ID: 950043859

View in Genome Browser
Species Human (GRCh38)
Location 3:9937543-9937565
Sequence CTCACTGATCGGACAGGGCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 115}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950043859_950043866 -1 Left 950043859 3:9937543-9937565 CCCTGCCCTGTCCGATCAGTGAG 0: 1
1: 0
2: 0
3: 9
4: 115
Right 950043866 3:9937565-9937587 GACCCGCCTGGTAGAGGTGCTGG 0: 1
1: 0
2: 1
3: 2
4: 107
950043859_950043865 -7 Left 950043859 3:9937543-9937565 CCCTGCCCTGTCCGATCAGTGAG 0: 1
1: 0
2: 0
3: 9
4: 115
Right 950043865 3:9937559-9937581 CAGTGAGACCCGCCTGGTAGAGG 0: 1
1: 0
2: 0
3: 6
4: 86
950043859_950043869 2 Left 950043859 3:9937543-9937565 CCCTGCCCTGTCCGATCAGTGAG 0: 1
1: 0
2: 0
3: 9
4: 115
Right 950043869 3:9937568-9937590 CCGCCTGGTAGAGGTGCTGGAGG 0: 1
1: 0
2: 1
3: 18
4: 194
950043859_950043870 3 Left 950043859 3:9937543-9937565 CCCTGCCCTGTCCGATCAGTGAG 0: 1
1: 0
2: 0
3: 9
4: 115
Right 950043870 3:9937569-9937591 CGCCTGGTAGAGGTGCTGGAGGG 0: 1
1: 0
2: 1
3: 15
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950043859 Original CRISPR CTCACTGATCGGACAGGGCA GGG (reversed) Exonic
900457740 1:2785673-2785695 CCCACGGGTTGGACAGGGCAAGG - Intronic
908062859 1:60370840-60370862 CTCACTTATCACAAAGGGCATGG - Intergenic
912454400 1:109788081-109788103 CTGACTGGCCGGACTGGGCATGG + Intergenic
912614975 1:111090173-111090195 ACCACTGATCTGACAGGGCGTGG - Intergenic
916260152 1:162833856-162833878 CTCACTGAATGGAGAAGGCAGGG + Intronic
917703085 1:177600905-177600927 CCCACTGGTCTGACATGGCATGG - Intergenic
919900681 1:202042220-202042242 CTCACTAATCCCACAAGGCAGGG - Intergenic
921055492 1:211539500-211539522 ATAACTGATGGGCCAGGGCAAGG - Intergenic
1066026221 10:31362507-31362529 CTCACTGCCCAGACGGGGCAGGG + Intronic
1071341770 10:84655633-84655655 CTCACTTCCCAGACAGGGCAGGG + Intergenic
1071707115 10:88011288-88011310 CTCACAGAGCAGAAAGGGCAAGG + Intergenic
1071921339 10:90354266-90354288 TACAGTGATCAGACAGGGCATGG + Intergenic
1073752488 10:106544535-106544557 CTCGCTAATTGTACAGGGCATGG + Intergenic
1077172943 11:1176470-1176492 CTGAGTGATGGGGCAGGGCACGG - Intronic
1084422464 11:69067162-69067184 CTCACTGCTTGCACAGTGCATGG + Intronic
1089740548 11:120579110-120579132 CTCAGTGCTGGGACAGGGCCTGG - Intronic
1090284364 11:125486486-125486508 ATCTCTGATCTGTCAGGGCATGG - Intronic
1104157235 12:126145149-126145171 CGCACAGATAGGACGGGGCAAGG - Intergenic
1105303523 13:19154423-19154445 CACACAGGTGGGACAGGGCAGGG + Intergenic
1105972710 13:25445420-25445442 TTCACTGATCCTCCAGGGCAGGG - Intronic
1106419844 13:29577151-29577173 CTCAATGGTCGGATGGGGCAGGG + Intronic
1107083132 13:36396261-36396283 CTCCCTCATGGGACAGGGCCTGG - Intergenic
1110105440 13:71669314-71669336 CTCACTGATCTGACAGGAGATGG - Intronic
1110247475 13:73342714-73342736 CTCACTGATCTGACAGGAGGCGG - Intergenic
1110626571 13:77661084-77661106 CTCACTGCCCAGACGGGGCAGGG + Intergenic
1112993566 13:105544596-105544618 CTCACTGATGGCACTGGGGAAGG - Intergenic
1113876766 13:113599614-113599636 GACACTGATCCAACAGGGCAGGG - Intronic
1114570047 14:23660579-23660601 CTCACTGCTCAGACAGAGGAAGG - Intergenic
1118959391 14:70515038-70515060 CTGACAGATGAGACAGGGCAAGG + Intergenic
1121985166 14:98498370-98498392 CTCACTGGAAGGAGAGGGCAGGG + Intergenic
1122348309 14:101073733-101073755 CTCACAGATCCCACAGGGGAGGG + Intergenic
1126038000 15:44565467-44565489 GTCACTGATCTGACAGGAGATGG + Intronic
1127690894 15:61396290-61396312 CTCCTTGATGGGGCAGGGCAGGG + Intergenic
1127790322 15:62392581-62392603 CTTTGTGATGGGACAGGGCACGG + Intronic
1128945064 15:71814196-71814218 CTCACTGATTAGACAGCACAAGG + Intronic
1129595245 15:76958761-76958783 ATCACTGATCTGACAGGACGCGG + Intergenic
1130379322 15:83358223-83358245 CTCCCTGATGGGGCTGGGCATGG - Intergenic
1130789827 15:87142199-87142221 ATCACTGATTGGTTAGGGCATGG + Intergenic
1130954922 15:88621080-88621102 AACACTGATGGGACCGGGCAGGG + Intergenic
1131631460 15:94181300-94181322 TTCACTGATGCCACAGGGCAGGG - Intergenic
1135422974 16:22316976-22316998 CTCACTGCAGGGACATGGCAGGG - Exonic
1139480815 16:67229715-67229737 CTCACTGCAGGGACAGAGCAGGG + Exonic
1139548902 16:67662675-67662697 CACACTGCTGGGACATGGCAGGG + Exonic
1141440616 16:84027459-84027481 CTCACTGACTGGACAGGCCTGGG + Intronic
1141767509 16:86068166-86068188 CTCACGGAGGGGATAGGGCAGGG + Intergenic
1147658550 17:42104897-42104919 CACTCTGATCGGCCCGGGCACGG + Exonic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1150613428 17:66751336-66751358 CTCACAGATGGCACATGGCAGGG + Intronic
1151889752 17:76945069-76945091 ATCACTGACCTGAAAGGGCAGGG - Intronic
1151976549 17:77486947-77486969 CTCCCTGACCGGCCAGGGCCTGG - Intronic
1152831291 17:82498362-82498384 CTCACTGATGGGGCCGGGCGCGG + Intergenic
1163126986 19:15249660-15249682 CTGGCTGGTGGGACAGGGCAGGG - Intronic
1163393804 19:17046886-17046908 TACACTGATGGGACTGGGCATGG + Intergenic
1166040453 19:40199143-40199165 CTGACAGATGGGACAGTGCATGG - Intronic
928539444 2:32270510-32270532 GTCACTGATCTGACAGGAGATGG - Intergenic
930114384 2:47706419-47706441 ATCACTGATTGCACAGAGCATGG - Intronic
932063074 2:68527682-68527704 CTCACTGCCCAGACAGGGCAGGG + Intronic
932063133 2:68527922-68527944 CTCACTGCCCAGACGGGGCAGGG + Intronic
935014101 2:99163616-99163638 ATCAATGAACAGACAGGGCATGG - Intronic
935443986 2:103137275-103137297 GTCTCTGATGGGACAGGGGAAGG + Intergenic
937544487 2:123000277-123000299 CTCACTGAATGAAAAGGGCATGG - Intergenic
942066852 2:172279633-172279655 CTCTCTGATTGGTCTGGGCACGG + Intergenic
943326852 2:186510012-186510034 CTCAATGATCTGGCCGGGCATGG + Intergenic
946168131 2:217877799-217877821 CTCACTGCCAGGAGAGGGCAAGG + Intronic
1168940368 20:1706557-1706579 CTCACAGATCCTAAAGGGCAGGG - Intergenic
1169379535 20:5094826-5094848 CTTACTGATGGCACTGGGCATGG - Intronic
1171210813 20:23315579-23315601 CTGGCTGATGGGAAAGGGCACGG - Intergenic
1179924872 21:44528884-44528906 CTCAGCGATTGCACAGGGCATGG + Intronic
1184073745 22:42163089-42163111 CTCAAGGAGGGGACAGGGCAGGG + Intronic
950043859 3:9937543-9937565 CTCACTGATCGGACAGGGCAGGG - Exonic
951079186 3:18431069-18431091 ATCACTTATTTGACAGGGCACGG + Intronic
952415934 3:33091820-33091842 CTCACTGAGAAGACAGGGCTGGG - Exonic
954795342 3:53158654-53158676 CACACTGGTGGGCCAGGGCAGGG - Intronic
969302165 4:6303559-6303581 CTTACTGAGCGGAAAGTGCACGG + Intergenic
970237459 4:13973088-13973110 CTCGCTGATCAGACAGGCCTGGG + Intergenic
973144877 4:46812923-46812945 CTCACCTATTGCACAGGGCAGGG + Intronic
976168035 4:82275942-82275964 CTCAATGATAGGAGAGGGCTGGG - Intergenic
982617076 4:157652344-157652366 CTCACTTATCACAAAGGGCATGG + Intergenic
991456100 5:66806244-66806266 CTCCCTGCTCTGACAGGGTAAGG - Intronic
1000022388 5:157329414-157329436 ATCACTGATCTTACAGGGAAGGG - Intronic
1001334529 5:170786218-170786240 CTCAATGCTTGGACAGGGAAAGG + Intronic
1002470884 5:179435438-179435460 CTCAGGGATGGGGCAGGGCAAGG + Intergenic
1005243407 6:23855730-23855752 CTCACTGCCCAGACGGGGCAGGG - Intergenic
1005528178 6:26673240-26673262 CTCATTGATGGCGCAGGGCAAGG - Intergenic
1005528929 6:26682364-26682386 CTCACTGATGGCCCAGGGCAAGG - Intergenic
1005530943 6:26705255-26705277 CTCACTGATGGCCCAGGGCAAGG - Intergenic
1005539853 6:26796381-26796403 CTCACTGATGGCCCAGGGCAAGG + Intergenic
1005541867 6:26819282-26819304 CTCACTGATGGCCCAGGGCAAGG + Intergenic
1005542617 6:26828399-26828421 CTCATTGATGGCGCAGGGCAAGG + Intergenic
1007253018 6:40509283-40509305 ATCACTCATGGGACAGAGCATGG + Intronic
1009010670 6:57838522-57838544 CTCACTGATGGCCCAGGGCAAGG + Intergenic
1009012672 6:57861339-57861361 CTCACTGATGGCCCAGGGCAAGG + Intergenic
1009013432 6:57870516-57870538 CTCATTGATGGCGCAGGGCAAGG + Intergenic
1012908184 6:105091416-105091438 CCCACAGGACGGACAGGGCAGGG - Intergenic
1013600560 6:111700265-111700287 CTCTCTGATGGAGCAGGGCAGGG + Exonic
1014740873 6:125146588-125146610 CTCACTTATCAGAAAGGGGATGG - Intronic
1018813953 6:167317231-167317253 CTCCCTGATCAGCCAGGCCAGGG - Intergenic
1020270754 7:6593939-6593961 CTCACTGACCAGGCTGGGCACGG - Intronic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1033474355 7:141676536-141676558 CTGACTGATGGGACAGAACAAGG + Intronic
1034741431 7:153477519-153477541 CTTGTTGATGGGACAGGGCAGGG + Intergenic
1035369088 7:158367414-158367436 CTCACTGGTGGGAAAGGGAAAGG + Intronic
1040005412 8:42616747-42616769 CTCACTGTTGAGACTGGGCAGGG + Intergenic
1041152669 8:54953049-54953071 CTCTCAGCTCGGACTGGGCATGG - Intergenic
1045494999 8:102700676-102700698 CTCACTGAAGGGACTGGGCCAGG + Intergenic
1046382035 8:113463901-113463923 GTCATTGATTGGTCAGGGCAAGG + Intergenic
1048211795 8:132460248-132460270 CTCAATGAGCTGACAGCGCAAGG + Intronic
1048235906 8:132690438-132690460 CTCACTGTTCGGCAAGGGTAGGG - Intronic
1048423796 8:134303988-134304010 CTCACTGATAGGCCAGGACAGGG + Intergenic
1048819551 8:138368256-138368278 CTGACAGATAGGAAAGGGCAGGG - Intronic
1048852557 8:138658770-138658792 CTCACTAATCAGATAAGGCATGG - Intronic
1049021875 8:139962739-139962761 CTCCCTGAGCTGACAGGGGAGGG - Intronic
1052413542 9:28149546-28149568 CTCACTGCCCAGACGGGGCAGGG - Intronic
1056019936 9:82430953-82430975 CTCACTTCTCAGACAGTGCAGGG + Intergenic
1056102297 9:83311579-83311601 CACACGGATGGGTCAGGGCAGGG - Intronic
1060540953 9:124429686-124429708 CTCATTGATCAGCCAGGGCCTGG - Intergenic
1061383199 9:130271785-130271807 CTCCCTTAGCTGACAGGGCAAGG + Intergenic
1061569726 9:131469736-131469758 GTCACTGATGGGATAGAGCAGGG + Intronic
1061857163 9:133448715-133448737 CTCACTCACCGAGCAGGGCACGG - Exonic
1190134185 X:47779978-47780000 CCCACTGATCTGACAGGACGGGG + Intergenic
1191082518 X:56528830-56528852 CTCCCTGACAGCACAGGGCAAGG - Intergenic
1196789534 X:119451578-119451600 CTCACAGATGTGACAGGGTAGGG - Intronic
1200079204 X:153567196-153567218 CACAATGCTCGGACAGGCCAGGG + Intronic
1200218988 X:154381352-154381374 CTCCCTGGTGGGACAAGGCAGGG - Exonic
1200796560 Y:7346228-7346250 TGGGCTGATCGGACAGGGCATGG - Intergenic