ID: 950052146

View in Genome Browser
Species Human (GRCh38)
Location 3:10000337-10000359
Sequence GCCTCTATTAAGTTTTAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 1, 2: 1, 3: 10, 4: 183}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950052141_950052146 17 Left 950052141 3:10000297-10000319 CCCAAAGTGCTAGGATTACAGGC 0: 15701
1: 240057
2: 272945
3: 174764
4: 138480
Right 950052146 3:10000337-10000359 GCCTCTATTAAGTTTTAAGATGG 0: 1
1: 1
2: 1
3: 10
4: 183
950052142_950052146 16 Left 950052142 3:10000298-10000320 CCAAAGTGCTAGGATTACAGGCA 0: 7892
1: 107752
2: 241468
3: 240344
4: 208055
Right 950052146 3:10000337-10000359 GCCTCTATTAAGTTTTAAGATGG 0: 1
1: 1
2: 1
3: 10
4: 183
950052135_950052146 30 Left 950052135 3:10000284-10000306 CCCGCCTCGGCCTCCCAAAGTGC 0: 84291
1: 218536
2: 234154
3: 158283
4: 172560
Right 950052146 3:10000337-10000359 GCCTCTATTAAGTTTTAAGATGG 0: 1
1: 1
2: 1
3: 10
4: 183
950052139_950052146 20 Left 950052139 3:10000294-10000316 CCTCCCAAAGTGCTAGGATTACA 0: 22138
1: 313177
2: 258607
3: 141974
4: 131406
Right 950052146 3:10000337-10000359 GCCTCTATTAAGTTTTAAGATGG 0: 1
1: 1
2: 1
3: 10
4: 183
950052136_950052146 29 Left 950052136 3:10000285-10000307 CCGCCTCGGCCTCCCAAAGTGCT 0: 87986
1: 182858
2: 138884
3: 74939
4: 51691
Right 950052146 3:10000337-10000359 GCCTCTATTAAGTTTTAAGATGG 0: 1
1: 1
2: 1
3: 10
4: 183
950052137_950052146 26 Left 950052137 3:10000288-10000310 CCTCGGCCTCCCAAAGTGCTAGG 0: 7193
1: 136299
2: 273280
3: 205953
4: 123893
Right 950052146 3:10000337-10000359 GCCTCTATTAAGTTTTAAGATGG 0: 1
1: 1
2: 1
3: 10
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950052146 Original CRISPR GCCTCTATTAAGTTTTAAGA TGG Intronic
902125309 1:14204960-14204982 GCCAATATGAAGTTCTAAGAAGG + Intergenic
902578950 1:17396379-17396401 GCCTTTATTATTTTTTGAGATGG - Intronic
906505036 1:46372537-46372559 ACCTATATTAAGTTGTGAGAAGG - Intergenic
907127256 1:52061939-52061961 GCCTCTTTTTTTTTTTAAGATGG + Intronic
907789644 1:57649453-57649475 CCCTCTGATATGTTTTAAGAAGG + Intronic
908769624 1:67584170-67584192 GCCTCTATTAGGTTTCTAAAAGG + Intergenic
908823759 1:68114459-68114481 GCATATAGTAAGTTTTAAAAAGG - Intronic
913998901 1:143675606-143675628 TCCTGCATTAAGTTTAAAGAAGG + Intergenic
915542917 1:156580068-156580090 GCTTGTATTCAGGTTTAAGAGGG + Intronic
915628095 1:157128965-157128987 TTCTCCATTAAGTTTTAAGATGG - Intronic
917409138 1:174740158-174740180 GTCTCTATGAAGATGTAAGAAGG - Intronic
917845589 1:179017378-179017400 GCCTCTTTTGAGCTTTAAAAAGG + Intergenic
919951597 1:202369237-202369259 ATCTCTAATAGGTTTTAAGATGG + Intronic
920412764 1:205775040-205775062 GCCTCACTTCAGTTTGAAGAGGG - Exonic
923347344 1:233067003-233067025 GCCTCTATTGACTCTTGAGATGG - Intronic
1064855535 10:19763405-19763427 GCATCTAATAAGTTTTGATATGG + Intronic
1066107930 10:32171920-32171942 GCCTCCATTAATTCTTAAAACGG + Intergenic
1066671407 10:37844192-37844214 GCATCTTTAAAGTGTTAAGAGGG + Intronic
1069553778 10:69383288-69383310 TACTCTATCAAGATTTAAGAAGG - Intronic
1070155772 10:73834215-73834237 GCTTCTACTGGGTTTTAAGAGGG + Intronic
1070176093 10:73970695-73970717 GCCTTTATTCAGTCTTAAGATGG + Intergenic
1074462960 10:113655261-113655283 GCCTCCATTAAAATTTAAAAGGG + Intronic
1075800059 10:125148110-125148132 GCCTCTACTAAGCTCTAGGAGGG + Intronic
1077578834 11:3404246-3404268 GCCTCTTTTAATTTTTCAAACGG + Intergenic
1077955924 11:7020071-7020093 GCCTTTATTAAGTCTTAACGTGG + Exonic
1078643407 11:13116458-13116480 GCCTCTGAAAAGTTTTAAGCAGG - Intergenic
1081258003 11:40921325-40921347 GTCATTATTAATTTTTAAGATGG + Intronic
1084235858 11:67787763-67787785 GCCTCTTTTAAGTTTTCAAACGG + Intergenic
1085175449 11:74482839-74482861 ATCTCCAATAAGTTTTAAGATGG - Intergenic
1086190057 11:84068423-84068445 GCTTGAATTAAGTTTTAAAAGGG - Intronic
1087943254 11:104126960-104126982 TCCTCTATGAAGTTTTTTGAGGG + Intronic
1088109627 11:106246910-106246932 GCCTCTATCTAGATTTCAGAGGG + Intergenic
1088345674 11:108822026-108822048 ATTTCCATTAAGTTTTAAGATGG + Intronic
1090822273 11:130353799-130353821 GCCCATATTAATTTTTAGGATGG + Intergenic
1091068913 11:132544561-132544583 GCCTCTAATAACTTTTTAGTCGG - Intronic
1091209114 11:133841832-133841854 GCCTCTCTTAAGTTTGTGGAAGG - Intronic
1091535035 12:1398771-1398793 GCCGCTTTTGACTTTTAAGATGG + Intronic
1092406761 12:8227125-8227147 GCCTCTTTTAATTTTTCAAACGG + Intronic
1093472432 12:19517040-19517062 GTCAAAATTAAGTTTTAAGATGG - Intronic
1093678703 12:21974945-21974967 GCCTATATTATGTTTTGAGAAGG - Intergenic
1098680954 12:73353908-73353930 GGCACTATTAGGTTTTAAAATGG + Intergenic
1099825455 12:87771309-87771331 GTCACTACTAAGTTTGAAGATGG + Intergenic
1101338374 12:103818048-103818070 GCTTCTGTTAGGTTTTGAGAGGG - Intronic
1103967826 12:124651439-124651461 GAAGCTATTAAGTTTTAAGCAGG - Intergenic
1105035136 12:132913874-132913896 TCATCTATTAAGTTTGAATATGG + Intronic
1105860059 13:24401309-24401331 ATCTCCAATAAGTTTTAAGATGG - Intergenic
1106184339 13:27395649-27395671 GCCTCTTTTGACTTTTAAAAAGG + Intergenic
1106656043 13:31747270-31747292 GCCTCTCTTAATTTTTCAGCTGG - Intronic
1107109211 13:36677511-36677533 GCCTCTAATAATTGTTAAAAGGG + Intronic
1107489111 13:40863270-40863292 CTCTCCAATAAGTTTTAAGATGG + Intergenic
1109087198 13:57989550-57989572 GCCAATATTCAGTTTTAAAATGG + Intergenic
1115064764 14:29244492-29244514 GCCTCTATTTTTTTTTTAGATGG - Intergenic
1115180156 14:30615337-30615359 TCTTCTCTTAAGTTTTAAGCAGG + Exonic
1115415194 14:33124151-33124173 GCCTCTATGAAGTTTTATAGAGG + Intronic
1115695405 14:35892519-35892541 ATCTCCAATAAGTTTTAAGATGG + Intronic
1117019788 14:51558167-51558189 GCCTCATTTAATTTTTAAAAAGG - Intronic
1122031158 14:98913637-98913659 GCCTCTATTTCTTTGTAAGATGG + Intergenic
1123401644 15:19993277-19993299 ACCTCTAATAAGATTAAAGAGGG + Intergenic
1123958688 15:25369976-25369998 GTCTCTATGAATTTTTAAGTGGG + Intronic
1124722438 15:32121724-32121746 GCCTTTTTTCACTTTTAAGATGG + Intronic
1126716044 15:51518572-51518594 GCGTATATTAAAGTTTAAGAAGG + Intronic
1131348158 15:91670873-91670895 GCCTCTCTTAAGATCCAAGAGGG + Intergenic
1131491878 15:92870171-92870193 GCCTCTTTTAAGTGTTAAGTTGG - Intergenic
1133479066 16:6151798-6151820 GCCTGTATTAAGTAGTAAGGGGG + Intronic
1134596592 16:15500654-15500676 TCCTTTATTTAGTTTTGAGACGG + Intronic
1135796898 16:25454024-25454046 ATCTCCAGTAAGTTTTAAGATGG + Intergenic
1138058464 16:53861950-53861972 GCCTCTACAGAGTTTTAAGGGGG - Intronic
1138088653 16:54156178-54156200 GCCTCTTTCCAGTTTTTAGAAGG - Intergenic
1140962787 16:79932661-79932683 GCTTCAATTAAGATTGAAGAAGG - Intergenic
1143065866 17:4246800-4246822 GCCTCTTTTAAGAGTTAAAAGGG + Intronic
1145976539 17:28987217-28987239 GCCCCTTTCAAGTTTTAATAGGG + Intronic
1149219234 17:54396561-54396583 ACATCTATTATGTTTTAGGATGG + Intergenic
1156628146 18:38934425-38934447 GCCTCTAGGCAGTTTTAGGAGGG + Intergenic
1156765761 18:40653056-40653078 GACTCAATTTAGTTTTCAGATGG - Intergenic
1157704519 18:49792447-49792469 GTCTTTATTAATTTTTGAGATGG + Intronic
1158832889 18:61299785-61299807 GCCTTTATCAAGTTTAAGGAAGG + Intergenic
1159700877 18:71624975-71624997 GCCAGTAAGAAGTTTTAAGATGG + Intergenic
1159803668 18:72928899-72928921 CACTCTATTAAGCTCTAAGAGGG + Intergenic
1167070135 19:47216885-47216907 GGCCCTATTTATTTTTAAGACGG + Intergenic
925569894 2:5297985-5298007 GTCTCTATAGAGTTTTAAGATGG + Intergenic
925894466 2:8460701-8460723 ACCTGAATTAAGTTTTGAGAGGG - Intergenic
926016504 2:9457605-9457627 GCACCTATTAAGTTTAAAGAAGG + Intronic
927225603 2:20763013-20763035 GAATCTTTTAAGTTCTAAGATGG - Intronic
930044869 2:47161251-47161273 GTATCTACTAACTTTTAAGATGG - Intronic
930538737 2:52678205-52678227 TCCTCTATTAAGTTTCTAGTAGG - Intergenic
932231176 2:70086008-70086030 TCCACTATTAAGCTTTAAAAAGG + Intergenic
933107968 2:78357290-78357312 GCATCAAATAACTTTTAAGATGG + Intergenic
934960415 2:98668015-98668037 GCCAGCATTCAGTTTTAAGACGG + Intronic
939855907 2:147358307-147358329 GCCTCCATTAAGTTGAGAGAAGG + Intergenic
939941739 2:148359556-148359578 GCCTTTCTTAAGACTTAAGAAGG - Intronic
940274056 2:151920837-151920859 GCCTCAAGTAAGTTTTAAGATGG - Intronic
943507382 2:188778636-188778658 GCCTCTATTAAGTTACAATTAGG + Intronic
945504951 2:210628543-210628565 GCTTCTGTTAAGTTTTTAGGAGG + Intronic
946360609 2:219217344-219217366 GCCTCTTTTTGTTTTTAAGACGG - Intronic
947302049 2:228698876-228698898 GTCTTTATTAAGTTATAGGATGG + Intergenic
1173244666 20:41328017-41328039 GCTACTGTTAAGTTTTAAAAAGG - Intergenic
1176701751 21:10061310-10061332 GCCACTATTAGGTTTCAAAAGGG + Intergenic
1177219108 21:18167606-18167628 GCCTTTATTAAGATTTTTGAAGG + Intronic
1179427312 21:41291918-41291940 GCATCTATTAAGTTCTAGGCAGG - Intergenic
1183552678 22:38500507-38500529 GCCTCTTTTTATTTTTGAGACGG - Intronic
1184844535 22:47073071-47073093 GGCAGTATTAAATTTTAAGAGGG - Intronic
949470409 3:4390189-4390211 GCCTCTATTAACGATTCAGAAGG + Intronic
950052146 3:10000337-10000359 GCCTCTATTAAGTTTTAAGATGG + Intronic
950059448 3:10057660-10057682 GCCTCCATTAAGTTTTAAGATGG + Intronic
956944471 3:74203986-74204008 GCAGCTTTTAAGTATTAAGATGG + Intergenic
959626181 3:108454424-108454446 ACCTGGTTTAAGTTTTAAGATGG + Intronic
959672858 3:108998533-108998555 GTGTCTATTAAATTTCAAGAAGG - Intronic
960229820 3:115212558-115212580 GCCTTTATTAAATTTTAATGTGG + Intergenic
960660791 3:120056239-120056261 GTCTCTTTTAATTTCTAAGATGG + Intronic
962003930 3:131329066-131329088 GCCTTAATTAATTTTTAAAAAGG - Intronic
962565868 3:136658828-136658850 GGCTCTATTAATTTTTATTATGG + Intronic
965395870 3:168160015-168160037 TGTTCTATTATGTTTTAAGAGGG + Intergenic
966550020 3:181194383-181194405 CCCTCTGTGAAGTTTCAAGAAGG + Intergenic
969759375 4:9170857-9170879 GCCTCTTTTAATTTTTCAAACGG - Intronic
971887416 4:32470957-32470979 TCCTCTATTCAGATTTCAGAAGG + Intergenic
972683047 4:41325329-41325351 GCCTTTCTTTAGTTTTAAAAAGG + Intergenic
975257811 4:72258817-72258839 TCCTCTATGAAGTTTTCAAAAGG + Intergenic
975333017 4:73140822-73140844 GCCTCTATTAGTCTTGAAGATGG - Intronic
975990145 4:80250801-80250823 GCCTCTATCTAGTTTTTAAAAGG + Intergenic
976985435 4:91290059-91290081 GCATCTTTAAAGTTTTGAGAGGG + Intronic
977119417 4:93079037-93079059 GCCTCAATTTAGTTTTGAAAAGG + Intronic
979833257 4:125327549-125327571 GGCTTTATAAATTTTTAAGATGG + Intronic
980490606 4:133522364-133522386 GTCTCTTTTATGTATTAAGAAGG + Intergenic
981384208 4:144108603-144108625 GCCTTTATTAATATTTAAAATGG - Intergenic
983405689 4:167326879-167326901 TCCTTTATTCAGTTTTAAGTTGG - Intergenic
983904069 4:173167271-173167293 GGCTATCCTAAGTTTTAAGATGG - Intergenic
984648266 4:182242459-182242481 GCCACCAAGAAGTTTTAAGAAGG - Intronic
986480824 5:8185517-8185539 GCCTCTATTGAGGTTCAATAGGG + Intergenic
987042963 5:14079986-14080008 GCCCCTGAGAAGTTTTAAGAAGG - Intergenic
988854505 5:35214881-35214903 GTTTCTATAAATTTTTAAGATGG - Intronic
989406727 5:41069440-41069462 GCCTGTATAAAGTTATAAAAAGG + Intronic
992128874 5:73671104-73671126 GCCTCTATAAAGTTTGTTGATGG + Intronic
993330503 5:86594402-86594424 ACTTCTCTAAAGTTTTAAGATGG + Intergenic
995683915 5:114750236-114750258 GCCTCTGTTTATTTTTAAAATGG - Intergenic
995715356 5:115077301-115077323 GCCTCTATTATATGTAAAGAGGG - Intergenic
1000477894 5:161733725-161733747 GCCTCCATTAACTTTTAGAATGG + Intergenic
1001859384 5:175040142-175040164 GCTGCTATTAAGTTGAAAGAGGG - Intergenic
1006469589 6:34220365-34220387 ATCTCCAGTAAGTTTTAAGATGG - Intergenic
1009448038 6:63766658-63766680 TTCTCTATTATGTTATAAGAAGG + Intronic
1011840071 6:91486422-91486444 CCCTCTACTGACTTTTAAGATGG - Intergenic
1013931162 6:115534650-115534672 GCCATTGTTAAGTTTAAAGAGGG + Intergenic
1014716453 6:124869931-124869953 ACATCTATTAATTTTTAAAAAGG + Intergenic
1015783554 6:136897130-136897152 GGCCCTATTAAGTTTTGAAAAGG - Intronic
1016879764 6:148899465-148899487 GCTTCTATTATGTTTTAATTTGG + Intronic
1017795509 6:157840610-157840632 CAATCAATTAAGTTTTAAGAAGG - Intronic
1018882651 6:167900572-167900594 ACCTCTTTCAAGTTTTAACATGG - Intronic
1020318896 7:6926308-6926330 GCCTCTTTTAATTTTTCAAACGG + Intergenic
1021884248 7:25123386-25123408 ATCTCCAGTAAGTTTTAAGATGG + Exonic
1027784227 7:82559028-82559050 GCCTCTGTCAATTTTTAAAATGG + Intergenic
1029052750 7:97706455-97706477 GCAACTATTAAGTTTTGAGAGGG - Intergenic
1030311301 7:108071882-108071904 GCCACTGAAAAGTTTTAAGAAGG - Intronic
1031102225 7:117495366-117495388 TCCTCTGTTATGTTTCAAGATGG + Intronic
1031506018 7:122584465-122584487 ACCTCTGTTAAGTTTAAAAATGG - Intronic
1031718703 7:125141101-125141123 GCAACTATTAATTTTTAAAAGGG + Intergenic
1033857028 7:145576017-145576039 CCCTCAATTAAATATTAAGATGG - Intergenic
1034131978 7:148727573-148727595 GCCTGGAGTAAGTGTTAAGAAGG + Intronic
1036381519 8:8238888-8238910 GCCTCTTTTAATTTTTCAAATGG - Intergenic
1036847127 8:12178055-12178077 GCCTCTTTTAATTTTTCAAACGG + Intergenic
1036868494 8:12420376-12420398 GCCTCTTTTAATTTTTCAAACGG + Intergenic
1040754980 8:50762177-50762199 ATCTCCAGTAAGTTTTAAGATGG + Intronic
1041215432 8:55595725-55595747 GCCTGTATTAAGCTTTATTAAGG - Intergenic
1043323460 8:79019726-79019748 GACTCTTTTAAATTTTAAAAAGG + Intergenic
1043858594 8:85289560-85289582 GCCTCTCTCAAGTTCCAAGACGG + Intergenic
1045636061 8:104191773-104191795 TACTATATTAATTTTTAAGACGG + Intronic
1047652029 8:126933113-126933135 GCCTCTATTTAATTACAAGATGG + Intergenic
1049129043 8:140820398-140820420 GCCTGAATTATGTTTTAACAGGG + Intronic
1050449048 9:5760456-5760478 GACTACCTTAAGTTTTAAGATGG - Intronic
1054926795 9:70597527-70597549 TCCTCTAGTGAGTTTTGAGAGGG + Intronic
1056485893 9:87057772-87057794 CACTTTATTAAGTTATAAGAAGG - Intergenic
1057323645 9:94038636-94038658 AACTCCAGTAAGTTTTAAGATGG - Intronic
1058308600 9:103473022-103473044 GCCTTTATTAGCTTTGAAGACGG - Intergenic
1058637740 9:107052987-107053009 GTGTTTATTAAGATTTAAGAAGG - Intergenic
1058998220 9:110320682-110320704 GCCTTTATTAGATTTTAAGAGGG + Intronic
1060346971 9:122825770-122825792 GCCCATATTTATTTTTAAGAGGG - Intronic
1062296284 9:135829200-135829222 GCCTCTTTTAACTTTTATAATGG - Intronic
1202786768 9_KI270719v1_random:31398-31420 GCCACTATTAGGTTTCAAAAGGG + Intergenic
1185518619 X:719728-719750 GCCACACTTTAGTTTTAAGAAGG + Intergenic
1186589027 X:10909156-10909178 GCCTCTTTTTTTTTTTAAGATGG - Intergenic
1187014842 X:15316477-15316499 GTATGTATTTAGTTTTAAGATGG + Intergenic
1188626430 X:32290749-32290771 GCCTTTAAGAAGTTTTAAGTAGG + Intronic
1189434250 X:40977365-40977387 GCCTTTTTTAAATTTTGAGATGG + Intergenic
1190486644 X:50932899-50932921 GACTCTATTCAATTTTAGGAAGG + Intergenic
1193102424 X:77629617-77629639 GCCCCTCTTAAGTTTTAACAAGG + Intronic
1193581814 X:83274214-83274236 GCATCTATTTCTTTTTAAGATGG + Intergenic
1194084761 X:89511931-89511953 GTCTCTTTTAAATTTTATGATGG + Intergenic
1195010394 X:100728077-100728099 GCCTCTGTGAAGATTTTAGATGG + Intronic
1197043948 X:121973603-121973625 ACACCTAATAAGTTTTAAGAGGG + Intergenic
1199208474 X:145177194-145177216 AACTCCAATAAGTTTTAAGATGG - Intergenic
1199822587 X:151463961-151463983 ACCTCTCTTTAGTTTTCAGAAGG + Intergenic
1200130568 X:153841861-153841883 ATCTCCAGTAAGTTTTAAGACGG - Intergenic
1200437408 Y:3167818-3167840 GTCTCTTTTAAATTTTATGATGG + Intergenic
1201526488 Y:14941237-14941259 ATCTCCAGTAAGTTTTAAGATGG + Intergenic
1202110806 Y:21417276-21417298 GCCACTAGTATGTCTTAAGAAGG - Intergenic
1202117649 Y:21486914-21486936 GCCACTAGTATGTCTTAAGAAGG + Intergenic
1202582948 Y:26401497-26401519 ATCTCTAATAGGTTTTAAGATGG - Intergenic
1202596935 Y:26550041-26550063 ATCTTCATTAAGTTTTAAGATGG - Intergenic