ID: 950047139

View in Genome Browser
Species Human (GRCh38)
Location 3:9955467-9955489
Sequence CAGAGTCTGCAGAAGGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950047139_950047148 0 Left 950047139 3:9955467-9955489 CCAGCATCCTTCTGCAGACTCTG No data
Right 950047148 3:9955490-9955512 GGACGGCGGGGATAAATGGAAGG No data
950047139_950047147 -4 Left 950047139 3:9955467-9955489 CCAGCATCCTTCTGCAGACTCTG No data
Right 950047147 3:9955486-9955508 TCTGGGACGGCGGGGATAAATGG No data
950047139_950047151 24 Left 950047139 3:9955467-9955489 CCAGCATCCTTCTGCAGACTCTG No data
Right 950047151 3:9955514-9955536 GACTCCAAGTATACAAGGGATGG No data
950047139_950047150 20 Left 950047139 3:9955467-9955489 CCAGCATCCTTCTGCAGACTCTG No data
Right 950047150 3:9955510-9955532 AGGTGACTCCAAGTATACAAGGG No data
950047139_950047149 19 Left 950047139 3:9955467-9955489 CCAGCATCCTTCTGCAGACTCTG No data
Right 950047149 3:9955509-9955531 AAGGTGACTCCAAGTATACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950047139 Original CRISPR CAGAGTCTGCAGAAGGATGC TGG (reversed) Intergenic
No off target data available for this crispr