ID: 950052607 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:10003794-10003816 |
Sequence | ACACCACCATGGCCTCATGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 121 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 15, 4: 104} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
950052603_950052607 | -10 | Left | 950052603 | 3:10003781-10003803 | CCACGCAACCAATACACCACCAT | 0: 1 1: 0 2: 0 3: 4 4: 68 |
||
Right | 950052607 | 3:10003794-10003816 | ACACCACCATGGCCTCATGAGGG | 0: 1 1: 0 2: 1 3: 15 4: 104 |
||||
950052602_950052607 | -9 | Left | 950052602 | 3:10003780-10003802 | CCCACGCAACCAATACACCACCA | 0: 1 1: 0 2: 0 3: 3 4: 92 |
||
Right | 950052607 | 3:10003794-10003816 | ACACCACCATGGCCTCATGAGGG | 0: 1 1: 0 2: 1 3: 15 4: 104 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
950052607 | Original CRISPR | ACACCACCATGGCCTCATGA GGG | Intronic | ||