448208 TCCCCAGGGGATTCCAGTGCAGG - Intronic
1148796517 17:50199784-50199806 GCCCTCGGGGACTTCGGCGCCGG + Exonic
1148807866 17:50273291-50273313 GCTCCCGGGGGCACCCGCGCTGG + Intronic
1152197415 17:78925593-78925615 GCGTCCGGGGACCCCCGCGCGGG - Intergenic
1152340380 17:79720989-79721011 TCCCCCCAGGCCTCCCTCGCTGG - Intergenic
1152349710 17:79777950-79777972 TCCGGCGGGGGGTCCCGCGCGGG - Intergenic
1152565608 17:81099003-81099025 TCCCACGGGGACACCCGGGTGGG + Intronic
1155053239 18:22165748-22165770 CCGCCCGGGGACCCCGGCGCTGG + Intergenic
1157534728 18:48449901-48449923 TCCCTCGGGGACACCTGCTCTGG + Intergenic
1158505771 18:58044726-58044748 CTCCCCGGGGAGTCCCGAGCAGG - Intronic
1160521529 18:79510907-79510929 TCCACCGGGGGCTCCTCCGCCGG + Intronic
1161454469 19:4363133-4363155 GGCCCCGGGGACTCCCTCCCTGG - Intronic
1161925266 19:7294537-7294559 GCGCCCAGGGCCTCCCGCGCGGG - Intergenic
1162076871 19:8193939-8193961 ACCCCAGGGGACTCCTGGGCTGG + Intronic
1163157991 19:15449566-15449588 TCCCGCGGGGTCTCCTGCCCCGG - Intronic
1164834862 19:31350154-31350176 TCCCCGGGGGACGCCAGCCCCGG - Intergenic
1166199289 19:41226184-41226206 GCCCCCGGTGACTCACGCGGGGG + Intronic
1166984105 19:46649449-46649471 TCCAACGAGGGCTCCCGCGCGGG + Exonic
1166995115 19:46716412-46716434 TCCCCCGGGGCCCCCCGGCCGGG - Exonic
1167129155 19:47573085-47573107 GCCCCCGGGGGCTCGCGCGCCGG + Intergenic
1167239410 19:48334256-48334278 GCCCCCGGGGTCACCCCCGCTGG + Intronic
1167267541 19:48491140-48491162 GGCCCCGGGGTCTCCAGCGCAGG + Exonic
925091081 2:1156503-1156525 TCCTCTGGGGACTCTAGCGCAGG - Intronic
929532258 2:42760666-42760688 TCCTCCAGGGACTCCTGAGCAGG - Intergenic
931587186 2:63841404-63841426 CTCCCTTGGGACTCCCGCGCCGG + Intronic
932572059 2:72943345-72943367 TCCCCCGGGGTCTCCACCTCAGG - Exonic
1175998324 20:62821192-62821214 ACCCCCGGGGCCGCCCGGGCTGG + Exonic
1176548567 21:8212155-8212177 TCCCGACGGGACTCCCCCGCGGG - Intergenic
1176556461 21:8256363-8256385 TCCCGACGGGACTCCCCCGCGGG - Intergenic
1176567498 21:8395190-8395212 TCCCGACGGGACTCCCCCGCGGG - Intergenic
1176575400 21:8439405-8439427 TCCCGACGGGACTCCCCCGCGGG - Intergenic
1182416822 22:30226649-30226671 TCCCCCAGGCACTCCCAGGCTGG - Intergenic
1183093632 22:35540116-35540138 GCACCCGGGGACTTCCGCGAAGG + Intergenic
1183420622 22:37709512-37709534 TCCCCGGGGGGCTCCGGCTCAGG - Intronic
1183743581 22:39681059-39681081 TCCCCTGGGGACTCCTGAGCAGG + Intronic
1183961326 22:41413559-41413581 TCCACCAGGGACTTCCGCCCTGG - Intergenic
1184568812 22:45309722-45309744 GCCCCCGGGGTCTCCAGCGCAGG - Intronic
1184662555 22:45972093-45972115 TCCCCCCGGGCCTCCAGCGCTGG - Intronic
1184766892 22:46576964-46576986 GCCCCCGCGGACCCCCGAGCCGG + Intronic
1185345080 22:50307457-50307479 TCCGCCCGGGCCTGCCGCGCTGG - Intronic
1203253451 22_KI270733v1_random:128460-128482 TCCCGACGGGACTCCCCCGCGGG - Intergenic
1203261505 22_KI270733v1_random:173538-173560 TCCCGACGGGACTCCCCCGCGGG - Intergenic
950043243 3:9933521-9933543 TCCCCCGGGGACTCCCGCGCCGG + Exonic
952694615 3:36250454-36250476 TCCCCCAGGGGCTCCCTCCCAGG - Intergenic
956468480 3:69541998-69542020 TGCCCCAGGGACTCCAGCGGAGG + Intronic
967930299 3:194686144-194686166 TCCCCGCGGGACTGCTGCGCGGG + Intergenic
968850538 4:3074790-3074812 GCCTCCGGGGACTGCCGTGCCGG + Exonic
972329332 4:38049816-38049838 ACCCCCGGGGACCCCCGGGCAGG - Exonic
979205581 4:118033666-118033688 TGCGCCGGGGACTCCTGCGCTGG - Intronic
984823692 4:183906146-183906168 TCTCCCGGGGACTGCAGCGGAGG + Exonic
985763042 5:1761455-1761477 TCCCCCTCAGACTCCCCCGCTGG + Intergenic
990545464 5:56816426-56816448 TGCCCCGGGGACACCCGTCCGGG - Intronic
990545591 5:56816975-56816997 TGGCCCGGGGACTGCGGCGCGGG + Intronic
991054598 5:62306852-62306874 CCCCCCGGGGACACCAGCCCGGG + Intronic
997303984 5:132825407-132825429 TCACCCAGGCATTCCCGCGCCGG + Exonic
997521051 5:134524992-134525014 GCCCCCCGGGGCTCCAGCGCTGG - Intronic
998385250 5:141753661-141753683 GGCCCCGGGGGCTCCCGGGCTGG + Intergenic
1002349924 5:178576756-178576778 TCCCCCGGCGACCGCCGCGCCGG + Intronic
1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG + Intergenic
1012525075 6:100167852-100167874 ACCCCTGGGGACTCCCCTGCAGG + Intergenic
1013318046 6:108960206-108960228 TCACCCGGGGTGTCCCCCGCCGG - Intronic
1013459004 6:110357957-110357979 TCCGGCGGGGGCGCCCGCGCGGG + Exonic
1014009710 6:116461899-116461921 TCCCCCGGGGCGTCGCGCACAGG - Exonic
1018756488 6:166853764-166853786 TCCCCTGGGGACTGCCCTGCAGG - Intronic
1019552550 7:1610397-1610419 TCCCCCGGGGGCTCACGAGTGGG - Intergenic
1028262899 7:88686461-88686483 TGCTCCGGGGCCTCCCGAGCTGG + Intergenic
1034979686 7:155467924-155467946 TCCCCTGGGGACGCCCGACCCGG + Intergenic
1035167468 7:157000117-157000139 GAACCCGGGGACCCCCGCGCTGG + Intronic
1038610248 8:29054310-29054332 GCCCCAGGGGACTCCCGCAGGGG + Intronic
1039454365 8:37697550-37697572 TCGCCCGGCGGCTCCCGCGGCGG + Exonic
1042159443 8:65877547-65877569 TCCCCCGTGGACTCCCACTGAGG - Intergenic
1047417085 8:124673511-124673533 TCCCCTGGGGACTTTCACGCAGG - Intronic
1054769399 9:69069766-69069788 TCCTCCGTGGACTCCCGCTATGG - Intronic
1054835635 9:69672455-69672477 TCCCCCGCGCCCTCCCTCGCAGG - Intergenic
1055509786 9:76984688-76984710 TCCCCCGGGGACTTCGTCACAGG + Intergenic
1057693538 9:97307884-97307906 TTCCCCGGGGAGTCCTGCCCTGG + Intronic
1057877803 9:98771187-98771209 TCCCTCAGGGACTCCCCAGCTGG - Intronic
1057922111 9:99105550-99105572 CTCCCCGGGGAGTCCCGAGCGGG - Intronic
1062332574 9:136051149-136051171 TCCCCCTGAGCCTCCCGGGCAGG + Intronic
1062341503 9:136095559-136095581 TCCCGCCGGGTGTCCCGCGCAGG - Intergenic
1062426138 9:136507122-136507144 TCCCACTGGGACCCCCGCTCTGG + Intronic
1062592740 9:137281379-137281401 CCCTCCGGGGACACCGGCGCTGG - Exonic
1203469851 Un_GL000220v1:111607-111629 TCCCGACGGGACTCCCCCGCGGG - Intergenic
1203477672 Un_GL000220v1:155579-155601 TCCCGACGGGACTCCCCCGCGGG - Intergenic
1185471451 X:386454-386476 ACCCCCGGGAACCCCCGGGCCGG - Exonic
1185778832 X:2828921-2828943 GCCCTCGGGGCCTCCAGCGCCGG + Exonic
1190320225 X:49175716-49175738 CTCCCCAGGGACTCTCGCGCAGG - Exonic
1192528785 X:71869380-71869402 TCCCTGGGGGACTCCTGGGCTGG - Intergenic
1192998717 X:76540351-76540373 TCCCACGGGGACTTCCAAGCAGG + Intergenic
1200259343 X:154603886-154603908 TCCTCCTGGGACTCCCTTGCAGG + Intergenic