ID: 950052607

View in Genome Browser
Species Human (GRCh38)
Location 3:10003794-10003816
Sequence ACACCACCATGGCCTCATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950052603_950052607 -10 Left 950052603 3:10003781-10003803 CCACGCAACCAATACACCACCAT 0: 1
1: 0
2: 0
3: 4
4: 68
Right 950052607 3:10003794-10003816 ACACCACCATGGCCTCATGAGGG 0: 1
1: 0
2: 1
3: 15
4: 104
950052602_950052607 -9 Left 950052602 3:10003780-10003802 CCCACGCAACCAATACACCACCA 0: 1
1: 0
2: 0
3: 3
4: 92
Right 950052607 3:10003794-10003816 ACACCACCATGGCCTCATGAGGG 0: 1
1: 0
2: 1
3: 15
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950052607 Original CRISPR ACACCACCATGGCCTCATGA GGG Intronic