ID: 950045013

View in Genome Browser
Species Human (GRCh38)
Location 3:9943834-9943856
Sequence CAGGGTAATCACAACGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 65}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950045009_950045013 2 Left 950045009 3:9943809-9943831 CCTAGGCCGGGGGTGTGGTGAGA 0: 1
1: 0
2: 0
3: 23
4: 276
Right 950045013 3:9943834-9943856 CAGGGTAATCACAACGATGATGG 0: 1
1: 0
2: 0
3: 4
4: 65
950045001_950045013 22 Left 950045001 3:9943789-9943811 CCTGGCCTGCTGAGAGCTGTCCT 0: 1
1: 7
2: 1
3: 43
4: 365
Right 950045013 3:9943834-9943856 CAGGGTAATCACAACGATGATGG 0: 1
1: 0
2: 0
3: 4
4: 65
950045003_950045013 17 Left 950045003 3:9943794-9943816 CCTGCTGAGAGCTGTCCTAGGCC 0: 1
1: 0
2: 2
3: 35
4: 185
Right 950045013 3:9943834-9943856 CAGGGTAATCACAACGATGATGG 0: 1
1: 0
2: 0
3: 4
4: 65
950045000_950045013 23 Left 950045000 3:9943788-9943810 CCCTGGCCTGCTGAGAGCTGTCC 0: 1
1: 0
2: 9
3: 27
4: 341
Right 950045013 3:9943834-9943856 CAGGGTAATCACAACGATGATGG 0: 1
1: 0
2: 0
3: 4
4: 65
950045010_950045013 -4 Left 950045010 3:9943815-9943837 CCGGGGGTGTGGTGAGATGCAGG 0: 1
1: 0
2: 8
3: 34
4: 289
Right 950045013 3:9943834-9943856 CAGGGTAATCACAACGATGATGG 0: 1
1: 0
2: 0
3: 4
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950045013 Original CRISPR CAGGGTAATCACAACGATGA TGG Intronic
904944068 1:34186394-34186416 CATGATAATGACAATGATGATGG - Intronic
906208764 1:44000755-44000777 CAGGGAACTCACGAAGATGATGG + Exonic
911727845 1:101260987-101261009 CAAGGAAATCACAAGGAAGAAGG - Intergenic
917846249 1:179022979-179023001 CAATGTGATCACAACCATGAGGG + Intergenic
919262138 1:195209393-195209415 CAGGGAACTCACAATCATGATGG - Intergenic
919519315 1:198567821-198567843 CAGGAAACTCACAACCATGATGG + Intergenic
921214397 1:212924820-212924842 GAGGGAAGTCACAAGGATGAAGG - Intergenic
923824215 1:237481599-237481621 AAGAGTAAGCACAACCATGAGGG - Intronic
1078457315 11:11485351-11485373 CAGATTAATCACACCGAGGAGGG - Intronic
1083273485 11:61583961-61583983 CAGGGTAAACACAGCAATGATGG - Intergenic
1087997500 11:104828310-104828332 CAGTGGAATCACAACACTGAGGG - Intergenic
1091653592 12:2327715-2327737 CAGCGTAATTACAAGGAAGATGG + Intronic
1107122961 13:36815213-36815235 CAGGGTAATACCAAAGTTGAAGG + Intergenic
1111944002 13:94644505-94644527 CATTGTAATCACAGCTATGAAGG + Intergenic
1111944063 13:94645212-94645234 CATTGTAATCACAGCTATGAAGG - Intergenic
1113386869 13:109857071-109857093 CAGGGTAAGCAGGAAGATGATGG + Intergenic
1115831222 14:37344280-37344302 CAGGGGAATAAAAAAGATGAAGG - Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117261281 14:54036225-54036247 CAGGGCAATCACTATGTTGATGG - Intergenic
1118538336 14:66793327-66793349 CAGGGAAAGCACAAAGAAGATGG + Intronic
1118864761 14:69694321-69694343 AAGGTTAATCACAACTATGCAGG - Intronic
1131199694 15:90386540-90386562 CAGTGTAATCACAACAGGGATGG + Intergenic
1131388351 15:92026704-92026726 CAGTGTAATGAAAACCATGACGG - Intronic
1134477786 16:14590833-14590855 GAGGGTAATCAAAATGCTGACGG + Intronic
1141270337 16:82534035-82534057 CTGGGTAATCAGAATGAGGAAGG - Intergenic
1144285327 17:13769085-13769107 CAGGAAAATCACAATCATGATGG + Intergenic
1146643634 17:34561546-34561568 CATGGTGATGACAATGATGATGG + Intergenic
1153632586 18:7086187-7086209 CAGGGTTCTCACAACCAAGAAGG + Intronic
1154332891 18:13444072-13444094 CAGGGTAATCAAATCGTTGATGG - Intronic
1158080882 18:53589331-53589353 AAGGGTAATGTCAATGATGACGG - Intergenic
1167430911 19:49453872-49453894 CTGGGTAATCAAAGGGATGAAGG - Intronic
940133276 2:150408035-150408057 CAGGGTCTTCATAAAGATGAAGG + Intergenic
940729676 2:157374808-157374830 CAGGGAAATTACAATCATGATGG + Intergenic
944897865 2:204183920-204183942 CAGGGTAAACGCAATGATGAGGG + Intergenic
947238889 2:227972982-227973004 CAGGGTAGTTCCAGCGATGATGG + Intergenic
1173596230 20:44260031-44260053 CAGGGTAATCTCCAAGATGTGGG - Intronic
1185079035 22:48699272-48699294 CATTGTAATCAGAACAATGAAGG - Intronic
1185157131 22:49199965-49199987 CATGATAATCACATAGATGAGGG - Intergenic
950045013 3:9943834-9943856 CAGGGTAATCACAACGATGATGG + Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
956762386 3:72455515-72455537 CATGGTAATCACAAGGCCGATGG - Intergenic
957120439 3:76083852-76083874 TATGGCAATCTCAACGATGATGG + Intronic
957683109 3:83464525-83464547 CATTGTAATCACAAAGATGCTGG + Intergenic
961608518 3:128116761-128116783 TAGAGAAATCACAAAGATGAGGG - Intronic
962251869 3:133840628-133840650 CAGGGTAACCACAGCCCTGAGGG + Intronic
964855055 3:161137856-161137878 CAGGGTAACCATAACACTGAGGG + Intronic
970498961 4:16657330-16657352 CAGGGTAATAATGATGATGATGG - Intronic
971172254 4:24245478-24245500 CAGCTTAATCAAAAAGATGATGG - Intergenic
971551234 4:27958766-27958788 CAGGGTAATCAGAGCAATGCTGG - Intergenic
972647927 4:40987720-40987742 CAGGGCACTCACAAACATGATGG - Intronic
972849802 4:43035267-43035289 CATGTTAATCACCAGGATGATGG + Intergenic
980741834 4:136960603-136960625 CATGGTAAACAGAACGGTGAGGG - Intergenic
987541383 5:19260839-19260861 AATGGTAATCACAAAGACGATGG + Intergenic
996096629 5:119406214-119406236 CCGGGCAATGACAACGATGGTGG - Intergenic
1001736393 5:174007181-174007203 AAGAGTTATCACAACGAGGAAGG + Intergenic
1013934984 6:115583257-115583279 TAAGGTAATGACAACGAAGAGGG - Intergenic
1014202648 6:118622801-118622823 CGGGGTCATCAAAAAGATGAAGG + Intronic
1015037571 6:128675587-128675609 CAGGTTAATCAAAACAATCAAGG + Intergenic
1024662426 7:51511114-51511136 CAGGATATTCACAACTATGATGG - Intergenic
1027909878 7:84236867-84236889 GAGGGTATTCACAATCATGAAGG - Intronic
1030321989 7:108178977-108178999 CAGGGAAATGACAAAGAAGATGG - Intronic
1034944815 7:155255043-155255065 CAAGGTTATCACAAATATGAAGG - Intergenic
1037855055 8:22366051-22366073 TAGGGTTATTACAAAGATGAAGG + Intergenic
1038621652 8:29149219-29149241 CAGCTTAATCCAAACGATGAGGG + Intronic
1043657765 8:82692352-82692374 CAGGGTCATTACAACCCTGAAGG + Intergenic
1052007827 9:23371473-23371495 CAGGCTAATAACACTGATGACGG + Intergenic
1054737526 9:68770423-68770445 CAGGGTAAAAATAAGGATGAAGG + Intronic
1060266947 9:122117338-122117360 CAGGAAACTTACAACGATGATGG + Intergenic
1061436864 9:130569183-130569205 CCAGGCAATCACAAGGATGAGGG + Intergenic
1196818402 X:119683557-119683579 CAGGGTCATCCCAATGATGGGGG + Intronic