ID: 950043256

View in Genome Browser
Species Human (GRCh38)
Location 3:9933540-9933562
Sequence CCTGGTCCCACCCCGCGTCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 213}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950043256_950043261 -10 Left 950043256 3:9933540-9933562 CCGGGACGCGGGGTGGGACCAGG 0: 1
1: 0
2: 1
3: 16
4: 213
Right 950043261 3:9933553-9933575 TGGGACCAGGCGCGGGACCTGGG 0: 1
1: 0
2: 0
3: 10
4: 142
950043256_950043269 2 Left 950043256 3:9933540-9933562 CCGGGACGCGGGGTGGGACCAGG 0: 1
1: 0
2: 1
3: 16
4: 213
Right 950043269 3:9933565-9933587 CGGGACCTGGGGCGGGGGACGGG 0: 1
1: 0
2: 8
3: 72
4: 699
950043256_950043265 -5 Left 950043256 3:9933540-9933562 CCGGGACGCGGGGTGGGACCAGG 0: 1
1: 0
2: 1
3: 16
4: 213
Right 950043265 3:9933558-9933580 CCAGGCGCGGGACCTGGGGCGGG 0: 1
1: 0
2: 2
3: 40
4: 526
950043256_950043266 -4 Left 950043256 3:9933540-9933562 CCGGGACGCGGGGTGGGACCAGG 0: 1
1: 0
2: 1
3: 16
4: 213
Right 950043266 3:9933559-9933581 CAGGCGCGGGACCTGGGGCGGGG 0: 1
1: 0
2: 4
3: 46
4: 513
950043256_950043262 -9 Left 950043256 3:9933540-9933562 CCGGGACGCGGGGTGGGACCAGG 0: 1
1: 0
2: 1
3: 16
4: 213
Right 950043262 3:9933554-9933576 GGGACCAGGCGCGGGACCTGGGG 0: 1
1: 0
2: 0
3: 17
4: 220
950043256_950043267 -3 Left 950043256 3:9933540-9933562 CCGGGACGCGGGGTGGGACCAGG 0: 1
1: 0
2: 1
3: 16
4: 213
Right 950043267 3:9933560-9933582 AGGCGCGGGACCTGGGGCGGGGG 0: 1
1: 0
2: 2
3: 45
4: 476
950043256_950043263 -6 Left 950043256 3:9933540-9933562 CCGGGACGCGGGGTGGGACCAGG 0: 1
1: 0
2: 1
3: 16
4: 213
Right 950043263 3:9933557-9933579 ACCAGGCGCGGGACCTGGGGCGG 0: 1
1: 0
2: 2
3: 25
4: 204
950043256_950043268 1 Left 950043256 3:9933540-9933562 CCGGGACGCGGGGTGGGACCAGG 0: 1
1: 0
2: 1
3: 16
4: 213
Right 950043268 3:9933564-9933586 GCGGGACCTGGGGCGGGGGACGG 0: 1
1: 0
2: 10
3: 130
4: 1202
950043256_950043271 15 Left 950043256 3:9933540-9933562 CCGGGACGCGGGGTGGGACCAGG 0: 1
1: 0
2: 1
3: 16
4: 213
Right 950043271 3:9933578-9933600 GGGGGACGGGACTTAAATAAAGG 0: 1
1: 0
2: 0
3: 3
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950043256 Original CRISPR CCTGGTCCCACCCCGCGTCC CGG (reversed) Exonic
900118818 1:1040066-1040088 CCTGGCCTCACACCCCGTCCCGG + Intronic
900148748 1:1169252-1169274 CCTGTGCCCACCCGGCCTCCTGG + Intergenic
900382665 1:2392354-2392376 CCTGTCCCCATCCTGCGTCCAGG + Intronic
906302958 1:44697010-44697032 TCTGGTACCACCCCGGGCCCAGG - Intronic
906529117 1:46513040-46513062 CCTGGTCCCTGCCCCCGTCTCGG + Exonic
908510137 1:64844710-64844732 TCTGGCCCCACCCCGAGTCAGGG - Intronic
919986761 1:202681095-202681117 CCTGGTCCCACCCTGGCTCCTGG + Intronic
922704943 1:227785738-227785760 CCAGGTCCCTCCCAGCGACCTGG + Intergenic
922730797 1:227947987-227948009 CCCGGCCCCGCCCCGCGCCCGGG + Intergenic
1068629540 10:59285144-59285166 CCGGGTCCCACCCCATCTCCAGG - Intronic
1068783309 10:60944234-60944256 CCTGCCCCCACCCCGCTCCCAGG + Exonic
1069599225 10:69692733-69692755 CCTGGAACCACCCCAGGTCCTGG - Intergenic
1069599412 10:69693830-69693852 CCTGGAACCACCCCAGGTCCCGG + Intergenic
1075093515 10:119456499-119456521 TCTGCTCCCACCTCCCGTCCAGG + Intronic
1076023472 10:127093069-127093091 CCTGGTCTCTTCCAGCGTCCAGG + Intronic
1076875928 10:133215478-133215500 CCTGTTCCCACGCCCCGTGCTGG - Intronic
1076889456 10:133276662-133276684 CCTGCTCGCACCCCGCACCCTGG - Intronic
1077896649 11:6458016-6458038 CCTCCTCCCACCCCAAGTCCCGG + Intronic
1078524591 11:12090749-12090771 CCTGTTCCCACCCCCCACCCTGG - Intergenic
1080752981 11:35167811-35167833 CCTGGGCCAACCCCAAGTCCTGG + Intronic
1080887216 11:36377535-36377557 CCTGGTCCCACCCCGGGCGGCGG - Intronic
1081636691 11:44726771-44726793 CCTCCTCCAACCCCGCGTCCAGG - Intronic
1081834674 11:46143843-46143865 GCTGGCCCCACCCCACTTCCAGG + Intergenic
1083298961 11:61730349-61730371 CCAGGGCCCACCCCGCCCCCAGG + Intronic
1083719627 11:64597978-64598000 CCTGGTCCCAGCCTGAGCCCCGG + Intronic
1083721015 11:64603560-64603582 CCTGGGCCCTCCCAGCTTCCAGG - Intergenic
1084402793 11:68955075-68955097 CCTGGTCCCACCTGGTGCCCCGG + Intergenic
1084544930 11:69810475-69810497 CCTGTTCCTGCCCCGCGTGCTGG - Exonic
1086893505 11:92285921-92285943 TCTGGCCACACCCCACGTCCTGG - Intergenic
1088630128 11:111766406-111766428 CCAGGCCCCGCCCCGCGCCCAGG + Intronic
1088672358 11:112154772-112154794 CCTTGTCACACCACGTGTCCTGG - Intronic
1088801902 11:113314492-113314514 CTTGGTCCCGCCCCGGGCCCTGG + Intergenic
1089294281 11:117458666-117458688 CCTGCTCTCACCCTGCCTCCTGG + Intronic
1089401766 11:118168502-118168524 CCTGGTCCCACCACCGGCCCCGG - Intronic
1089572723 11:119420923-119420945 CCTGTTCCCACCCCAGATCCAGG - Exonic
1090029517 11:123195148-123195170 CCTGGTCCCGGCTCCCGTCCGGG - Exonic
1091655227 12:2341198-2341220 CCTGGTTCCTCCCTGCATCCTGG + Intronic
1092137995 12:6163025-6163047 CCTGGTCCCAGGCCTGGTCCTGG - Intergenic
1092226716 12:6752849-6752871 CCTCTCCCCACCCCGCATCCCGG + Intronic
1096149066 12:49297404-49297426 CCTGGTAGCCCCCCGCCTCCAGG - Exonic
1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG + Intronic
1099365019 12:81758319-81758341 CCCGGCCCCACCCCGCCCCCAGG - Intronic
1100260503 12:92928822-92928844 CCTGGTGGCCCCGCGCGTCCAGG - Intronic
1103119821 12:118371929-118371951 CCTGCTCCCACCCGCTGTCCCGG + Intronic
1103459987 12:121096087-121096109 GCTGGGCCCGCCCCGCGTGCGGG - Intergenic
1104980433 12:132570976-132570998 CCTGGTCCCATCCCGGGACACGG - Intronic
1106553218 13:30789002-30789024 CCTGCTGCCACCCAGCGTCCTGG - Intergenic
1107133311 13:36919650-36919672 CCTGGTCCCTGCCCACGCCCCGG + Intronic
1111072219 13:83184039-83184061 CCTGCTCCCACCCCTGCTCCAGG - Intergenic
1111951775 13:94713500-94713522 CCTCCTCCCTCCCCGAGTCCTGG - Intergenic
1112773566 13:102819595-102819617 CCGGTTCCCACCCCGCGACAGGG - Intronic
1114673912 14:24428955-24428977 CCTGGGCCCACCCGGCCCCCAGG + Exonic
1118088305 14:62443579-62443601 CCTGGTTCCACCCCACATGCGGG - Intergenic
1119046328 14:71321144-71321166 CCCGGTGCCGCCGCGCGTCCCGG - Intronic
1119513441 14:75229642-75229664 CCTGGTGCCACCAGGCGACCTGG + Intergenic
1121109623 14:91303502-91303524 CCAGGCCCCACCCCTCCTCCAGG + Intronic
1122523547 14:102363415-102363437 CCCGGCCCCACCCTGCATCCCGG + Intronic
1122768165 14:104085546-104085568 CCGGGACCCACCCCGCCCCCAGG + Intergenic
1122975410 14:105168834-105168856 CCCGGCCCCACCCCGCGGCGCGG - Intergenic
1202848409 14_GL000225v1_random:943-965 ACTGGGCCCACGCAGCGTCCAGG - Intergenic
1124055542 15:26238073-26238095 CCTGCTCCCACCTCAGGTCCAGG - Intergenic
1124202012 15:27686803-27686825 CCTGGCCACACCCCGTGTACTGG - Intergenic
1124321020 15:28711733-28711755 CATGGTCCCTCCCCCCGACCAGG - Intronic
1124481478 15:30083622-30083644 CATGGTCCCTCCCCCCGACCAGG + Intronic
1124487933 15:30135718-30135740 CATGGTCCCTCCCCCCGACCAGG + Intronic
1124522117 15:30413572-30413594 CATGGTCCCTCCCCCCGACCAGG - Intronic
1124536548 15:30552646-30552668 CATGGTCCCTCCCCCCGACCAGG + Intronic
1124543022 15:30604695-30604717 CATGGTCCCTCCCCCCGACCAGG + Intronic
1124755596 15:32402603-32402625 CATGGTCCCTCCCCCCGACCAGG - Intronic
1124762105 15:32454946-32454968 CATGGTCCCTCCCCCCGACCAGG - Intronic
1124776525 15:32594122-32594144 CATGGTCCCTCCCCCCGACCAGG + Intronic
1125518962 15:40337833-40337855 CATAGTCCCAGCCCGCCTCCGGG + Exonic
1128061863 15:64740501-64740523 CCTGCACCCACCCCGCTTCAGGG - Exonic
1128582262 15:68818504-68818526 CCGCGCCCCACCCCGCCTCCAGG + Intronic
1128708035 15:69851625-69851647 CATGGTCCCACCCCACATCTTGG + Intergenic
1128994513 15:72286929-72286951 CCTGGACCCTCCCCGCATACAGG + Intronic
1129287942 15:74541082-74541104 CCTCGTCCCACCCCGCCCCCCGG + Intergenic
1129968234 15:79755809-79755831 CCTGGTGCCTCCCCCCGACCAGG - Intergenic
1130237226 15:82147012-82147034 CCTGGTCACATGCCGTGTCCAGG + Intronic
1131537835 15:93252378-93252400 CGGGCTCCCACCCCGCTTCCAGG + Intergenic
1132889071 16:2195542-2195564 CCTGGTCCCAGCACTCATCCTGG - Intronic
1137450856 16:48572343-48572365 CCTGTTCCCACCCTGCTCCCAGG - Intronic
1139546646 16:67652914-67652936 CCGGGCCCCTCCCCGCGCCCTGG + Intronic
1139643576 16:68311026-68311048 CGAGGTCCCGCCCCGCGTGCTGG + Intronic
1140067981 16:71626397-71626419 CCTGGTCTCTCTCCGGGTCCCGG - Exonic
1141117680 16:81324465-81324487 CCTGGTGCCACCCCTGATCCTGG - Intronic
1141409983 16:83826502-83826524 CCTTGCCCCACCCCGCTCCCAGG + Intergenic
1141435189 16:83995995-83996017 CCTGGTCCCACCCCGTCTCCAGG - Intronic
1141531168 16:84648263-84648285 CCTGGTGCCACCCACCGTCACGG - Intergenic
1142764009 17:2055908-2055930 CCTGCGCCCCACCCGCGTCCCGG - Intronic
1143205212 17:5136323-5136345 CCTGGCCCGACCCCACTTCCAGG + Intronic
1144727331 17:17508356-17508378 CCTACCCCCACCCCACGTCCAGG - Intronic
1144947941 17:18979306-18979328 CCTGGCCACACCCCACCTCCAGG + Intronic
1145798306 17:27668391-27668413 CCTGGTCTGACCCAGTGTCCTGG - Intergenic
1145999237 17:29121493-29121515 CCTGGTCCCACCCCCTGCCCTGG - Intronic
1146446909 17:32939525-32939547 CCTGGTCTCACCGTGCGTCCAGG - Exonic
1146843107 17:36168292-36168314 CCTTGTCTGACCCAGCGTCCTGG - Intronic
1146855412 17:36256233-36256255 CCTTGTCTGACCCAGCGTCCTGG - Intronic
1146865209 17:36332142-36332164 CCTTGTCTGACCCAGCGTCCTGG + Intronic
1146871318 17:36380144-36380166 CCTTGTCTGACCCAGCGTCCTGG - Intronic
1146878678 17:36431226-36431248 CCTTGTCTGACCCAGCGTCCTGG - Intronic
1146882626 17:36452372-36452394 CCTTGTCTGACCCAGCGTCCTGG - Intergenic
1146916310 17:36680484-36680506 CCTTCTCCCACCCCACATCCAGG + Intergenic
1147068069 17:37932736-37932758 CCTTGTCTGACCCAGCGTCCTGG + Intronic
1147074204 17:37980768-37980790 CCTTGTCTGACCCAGCGTCCTGG - Intronic
1147079599 17:38012291-38012313 CCTTGTCTGACCCAGCGTCCTGG + Intronic
1147085726 17:38060306-38060328 CCTTGTCTGACCCAGCGTCCTGG - Intronic
1147095540 17:38136233-38136255 CCTTGTCTGACCCAGCGTCCTGG + Intergenic
1147101673 17:38184272-38184294 CCTTGTCTGACCCAGCGTCCTGG - Intergenic
1147536393 17:41325379-41325401 CCTGGCCCGACCCCACTTCCAGG + Intergenic
1148733449 17:49851425-49851447 CCTGCGCCCACCCGGCGCCCTGG - Intergenic
1149846272 17:60010782-60010804 CCTTGTCTGACCCAGCGTCCTGG - Intergenic
1150084620 17:62267357-62267379 CCTTGTCTGACCCAGCGTCCTGG - Intergenic
1151314308 17:73312212-73312234 CCTGGGCCCGCCCGGCTTCCGGG + Intergenic
1152014537 17:77741804-77741826 CCTGGGCCCACCCCTCGCTCTGG + Intergenic
1152226815 17:79096615-79096637 CCTGATCCCACCCTCCCTCCCGG + Intronic
1152795085 17:82302708-82302730 CCTGGTGCCGCCCCGGGACCTGG + Intergenic
1153051764 18:907505-907527 TCTGCTCCCACCCCCAGTCCTGG + Intronic
1154176843 18:12091638-12091660 CCTGGCCCCAGCCCCCTTCCCGG - Intergenic
1160775405 19:853057-853079 CCGGCTCGGACCCCGCGTCCCGG + Intronic
1161102091 19:2426317-2426339 CTTCGTTCCACCCCGGGTCCTGG - Exonic
1162490062 19:10986539-10986561 CCTGGCCCCGGCCCGGGTCCCGG + Exonic
1163468974 19:17486122-17486144 CCTGGTGCCACCCAGTGACCTGG + Intronic
1165448568 19:35869663-35869685 CCTGGGCCGACCCCGGGGCCTGG - Exonic
1166117823 19:40666860-40666882 CCTCCTCCCTCCCCGCCTCCTGG + Exonic
1167262499 19:48467112-48467134 CGTGTTCCCACCCCGTGTTCTGG + Intronic
925060439 2:886044-886066 CCTGCTCGCACTCTGCGTCCTGG - Intergenic
925406261 2:3607026-3607048 CCAGATGCCACCCCGTGTCCGGG - Intronic
926250976 2:11155352-11155374 CCTGGACGCACCCCGCCCCCGGG - Exonic
927156311 2:20223672-20223694 CCAGGTCCCAGCCCCCGTCAAGG + Intronic
928259774 2:29756123-29756145 TCTGGGCCTACCCCGCCTCCAGG + Intronic
928552697 2:32388906-32388928 CCTGGCCCCACTCCGAGTTCTGG - Exonic
929403838 2:41617288-41617310 CCTGTTCCCACCCTGCTGCCTGG - Intergenic
932363610 2:71130769-71130791 CCCGGTCGCACCCCGAGCCCGGG - Intronic
932863883 2:75321533-75321555 CCTGATCCCACCCCAAGGCCTGG - Intergenic
934515648 2:94984900-94984922 CCTGGTCCCACCCAGGGCCCAGG - Intergenic
936525158 2:113236463-113236485 CCTGGGCCCACCTGGCGGCCCGG + Intronic
938159891 2:128975683-128975705 CCTGGGCCCATCCTGCCTCCTGG + Intergenic
938299313 2:130198861-130198883 CCTGTTCCCACCCAGCACCCGGG + Intergenic
945978224 2:216287111-216287133 CCAGGTCCCACCCCAATTCCTGG + Intronic
947912872 2:233813006-233813028 CCAGGTCCCACCCCAGATCCTGG + Intronic
1171372492 20:24670617-24670639 CCTGGGACCACCCCCCCTCCCGG - Intergenic
1175215703 20:57390850-57390872 CCTGGCCCCACGGAGCGTCCAGG - Intergenic
1175894308 20:62329311-62329333 CCTGGTCCCAGCCAGCCTCTGGG - Intronic
1175912812 20:62412819-62412841 CCTGGACCCACCTCGCTGCCTGG + Exonic
1176130585 20:63495161-63495183 CCTGGCCCCACCTCACTTCCAGG + Intronic
1176173659 20:63707799-63707821 CCGCGTCCCACCTCGAGTCCTGG + Intronic
1176196265 20:63837478-63837500 CCTGGTCCCACCTCCGGTGCTGG + Intergenic
1176547773 21:8208946-8208968 CCGGGCCCCACCCCCCGACCCGG - Intergenic
1176555669 21:8253151-8253173 CCGGGCCCCACCCCCCGACCCGG - Intergenic
1176566718 21:8391985-8392007 CCGGGCCCCACCCCCCGACCCGG - Intergenic
1176574599 21:8436180-8436202 CCGGGCCCCACCCCCCGACCCGG - Intergenic
1176611212 21:8987472-8987494 CCGGGCCCCACCCCCCGACCCGG - Intergenic
1178486530 21:33023147-33023169 CCTGGTTGGCCCCCGCGTCCTGG - Intergenic
1179252125 21:39679474-39679496 CCTGGTCCCACCCCTACTCAGGG + Intergenic
1179640609 21:42745220-42745242 CCTGCGCCCACCCCGAGGCCAGG - Intronic
1179810004 21:43864749-43864771 CCCGGCCCCACCCCGCGCCCCGG + Intergenic
1180001663 21:44998007-44998029 CCTGCTGCCAGCCCGCGGCCCGG - Intergenic
1180093217 21:45542891-45542913 CGTGGGCCCGACCCGCGTCCCGG - Intronic
1182051295 22:27314840-27314862 CATGGTCCCTCCCTGCCTCCTGG + Intergenic
1182351587 22:29702942-29702964 CCTGGTTCCACTCCGGCTCCCGG - Intergenic
1182426301 22:30274735-30274757 GCTGGTCCCAACCCGCCTCCTGG + Intergenic
1183194013 22:36340819-36340841 CCTGGTCACTCCCCTCGCCCTGG - Intronic
1183375403 22:37461973-37461995 CCTGGGCCCCTCCCGCCTCCAGG + Intergenic
1183487674 22:38098031-38098053 CCTGGCCCACCCCCGCTTCCCGG + Intronic
1183947475 22:41334830-41334852 CCTGGTCCATCCCCACTTCCAGG - Intronic
1184257825 22:43297073-43297095 CCTCGTCCCACCCAGCCACCAGG + Intronic
1203252647 22_KI270733v1_random:125231-125253 CCGGGCCCCACCCCCCGACCCGG - Intergenic
1203260703 22_KI270733v1_random:170317-170339 CCGGGCCCCACCCCCCGACCCGG - Intergenic
950043256 3:9933540-9933562 CCTGGTCCCACCCCGCGTCCCGG - Exonic
950475760 3:13214013-13214035 CCTGGTCCCTCCCCGCCACCCGG + Intergenic
955927600 3:64023216-64023238 CCTGGGCCGTCCCCGCGTTCCGG - Intronic
960848013 3:122022309-122022331 CCTGCTCCGCCCCCGCCTCCCGG + Intergenic
961745138 3:129059709-129059731 CCTGTTCTCTCCCCGCCTCCTGG - Intergenic
962343730 3:134605234-134605256 CCTGGTCCCTCCTGGCTTCCAGG + Intronic
968514293 4:1009861-1009883 CCTGGCCCCGCCCCCCGTCCCGG + Intergenic
968607126 4:1540812-1540834 CCCGGCCCCACCCCGGGCCCTGG + Intergenic
968648587 4:1751589-1751611 CCTGGGCCCACTCAGTGTCCCGG - Intergenic
977309932 4:95373415-95373437 CCTGCTCCCTCCACGCATCCAGG + Intronic
985651782 5:1111067-1111089 CCAGCCCCCACCCCGCGTGCTGG - Intronic
986184514 5:5423019-5423041 CCGAGTCCCCCCCCGCGCCCGGG - Intronic
992179716 5:74184183-74184205 CCCGGTCCCACCCCACAGCCAGG - Intergenic
994353047 5:98768932-98768954 GCTGTTCCCACTCCGCGCCCCGG - Intronic
996819141 5:127606415-127606437 CCTGGTCCCAACCCTTGTTCTGG - Intergenic
998161780 5:139817098-139817120 CCTGGTCCTTCCCCTGGTCCCGG + Intronic
998170269 5:139868637-139868659 CCTTTTCCCACCCCACCTCCCGG + Intronic
1002566439 5:180114795-180114817 CGTGGTGCCACCGCCCGTCCTGG + Intronic
1002575153 5:180170198-180170220 CTTGGTCCCCTCCCGCATCCCGG - Intronic
1003624581 6:7729323-7729345 CCCGCCCCCACCCCGCCTCCAGG + Intronic
1003973872 6:11324438-11324460 CATGGTGCCACCCCACGTGCAGG + Intronic
1006011580 6:31046731-31046753 CCTGGTCCCACCCAGGCTTCTGG + Intergenic
1006187140 6:32187955-32187977 CCTGGGCCCACCTGGCATCCAGG + Exonic
1007362492 6:41369083-41369105 CGTGGTCCCACACCGCCTCCTGG - Intergenic
1007633429 6:43285044-43285066 CCTGGGCCCAGGCCGCGGCCAGG - Exonic
1009398742 6:63230286-63230308 CCTGGTTCCACCGCAGGTCCTGG - Intergenic
1010302686 6:74280450-74280472 CCTGTTCCCAACCCACGTCTAGG + Intergenic
1013656691 6:112254070-112254092 CCTGCTCCCGCGCCGCGTCCGGG - Exonic
1018908983 6:168091157-168091179 CCTGGTTCCACCCAACTTCCTGG + Intergenic
1019352556 7:561829-561851 CCTGTTCCCACCCCAAGCCCTGG - Intronic
1019687166 7:2388359-2388381 CCTGCACCCACCCCCCGGCCCGG - Intergenic
1020023762 7:4884031-4884053 ACTGGTCCCACCCTTCCTCCGGG - Intergenic
1023658156 7:42447180-42447202 CCTGTTCCCACCACTCCTCCAGG + Intergenic
1035187826 7:157139512-157139534 CCGAGTCCAACCCCGAGTCCCGG - Intronic
1035404479 7:158588421-158588443 CCTGGCCCCAGCCCACGCCCTGG - Intergenic
1036707896 8:11059042-11059064 CCTGGTCCTGCCCCGCTTTCTGG - Intronic
1037337073 8:17801651-17801673 CCTGGCTGCACCGCGCGTCCCGG + Intergenic
1038373126 8:27012321-27012343 CCTGGTCCCACCGCAGGTCCTGG - Intergenic
1049346022 8:142139097-142139119 CCCGGTTCCACCCCTCCTCCTGG - Intergenic
1049497781 8:142944636-142944658 CCTGGTCACACACTGAGTCCTGG - Intergenic
1049651326 8:143771276-143771298 CCTGGGTCCTCTCCGCGTCCCGG + Intergenic
1049766219 8:144356470-144356492 CCGGGAGCCACCCCTCGTCCCGG + Exonic
1053796447 9:41731110-41731132 CCTGGTCCATGCCCGCCTCCCGG - Intergenic
1054148732 9:61583718-61583740 CCTGGTCCATGCCCGCCTCCCGG + Intergenic
1054184853 9:61943186-61943208 CCTGGTCCATGCCCGCCTCCCGG - Intergenic
1054468494 9:65514847-65514869 CCTGGTCCATGCCCGCCTCCCGG + Intergenic
1054653654 9:67645318-67645340 CCTGGTCCATGCCCGCCTCCCGG + Intergenic
1056020396 9:82433080-82433102 CCTGGTCCCACCGCAGGTCCTGG - Intergenic
1057071500 9:92104228-92104250 CCTGGTTCCACCGCAGGTCCTGG + Intronic
1057466258 9:95317272-95317294 CCTGGCCCCGCCCCGCGGGCTGG + Intronic
1058472869 9:105299002-105299024 CCTACTCCCACCCCTCTTCCTGG - Intronic
1059176611 9:112174830-112174852 CCAGCCCCCACCCCGCCTCCTGG + Intronic
1060115112 9:120934205-120934227 CCTGGTACCACCCCAAGTACAGG - Intergenic
1060996640 9:127877789-127877811 CTCGGTCCCGCCCCGCTTCCCGG - Intergenic
1061754746 9:132804559-132804581 CCTGCTCCCACCCCCCTCCCTGG - Intronic
1061781169 9:132996798-132996820 CCCCACCCCACCCCGCGTCCTGG + Intergenic
1062583167 9:137237149-137237171 CCTGGGCCCACCCCACGGACAGG - Intergenic
1203469050 Un_GL000220v1:108382-108404 CCGGGCCCCACCCCCCGACCCGG - Intergenic
1203476871 Un_GL000220v1:152354-152376 CCGGGCCCCACCCCCCGACCCGG - Intergenic
1198806697 X:140501550-140501572 CCTGGTCCTGCCGCGCGTCCAGG - Intergenic
1198806953 X:140502873-140502895 CCAGGTCCCACCCCGCCCCTAGG + Intergenic
1199942916 X:152641982-152642004 CCTGCTCCCTCCCCCGGTCCTGG - Intronic