ID: 950050706

View in Genome Browser
Species Human (GRCh38)
Location 3:9986872-9986894
Sequence GCACCTCAGTGGCGTCAGAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 93}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950050702_950050706 13 Left 950050702 3:9986836-9986858 CCACTTCCGGCGCGAACGTTGAC 0: 1
1: 0
2: 0
3: 1
4: 3
Right 950050706 3:9986872-9986894 GCACCTCAGTGGCGTCAGAGCGG 0: 1
1: 0
2: 1
3: 12
4: 93
950050701_950050706 22 Left 950050701 3:9986827-9986849 CCTGGTCTTCCACTTCCGGCGCG 0: 1
1: 1
2: 1
3: 2
4: 38
Right 950050706 3:9986872-9986894 GCACCTCAGTGGCGTCAGAGCGG 0: 1
1: 0
2: 1
3: 12
4: 93
950050703_950050706 7 Left 950050703 3:9986842-9986864 CCGGCGCGAACGTTGACGTCACG 0: 1
1: 0
2: 0
3: 1
4: 7
Right 950050706 3:9986872-9986894 GCACCTCAGTGGCGTCAGAGCGG 0: 1
1: 0
2: 1
3: 12
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950050706 Original CRISPR GCACCTCAGTGGCGTCAGAG CGG Exonic
901066501 1:6497087-6497109 GCACCGCGGTGGGGGCAGAGCGG + Exonic
902595937 1:17509537-17509559 GGAACTCACTGGCTTCAGAGGGG + Intergenic
903339959 1:22647591-22647613 GTACCGCAGCGGCGTCAAAGTGG + Exonic
903652515 1:24930379-24930401 GCACCTCGGTGGCGTTCGCGGGG + Intronic
904472593 1:30745382-30745404 GTGCCTCAGTGGAGGCAGAGAGG + Intronic
905867990 1:41386686-41386708 GGAGCTGAGTGGCGTGAGAGGGG - Intergenic
910165631 1:84324815-84324837 GCTCCTCATTGGATTCAGAGAGG - Intronic
916174515 1:162026439-162026461 GCAACTCAGTGATGTCAGCGAGG + Intergenic
917904925 1:179579257-179579279 TTACCTGAGTGGAGTCAGAGGGG + Intergenic
919843314 1:201624876-201624898 GGACCTCTGAGGCATCAGAGCGG + Intronic
922224007 1:223629517-223629539 GCCACTCAGTGGCATCAGTGTGG - Intronic
923555970 1:235000541-235000563 GCCCCTCAGCCACGTCAGAGTGG + Intergenic
1062816989 10:508118-508140 GCTCCTCTGTGGCGTGAGGGAGG - Intronic
1073606610 10:104901908-104901930 GGACCTCAGTGGCCTCTCAGTGG + Intronic
1076571911 10:131438691-131438713 CCACCACAGTGTCCTCAGAGCGG + Intergenic
1077086857 11:757174-757196 GCACCCCTGTGGCATCAGTGAGG + Intronic
1077096538 11:801465-801487 GCTCCTCAGTGGCCCCAGGGGGG + Exonic
1077200647 11:1305837-1305859 CCACCGCGGTGCCGTCAGAGAGG - Intronic
1078896900 11:15604863-15604885 TCACCTCAGTGGCACCAGGGAGG - Intergenic
1083992865 11:66257712-66257734 CTACCTCGGTGGCGTCGGAGGGG - Intronic
1084042027 11:66547815-66547837 GCACCTCGGGGGCGCCAAAGAGG + Intronic
1085523499 11:77151520-77151542 ACATCTCTGTGGCCTCAGAGAGG + Intronic
1089092087 11:115886404-115886426 GCACTTCAGTGGCATGAGAGAGG + Intergenic
1091839245 12:3607695-3607717 GCAACTCATTGGCATCAGTGAGG + Intronic
1104061761 12:125274487-125274509 ACACCTCTGTGTCGCCAGAGCGG - Intronic
1113880502 13:113622955-113622977 TCACCTGGGTGGCGTCAGCGCGG + Intronic
1119852199 14:77874213-77874235 GCTCCTCAGAGGCATCAGGGTGG - Intronic
1122277850 14:100604360-100604382 GCACCTCGGTGGCTTCATTGGGG - Intergenic
1122728534 14:103777510-103777532 GCATCTCTGTGGCGGCAGATGGG - Intronic
1124553577 15:30706106-30706128 GCAGCCCAGTGGAGTCACAGTGG + Intronic
1124677668 15:31699562-31699584 GCAGCCCAGTGGAGTCACAGTGG - Intronic
1125884593 15:43219144-43219166 TCACCTCAGTAGCTTCAGACTGG - Intronic
1128318010 15:66673342-66673364 GTGCCTCAGAGGCCTCAGAGAGG - Intronic
1128941397 15:71790625-71790647 CCACCTCAGTGACCTCAGAGGGG + Intergenic
1131247597 15:90808962-90808984 GCACCTCAGAGGCAGCAGACAGG - Intronic
1131263644 15:90903051-90903073 GCGCCACTGCGGCGTCAGAGGGG + Exonic
1131793109 15:95986489-95986511 GCTTCTCAGTGGTGGCAGAGAGG - Intergenic
1132345434 15:101105455-101105477 GCACCTGATGGGCCTCAGAGGGG + Intergenic
1132497839 16:272246-272268 GCACCTCGCTGGGGCCAGAGCGG + Intronic
1134195191 16:12154376-12154398 CCACCTCAGGGGTGTCAGAGGGG - Intronic
1134228183 16:12408332-12408354 GCACCACAGTGGACCCAGAGAGG - Intronic
1137706638 16:50539987-50540009 GGACCTCAGCGGAGGCAGAGAGG + Intergenic
1141489171 16:84360351-84360373 TCACCTGAGTGGCGTCACACAGG + Intergenic
1141760148 16:86022836-86022858 GGAGCTCAGTGGCTCCAGAGGGG + Intergenic
1145094613 17:20015053-20015075 GCACCACACTGGCTTAAGAGTGG + Intronic
1151190723 17:72395876-72395898 GCACCTCAGTAGCCCCACAGGGG + Intergenic
1152596165 17:81238832-81238854 GCAGCTCAGGGGCGTCGGCGCGG + Intronic
1153088732 18:1319081-1319103 GCAGCTCAGTGCAGACAGAGAGG + Intergenic
1160432826 18:78823625-78823647 GCCCTTCAGTGGGGTCGGAGAGG + Intergenic
1161267288 19:3370140-3370162 GCCCCTCAGTGCCGGGAGAGGGG + Intronic
1161424423 19:4194932-4194954 ACACCTCAGTGGGCTCCGAGGGG + Intronic
1161767343 19:6214931-6214953 GCCCCTCAGTGGCCTCAGGCTGG + Intronic
1162493687 19:11010793-11010815 GCACTCCAGTGGCCTCACAGAGG + Intronic
1163114234 19:15179494-15179516 ACACTTCAGTGGGGTAAGAGAGG + Exonic
1163603474 19:18262006-18262028 ACACCTCAGTGGCCACAGATAGG + Intronic
1163603493 19:18262084-18262106 ACACCTCAGTGGCCACAGATGGG + Intronic
1167254902 19:48421550-48421572 GCACATCAGGGGCCTCAGGGAGG + Intronic
925684451 2:6457096-6457118 GCACCTCAGTGCTGCCAGATAGG - Intergenic
939646934 2:144711629-144711651 GCACCTCAGTGCAGTTAGTGGGG - Intergenic
949032430 2:241803326-241803348 GCACCTGTGTGGCGACAGAGAGG - Exonic
1171330866 20:24337767-24337789 GCCCCTCAGTGAGGTCAGAGGGG + Intergenic
1175745141 20:61451308-61451330 GCGTCTCAGCTGCGTCAGAGTGG + Intronic
1175812893 20:61868343-61868365 GGACCTCTGAGGAGTCAGAGGGG + Intronic
1175909331 20:62397118-62397140 CCACCTCAGTGCCGTCACGGGGG + Intronic
1175943252 20:62547477-62547499 GCCCCCCAGTGATGTCAGAGGGG - Intergenic
1179609295 21:42539503-42539525 CCACCTCAGTGGCATCATTGGGG + Exonic
1182995425 22:34807848-34807870 GCTTCTCAGAGGAGTCAGAGAGG - Intergenic
950050706 3:9986872-9986894 GCACCTCAGTGGCGTCAGAGCGG + Exonic
950056152 3:10026401-10026423 GCGCCTCGGTGGCGTCAGAGCGG + Exonic
950653419 3:14422047-14422069 CCACCTCAGTGAAGTCTGAGGGG + Intronic
963727571 3:148939365-148939387 GCACTTCAGTGGTGTCAAACTGG + Intergenic
963972272 3:151443294-151443316 TCACTTCAGTGCCATCAGAGAGG + Exonic
966252962 3:177887455-177887477 GCATCTCTGTGGTGGCAGAGTGG - Intergenic
968511794 4:998916-998938 GCAGCTCACTGGAGTCAGGGTGG - Intronic
969726371 4:8920665-8920687 GCAGCTGAGTGGCGTCGGGGAGG + Intergenic
975359154 4:73446502-73446524 GCACCTAAGTGGCCAGAGAGAGG - Intronic
983169297 4:164517861-164517883 GCATCTCTGTGGGGTCAGTGTGG + Intergenic
985535079 5:460080-460102 GCACTGCAGTGGCTTCAGAGAGG - Intronic
995225732 5:109698713-109698735 GCACTTCATTGGCTTCAGTGAGG + Intronic
996962707 5:129270209-129270231 GCACCTCACTGGGGGCAGAGTGG - Intergenic
997675060 5:135706736-135706758 GCACATCAGTGGCTTGAGGGAGG - Intergenic
1002259191 5:177982332-177982354 GCACCTCCGTGTCGCCAGGGCGG - Intergenic
1002527638 5:179823785-179823807 GCCCCACAGTGACGACAGAGGGG + Intronic
1003966411 6:11256383-11256405 GCGCCTCTGTGGTGTTAGAGTGG - Intronic
1008595107 6:53034475-53034497 GCAGGTCAGTTGTGTCAGAGTGG + Intronic
1011009567 6:82688306-82688328 GTACCTCAGTGACGGCAGAAAGG - Intergenic
1018638228 6:165883702-165883724 GCACCTCAGTGGGGTGTGCGAGG - Intronic
1018944957 6:168341178-168341200 GGCCCTGAGTGGCGTCAGGGAGG - Intergenic
1023763928 7:43493244-43493266 ACACCTCTGTGGAGACAGAGCGG + Intronic
1027270940 7:76518395-76518417 GCTCCTCAGTGGGCTCAGAGAGG - Intergenic
1027320701 7:77008226-77008248 GCTCCTCAGTGGGCTCAGAGAGG - Intergenic
1032061595 7:128729740-128729762 TCACCTCTGTGAGGTCAGAGAGG - Intronic
1034635440 7:152563736-152563758 GGACCTCAGTGGACTCACAGAGG - Intergenic
1038411734 8:27364262-27364284 GCACCTCAGGGGCTTCAGCCAGG + Intronic
1048466105 8:134665848-134665870 GGACCTCAGGGGAGGCAGAGGGG - Intronic
1050504129 9:6329439-6329461 GCAAGTCAGTGGCTCCAGAGGGG + Exonic
1054460353 9:65459047-65459069 ACACCTGAGTGGCAGCAGAGAGG + Intergenic
1055252980 9:74330682-74330704 CCAACTCAGTGGCATCAGTGTGG + Intergenic
1057211371 9:93202763-93202785 GCTCCTCAGGGGCTTCAGGGAGG - Intronic
1059411922 9:114137926-114137948 GCACCTCAGGGGCCACAGATGGG + Intergenic
1060545470 9:124456680-124456702 GCACCTCAATGACCTCAGAGCGG + Exonic
1061387406 9:130298755-130298777 CCAACTCAGTGCAGTCAGAGGGG + Intronic
1062073039 9:134568638-134568660 GAACCTCCTTGGGGTCAGAGGGG - Intergenic
1186262476 X:7794119-7794141 GCAGCTCATTGGCATCACAGAGG - Intergenic
1190789208 X:53683732-53683754 GCACCTCAGAGGCGTCATAAAGG + Intronic
1192213307 X:69141300-69141322 CAACCTCAGTGGCATCAGAGTGG - Intergenic
1200363529 X:155636260-155636282 GTCCCACAGTGGGGTCAGAGAGG + Intronic