ID: 950053282

View in Genome Browser
Species Human (GRCh38)
Location 3:10007918-10007940
Sequence CCTGGTCCTGTTCTTTATTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 1, 2: 0, 3: 22, 4: 275}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950053282_950053288 -3 Left 950053282 3:10007918-10007940 CCCCAATAAAGAACAGGACCAGG 0: 1
1: 1
2: 0
3: 22
4: 275
Right 950053288 3:10007938-10007960 AGGAAGCAAGAAGCAGGCTCAGG 0: 2
1: 0
2: 31
3: 79
4: 555
950053282_950053292 7 Left 950053282 3:10007918-10007940 CCCCAATAAAGAACAGGACCAGG 0: 1
1: 1
2: 0
3: 22
4: 275
Right 950053292 3:10007948-10007970 AAGCAGGCTCAGGAGAGGGTGGG 0: 2
1: 0
2: 2
3: 50
4: 484
950053282_950053290 3 Left 950053282 3:10007918-10007940 CCCCAATAAAGAACAGGACCAGG 0: 1
1: 1
2: 0
3: 22
4: 275
Right 950053290 3:10007944-10007966 CAAGAAGCAGGCTCAGGAGAGGG 0: 2
1: 6
2: 23
3: 79
4: 571
950053282_950053289 2 Left 950053282 3:10007918-10007940 CCCCAATAAAGAACAGGACCAGG 0: 1
1: 1
2: 0
3: 22
4: 275
Right 950053289 3:10007943-10007965 GCAAGAAGCAGGCTCAGGAGAGG 0: 2
1: 0
2: 3
3: 38
4: 374
950053282_950053293 18 Left 950053282 3:10007918-10007940 CCCCAATAAAGAACAGGACCAGG 0: 1
1: 1
2: 0
3: 22
4: 275
Right 950053293 3:10007959-10007981 GGAGAGGGTGGGAGTGTTATAGG 0: 2
1: 0
2: 4
3: 39
4: 375
950053282_950053291 6 Left 950053282 3:10007918-10007940 CCCCAATAAAGAACAGGACCAGG 0: 1
1: 1
2: 0
3: 22
4: 275
Right 950053291 3:10007947-10007969 GAAGCAGGCTCAGGAGAGGGTGG 0: 2
1: 0
2: 8
3: 79
4: 722
950053282_950053294 19 Left 950053282 3:10007918-10007940 CCCCAATAAAGAACAGGACCAGG 0: 1
1: 1
2: 0
3: 22
4: 275
Right 950053294 3:10007960-10007982 GAGAGGGTGGGAGTGTTATAGGG 0: 2
1: 0
2: 0
3: 28
4: 302
950053282_950053286 -9 Left 950053282 3:10007918-10007940 CCCCAATAAAGAACAGGACCAGG 0: 1
1: 1
2: 0
3: 22
4: 275
Right 950053286 3:10007932-10007954 AGGACCAGGAAGCAAGAAGCAGG 0: 2
1: 2
2: 9
3: 53
4: 409

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950053282 Original CRISPR CCTGGTCCTGTTCTTTATTG GGG (reversed) Intronic
900789392 1:4669585-4669607 CCTGGTCCCGCCCTTGATTGTGG + Intronic
901625553 1:10622808-10622830 CCTGGTCCTTGTCCTTATTCAGG + Intronic
902086954 1:13870301-13870323 CATGATCTTGTTCTTTTTTGTGG + Intergenic
906550964 1:46666272-46666294 CCTGGTGAGGCTCTTTATTGAGG - Intronic
908113227 1:60917360-60917382 CCTGGTCTTGTTCTTGAGAGGGG + Intronic
909052070 1:70778108-70778130 CCTAGGCCTGTACTTGATTGAGG - Intergenic
909211828 1:72833997-72834019 TCTGGTCCTGGGCTTTATTTTGG - Intergenic
909335356 1:74465944-74465966 TCTGGTCATCTTCTGTATTGTGG + Intronic
909769651 1:79404777-79404799 TCTTGTTCTGTTCTTTACTGTGG + Intergenic
909772826 1:79445736-79445758 CATGATCTTGTTCTTTTTTGTGG - Intergenic
909775682 1:79481899-79481921 CCTGGTCCCATTCTTTTTTATGG - Intergenic
910190706 1:84592387-84592409 TCTGGTCCTGGGCTTTTTTGGGG - Intergenic
910813299 1:91260193-91260215 CATGGTCTTGTTCTTTATTATGG - Intergenic
911311316 1:96295052-96295074 TCTGGTCCTGTGCTTTTTTTTGG + Intergenic
911984864 1:104609876-104609898 TCTGGTCCTGGTCTTTTTTTTGG - Intergenic
912928618 1:113935355-113935377 CATGGTCTTGTTCTTTTTTATGG + Intronic
914260014 1:145991054-145991076 TCTGGTCCTGGTCCTTATTTGGG - Intergenic
914904610 1:151733583-151733605 CCTGTTCCTGGTCTCTGTTGAGG - Intergenic
916055747 1:161068128-161068150 CCTGGTACTGCCCTTTTTTGTGG - Intronic
916123532 1:161549915-161549937 CCTGGTCCTGTTCTATGGTGGGG - Exonic
916765512 1:167856260-167856282 GGTGTTCCTGTTCTTTATTACGG + Exonic
917028604 1:170666566-170666588 CGTGGTCCTGTTTTCTGTTGTGG - Intronic
917563983 1:176192358-176192380 CCTGGTACTGTTGTTACTTGTGG - Intronic
918159593 1:181885730-181885752 CCTGGTCCTGGACTTTTTTTTGG - Intergenic
918319818 1:183353816-183353838 CCTGTTCCTGTCCCTGATTGTGG + Intronic
919136249 1:193511333-193511355 TCTGGTCCTGGGCTTTATTTTGG + Intergenic
920414971 1:205793116-205793138 CCTGGCCATGCTCTTTATTTGGG - Intronic
920928690 1:210366797-210366819 CCTGTTCCTCTTCTGGATTGGGG + Intronic
921962548 1:221050943-221050965 TCTGGTCCTGGTCTTTTTTTTGG - Intergenic
924171363 1:241345052-241345074 CATGATCTTGTTCTTTGTTGTGG - Intronic
1064412322 10:15117471-15117493 CCTCGTCGTGTTCTTGATGGTGG - Intronic
1064598945 10:16973814-16973836 CATGGTCTTGTTCATTCTTGTGG + Intronic
1064935220 10:20671708-20671730 CCTGGTGCTGTTGTTGACTGCGG - Intergenic
1066239869 10:33523252-33523274 CCTTGTCCTGCTCTTTAATTAGG + Intergenic
1068307217 10:55227387-55227409 CCATGTCTTGTTCTTAATTGAGG - Intronic
1069281269 10:66657352-66657374 CTTGCTCCTGTTCTTCAATGTGG + Intronic
1071455121 10:85842142-85842164 CATGATCTTGTTCTTTTTTGTGG - Intronic
1072715035 10:97745472-97745494 CCTGGCCCTGTTCTTTCTGCTGG + Intronic
1073624227 10:105079882-105079904 CCTGATCTTGTTCTTTTTTATGG + Intronic
1074157090 10:110808528-110808550 CCTGGGCCTTTTCTTGAATGGGG + Intronic
1074546682 10:114406647-114406669 CATGGTCTTGTTCTTTTTTATGG - Intergenic
1074930497 10:118120467-118120489 CCTGGTCATGTTCCTTCTTGGGG + Intergenic
1075763665 10:124875946-124875968 CCAGCTCCTGTACTTTTTTGAGG + Intergenic
1077701477 11:4445963-4445985 CCTAGTGCTGTTCTTTATGGAGG + Intergenic
1079636805 11:22752636-22752658 CCTCCTCCTTTTCTTTTTTGGGG - Intronic
1079919729 11:26418133-26418155 CCTGCTGCTGTTCTTACTTGTGG - Intronic
1080577445 11:33612927-33612949 CATGATCTTGTTCTTTATTATGG + Intronic
1080725070 11:34889808-34889830 CATGATCTTGTTCTTTATTATGG + Intronic
1083744125 11:64725924-64725946 CCCTGGCCTGTTCTTTATTTTGG - Intergenic
1083944390 11:65915978-65916000 CCTGGCCCTGGCCTTGATTGGGG - Intergenic
1084480915 11:69419545-69419567 CCTGGTCCTCTTCTTAAGTCTGG - Intergenic
1084874182 11:72118476-72118498 TCTGGTCCAGTTCTTTGTTCAGG - Intronic
1086305831 11:85481578-85481600 CCTGGTGCTAGGCTTTATTGGGG - Intronic
1086398182 11:86438590-86438612 CCTGGACCTGGTTTTTCTTGGGG + Intergenic
1087727233 11:101735324-101735346 CGTAGCCCTGTTCTGTATTGTGG - Intronic
1088650208 11:111951276-111951298 TCTGGGCCTGTACTTTTTTGAGG - Intronic
1088830164 11:113530130-113530152 CCTGTTTCTGTTGTCTATTGCGG - Intergenic
1089901496 11:121990873-121990895 CATGATCTTGTTCTTTTTTGTGG - Intergenic
1093581552 12:20789964-20789986 CAAGGTCCTTTTCTTTATGGTGG + Intergenic
1094686630 12:32723301-32723323 CCTGGTCTTGTTATATAATGGGG - Intronic
1095333664 12:41000956-41000978 CATGGTCTTGTTCTTTTTTATGG + Intronic
1096451847 12:51749513-51749535 CCTTGTCATTTTCTTTTTTGGGG + Intronic
1096872209 12:54600295-54600317 CTTGCTCCTGTCCTTTTTTGAGG - Intergenic
1099319191 12:81123790-81123812 CATGATCTTGTTCTTTTTTGTGG + Intronic
1099505805 12:83474705-83474727 CCTGGTCCATTTCTTTATCTTGG - Intergenic
1099550731 12:84040391-84040413 CCTGGTCCTGGGCTTTCTTTTGG + Intergenic
1099619653 12:84985091-84985113 CTTAATCCTGTTCTTAATTGTGG - Intergenic
1099670194 12:85681443-85681465 CCTGTTCCTCTTCCTTTTTGGGG + Intergenic
1100890028 12:99115287-99115309 CATGATCTTGTTCTTTTTTGTGG - Intronic
1104341527 12:127954315-127954337 CATGATCCTGTTCTTTTTTACGG + Intergenic
1105819644 13:24068313-24068335 CATGATCTTGTTCTTTTTTGTGG + Intronic
1106006483 13:25774938-25774960 CGTGGTCCTGTATATTATTGAGG + Exonic
1107461408 13:40607090-40607112 CCTGGGTCTGGTCTTGATTGAGG - Intronic
1108078772 13:46710722-46710744 CCTGTTCCTATTCATTGTTGAGG - Intronic
1108930300 13:55809194-55809216 CCTGGTTCTCTTCATTTTTGTGG - Intergenic
1110788943 13:79566317-79566339 CATGATCCTGTTCTTTTTTATGG - Intergenic
1112233995 13:97618748-97618770 CATGGTCTTGTTCTTTTTTATGG - Intergenic
1112760743 13:102691198-102691220 TCTGGGCCTTTTCTTTATTTAGG + Intronic
1112897366 13:104316357-104316379 CCTGGTCCTCTTCTCTAATTTGG + Intergenic
1112958980 13:105098158-105098180 CCTGCTCCTTTTCTGTATGGTGG - Intergenic
1113188031 13:107712374-107712396 CCTTGTCCTCTGTTTTATTGCGG - Intronic
1114223878 14:20721414-20721436 CCTGGCCGGGTACTTTATTGGGG - Intergenic
1115811615 14:37115213-37115235 CCTGGGCCTGGTCTTCATTATGG - Intronic
1116146442 14:41076621-41076643 CCTCGGCCTTTCCTTTATTGTGG + Intergenic
1116422190 14:44745418-44745440 CCTGGTCTTTTACTGTATTGTGG - Intergenic
1117161378 14:52993862-52993884 CCTGGTGCTGTATTCTATTGTGG + Intergenic
1117643599 14:57827176-57827198 CATGGTCTTGTTCTTTTTTATGG - Intronic
1118379454 14:65205652-65205674 GCTGGGCCTGCTCTTTATTTGGG + Intergenic
1120563846 14:86030081-86030103 CCTGGGCCTGTATTTTATTGTGG - Intergenic
1120960363 14:90119162-90119184 TCTGGTCCTGTGCTTTTTTTTGG - Intronic
1121502382 14:94448504-94448526 CCTGGCCCTGCTCTCTCTTGGGG - Exonic
1124398371 15:29326153-29326175 CCTTGCCTTGTTCTTTTTTGGGG - Intronic
1127300314 15:57646644-57646666 GCTGCTCCTGTACTTTCTTGGGG - Intronic
1128065206 15:64760202-64760224 CCCAGTCCTGTTCTTCATGGAGG - Intronic
1131087784 15:89591432-89591454 CCTGGTCCTGTTCTTAAAAATGG - Intronic
1135242320 16:20819094-20819116 CATGGTCTTGTTCCTTTTTGTGG + Intronic
1138244071 16:55453398-55453420 CCTGGTCCTATTCTTGACTTTGG + Intronic
1138393991 16:56690580-56690602 CATGGTCTTGTTCTTTTTTATGG + Intronic
1141581169 16:85000187-85000209 CCTGCTCATGTTTTTAATTGAGG - Intronic
1141937361 16:87249931-87249953 CATGATCTTGTTCTTTATTATGG - Intronic
1144419792 17:15086215-15086237 CCTGGTCTTGCTCTGAATTGTGG + Intergenic
1151031596 17:70746740-70746762 CATGATCCTGTTCTTTTTTATGG - Intergenic
1151143947 17:72021325-72021347 CATGATCCTGTTCTTTTTTATGG + Intergenic
1151373046 17:73661596-73661618 TCTGTTTCTGTTCTTTATTCTGG + Intergenic
1151513633 17:74578278-74578300 CCAGGTCTTTTTCTTTATTTCGG + Intergenic
1151926002 17:77197321-77197343 CTTGGCCTTGTTCTTTATTCAGG + Intronic
1152414339 17:80149156-80149178 CCCGGTCCTGTCCTTTCTTATGG + Intergenic
1152517092 17:80831973-80831995 CTTGGTACTGGTCTTGATTGTGG + Intronic
1155291011 18:24341748-24341770 CCTGGTGCTTTTTTCTATTGTGG - Intronic
1155420302 18:25648663-25648685 CCTGGTCATATTCTTTATGTAGG - Intergenic
1157468422 18:47968401-47968423 CCTGGTCCTCTCCTTTCTTTTGG + Intergenic
1162197130 19:8993562-8993584 CCTGTTACTGTTTTTTTTTGGGG + Intergenic
1163179171 19:15586633-15586655 CCTGGTCTTGTTCCTTTTTATGG + Intergenic
1164390557 19:27816165-27816187 CATGATCCTGTTCCTTTTTGTGG + Intergenic
1166249938 19:41563202-41563224 ACTGGTTCTGTTCTTTCTTAAGG + Intronic
925646241 2:6039863-6039885 CATGGTCCTGTTCCCTAGTGTGG - Intergenic
926386545 2:12341023-12341045 CCTGGCCTTGTTCTTAAGTGGGG + Intergenic
928057130 2:28068184-28068206 TCTGTTCCTATTCTTTATTACGG - Intronic
928093405 2:28390381-28390403 CCCGGTCCTTTCCTTTCTTGTGG - Intergenic
928181086 2:29069363-29069385 CATGATCTTGTTCTTTATTATGG - Intronic
929459397 2:42091085-42091107 CTTGTTTCTGTGCTTTATTGGGG + Intergenic
932287832 2:70552163-70552185 CCTGGTCCAGTTACTTACTGTGG + Intronic
932332042 2:70903330-70903352 CCAGGACCTGTCCTTTCTTGGGG + Intronic
933285861 2:80383983-80384005 CATGATCTTGTTCTTTTTTGTGG - Intronic
935950839 2:108326827-108326849 CCTGGTCCTGTTTTTCTGTGGGG - Intergenic
936812317 2:116416929-116416951 TCTGGTCCTGGTCTTTTTTCTGG - Intergenic
938490837 2:131760204-131760226 CCTGGGCCTGGTCTTCATTTGGG + Intronic
939541141 2:143495221-143495243 CCTTTTCCTCTTCTTTATTTAGG + Intronic
940080271 2:149793242-149793264 TCTGGTCCTGTACTTTTTTTTGG + Intergenic
942068997 2:172298407-172298429 CCAGCTCTTGTTCTTTATCGTGG - Intergenic
943155379 2:184168842-184168864 CCTTTACCTGTTCTTTAATGGGG - Intergenic
944292371 2:198021764-198021786 TCTGGTCCTGGTCTTTTTTTTGG - Intronic
945109272 2:206347215-206347237 CTGGGTCCTGTCCTTTATTAGGG + Intergenic
945423973 2:209676206-209676228 CATGATCTTGTTCTTTATTATGG - Intronic
946584804 2:221173079-221173101 ACTGTTCCTGTTATCTATTGTGG - Intergenic
947315924 2:228858162-228858184 ACTGGGTCTGTTCTTTAGTGGGG + Intronic
1169047254 20:2543482-2543504 CCTGGCCATGCTGTTTATTGTGG - Intronic
1172003919 20:31803991-31804013 CCTAGTCCTTTTATTTCTTGTGG + Intergenic
1172859950 20:38041078-38041100 CCTGGTGCTGTTGTGTTTTGTGG + Intronic
1173443030 20:43095033-43095055 ACTGGTCCTGCTCTTTTTGGTGG - Intronic
1173636925 20:44567733-44567755 CCTGCTCCTGTTCTTAATCCTGG - Intronic
1174739957 20:53003162-53003184 CCAGGTACTGTCCTTCATTGTGG + Intronic
1176874018 21:14108144-14108166 TCTGGTCCTGTGCATTATTCTGG + Intergenic
1176995010 21:15544708-15544730 CCTGGTGCTCTTTTATATTGCGG - Intergenic
1178043498 21:28668575-28668597 CCTGGTCATGTGATTTATTTTGG - Intergenic
1179794522 21:43775256-43775278 CCTGGACCTGTTCTTGCTTGGGG + Intronic
1180640633 22:17295919-17295941 TCTGGTCCTGGACTTTATTTTGG + Intergenic
1181645674 22:24230775-24230797 CCTTGTTCTGTTTTTTATTTAGG + Intronic
1182762979 22:32737767-32737789 CCTGGTCCTGATCTCTAGGGAGG - Intronic
1183674692 22:39292679-39292701 CCTGGTCCTGTGTGATATTGGGG - Intergenic
1184594884 22:45507821-45507843 CCTGGCCCTGTTTTTCATTTTGG + Intronic
950053282 3:10007918-10007940 CCTGGTCCTGTTCTTTATTGGGG - Intronic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
951495048 3:23316591-23316613 CTTGGTGCTTTTCTCTATTGTGG + Intronic
952622718 3:35365077-35365099 CTTGGTTTTGTTCTTTATTAAGG - Intergenic
953122767 3:40061407-40061429 CATGGTCTTGTTCTTTTTTACGG + Intronic
954835396 3:53462597-53462619 AGTGTTCCTGTTATTTATTGTGG + Intergenic
954960478 3:54559918-54559940 CATGGTCTTGTTCTTTTTTATGG + Intronic
958002581 3:87769848-87769870 TCTGCTCCTGTGCTTTTTTGAGG + Intergenic
960823881 3:121762136-121762158 CCTGGTGATGTTCTTTGTTAGGG - Intergenic
961861389 3:129919199-129919221 CCTGGTCCTGCTCTTTATTGGGG - Intergenic
962235636 3:133704801-133704823 CAAGGTCATGTTCTTTAGTGGGG + Intergenic
963477529 3:145825755-145825777 TCTGGTCCTGTGCTTTTTTTCGG + Intergenic
966016621 3:175147413-175147435 CATGGTTTTGTTCTTTTTTGTGG + Intronic
968923545 4:3535139-3535161 CCTGGGCCTGTTCTGTAGTGTGG + Intergenic
971940658 4:33211156-33211178 TCTTGTCCTATTCTTTCTTGGGG + Intergenic
972045953 4:34664471-34664493 CCTGGTCCTGGGCTTTACTGGGG + Intergenic
972385669 4:38563121-38563143 CCTTCCCCTGTTCTGTATTGTGG - Intergenic
973977280 4:56274948-56274970 CATGATCTTGTTCTTTTTTGTGG - Intronic
974154400 4:58052266-58052288 CTTGATCCAGTTCTGTATTGAGG + Intergenic
974339591 4:60598222-60598244 CATGGTCTTGTTCTTTTTTATGG + Intergenic
974572175 4:63667117-63667139 TCTGGTCCTCTGCTTTATTTTGG + Intergenic
974667736 4:64986898-64986920 ACTTGACCTGTTGTTTATTGGGG - Intergenic
974834221 4:67227988-67228010 CATGATCTTGTTCTTTTTTGTGG - Intergenic
975424645 4:74211806-74211828 TCTGGTCCTGTTTTTTTTTTGGG + Intronic
976216649 4:82721394-82721416 CCTGAATCTGTTATTTATTGGGG - Intronic
978178688 4:105766456-105766478 CCTGGTTCTATTCTATATAGCGG - Intronic
978390154 4:108216708-108216730 CATGATCTTGTTCTTTTTTGTGG + Intergenic
979996398 4:127436956-127436978 ACTGATCCTGTTTTTTATTTTGG + Intergenic
982826054 4:160005194-160005216 TCTGGTCCTGGACTTTATTTTGG - Intergenic
983908179 4:173206141-173206163 CCTGGTGCTGGCTTTTATTGAGG + Intronic
985252215 4:188035550-188035572 CCTGCTCCTGTATTTTTTTGTGG + Intergenic
987925214 5:24331986-24332008 CCTTCTACTGTTCTTTAGTGAGG - Intergenic
988075887 5:26353820-26353842 CCAGGACCTGTTATTTATTTTGG + Intergenic
988862623 5:35300430-35300452 CATGATCTTGTTCTTTATTATGG - Intergenic
989378455 5:40790149-40790171 CCTGCTCCTGTTATGTATGGAGG - Intronic
990034531 5:51303931-51303953 CCAGATCCTCTTCTTGATTGAGG + Intergenic
991286760 5:64985946-64985968 CCTGGTCCTGCCCTTGATTATGG - Intronic
992389268 5:76315164-76315186 CCTGGCCATGTTCCTTAATGAGG - Intronic
993186210 5:84623951-84623973 TCTGGTCATGCTCTTTATTCTGG + Intergenic
993765455 5:91850980-91851002 CCTGATCCTGTTCTTCACTGTGG + Intergenic
993770423 5:91918080-91918102 TCTGGTCCAGTTCTTGGTTGTGG + Intergenic
994413081 5:99433973-99433995 CCTGGTGGTGTTGTTTATAGTGG + Intergenic
994480755 5:100331744-100331766 CCTGGTGGTGTTGTTTATAGTGG - Intergenic
995340602 5:111054723-111054745 CCTGGTCCTGGGCTTTTTTTTGG + Intergenic
995994958 5:118286649-118286671 CATGATCTTGTTCTTTTTTGTGG + Intergenic
996626800 5:125579877-125579899 CCTGGCTCTGTTATTTATTATGG + Intergenic
999734323 5:154501361-154501383 CATGGTCTTGTTCTTTACTCTGG + Intergenic
999804108 5:155066206-155066228 CATGGTTTTGTTCTTTCTTGTGG + Intergenic
1001561996 5:172675942-172675964 CCAGGCCCTGTGCTTTTTTGAGG + Intronic
1001633034 5:173190717-173190739 CCTGGTCTGGATCTTAATTGTGG + Intergenic
1002516895 5:179765643-179765665 CCTGCTTCAGTTCTTTATTCAGG - Exonic
1004276710 6:14243107-14243129 CATGATCTTGTTCTTTTTTGTGG - Intergenic
1004312918 6:14561775-14561797 CATGGTCTTGTTCTTTTTTATGG - Intergenic
1004314771 6:14576174-14576196 CATGGTCTTGTTCTTTTTTATGG - Intergenic
1008527454 6:52420598-52420620 CCTGACCCTGTTCTTTATTCTGG + Intronic
1010649433 6:78434025-78434047 CCTGGCCCTGTTCTTCAAAGGGG - Intergenic
1010849875 6:80760302-80760324 CCTGGTGCTGTGTTTTACTGTGG + Intergenic
1011142913 6:84179863-84179885 TCTGGTCCTGTACTTTTTTTTGG - Intronic
1011360897 6:86523495-86523517 CCTGGTCCTGGGTTTTATTTTGG + Intergenic
1011499630 6:87973512-87973534 CATGGTCTTGTTCTTTTTTATGG + Intergenic
1011875751 6:91959121-91959143 TCTGGTCCTGGACTTTTTTGGGG - Intergenic
1013485948 6:110596072-110596094 CCTGGTCCTGTTCTTTTTAATGG + Intergenic
1014323331 6:119960006-119960028 CCAGATGGTGTTCTTTATTGGGG - Intergenic
1014335402 6:120127407-120127429 CATGATCGTGTTCTTTATTTTGG + Intergenic
1014367228 6:120559784-120559806 TCTGGTCCTGGCCTTTTTTGGGG + Intergenic
1015741324 6:136457341-136457363 TCTGGTCCTGAGCTTTTTTGGGG - Intronic
1015882950 6:137887986-137888008 CCTGGTCCTGGGCTTTTTTTTGG + Intergenic
1017569517 6:155729529-155729551 TCTGGTCCTTATCTTGATTGTGG + Intergenic
1017671521 6:156773795-156773817 CTTGGTCCTGTCCTTCATAGGGG - Intergenic
1017709643 6:157155924-157155946 CCAGCCACTGTTCTTTATTGAGG + Intronic
1019772164 7:2890505-2890527 CTTGGTCCTGTTGTCTATGGTGG + Intergenic
1020974856 7:14992245-14992267 CATGATCTTGTTCTTTCTTGTGG - Intergenic
1021014990 7:15521216-15521238 TCTGGTCCTGTGCCTTTTTGCGG - Intronic
1022424028 7:30250706-30250728 CCTGACAGTGTTCTTTATTGAGG + Intergenic
1022856380 7:34318896-34318918 CCTGGTCTTGCTCTTTCATGTGG + Intergenic
1022920044 7:35003927-35003949 CCTGGTCCTTTTCTCTGCTGTGG + Intronic
1024314385 7:48001410-48001432 CATGATCTTGTTCTTTTTTGTGG + Intronic
1026825128 7:73576955-73576977 CCGAGTCCTGTTCTTTTATGGGG - Intronic
1026974937 7:74491651-74491673 CATGATCTTGTTCTTTTTTGTGG + Intronic
1027333402 7:77122703-77122725 CTTGGTCCTGATCCTTATTTAGG - Exonic
1028961937 7:96758773-96758795 CCTGGTCCTGGACTTTCTTTTGG + Intergenic
1029479866 7:100805802-100805824 CCTGGATCTGTTATTTTTTGGGG - Intronic
1029481181 7:100813938-100813960 CCTGGTCCTGGTGGTCATTGTGG - Exonic
1029782392 7:102748611-102748633 CTTGGTCCTGATCCTTATTTAGG + Intergenic
1029907661 7:104107706-104107728 CATGATCCTGTTCTTTTTTATGG + Intergenic
1030166117 7:106557084-106557106 TCTGGTCCTGTTCCTTTTTTTGG + Intergenic
1030225177 7:107142674-107142696 CCTGTTCATGTTCTTTCTGGAGG + Intronic
1030291038 7:107872737-107872759 CCTGCTCCTGTACTCCATTGTGG + Intergenic
1033009652 7:137607106-137607128 CCTTTTCCTGCTCTTTACTGTGG - Intronic
1033629959 7:143147896-143147918 CATGGCCCTGGTCTTTACTGGGG + Intergenic
1035763967 8:2090792-2090814 CGTGGTCTTGTTCTTTTTTATGG + Intronic
1038053437 8:23834962-23834984 CATGGTCTTGTTCTTTTTTATGG + Intergenic
1038580299 8:28742672-28742694 CATGGTTCTGTGATTTATTGAGG + Intronic
1039398818 8:37250214-37250236 CCTTGTCTTGTTCTTGATTTTGG - Intergenic
1041353845 8:56978711-56978733 CCTGATCATGTTCTTTTTTATGG - Intronic
1042786518 8:72552733-72552755 ACTGGCACTGTTCTTTATTGAGG + Intronic
1043227714 8:77752820-77752842 CATGATCTTGTTCTTTATTATGG - Intergenic
1043642119 8:82467461-82467483 TCTGGTCCTGGACTTTTTTGTGG - Intergenic
1043868952 8:85408139-85408161 CCTTGTCCTGTTCCTGATTCTGG - Intronic
1044191490 8:89324008-89324030 CCTTGTCCTGTGGTTTATGGTGG - Intergenic
1044268168 8:90207695-90207717 TCTGGTCCTGTGCTTTTTTTTGG - Intergenic
1046523627 8:115357084-115357106 CCTCGTCCTGCTCTCTAGTGGGG - Intergenic
1048229802 8:132627638-132627660 CCTGGCCCTGTTCCAGATTGGGG + Intronic
1048436057 8:134418982-134419004 CGTGATCTTGTTCTTTTTTGTGG - Intergenic
1053799256 9:41754163-41754185 CCTGGGCCTGTTCTGTAGTGTGG + Intergenic
1054145956 9:61560836-61560858 CCTGGGCCTGTTCTGTAGAGTGG - Intergenic
1054187666 9:61966222-61966244 CCTGGGCCTGTTCTGTAGTGTGG + Intergenic
1054465695 9:65491914-65491936 CCTGGGCCTGTTCTGTAGTGTGG - Intergenic
1054650850 9:67622359-67622381 CCTGGGCCTGTTCTGTAGTGTGG - Intergenic
1056085350 9:83143393-83143415 CCTTTTCCTGTTTTTTAATGGGG - Intergenic
1056756926 9:89387480-89387502 CCTGGGCCTGTTGTCTATTGGGG + Exonic
1058811631 9:108645069-108645091 CCTAGTCCCTTTCTTCATTGTGG + Intergenic
1059094652 9:111399709-111399731 CCTGGTCCTTTGTTTTATTGTGG - Intronic
1059757306 9:117305450-117305472 CCTGGCCCTGTGCTATATTGGGG - Intronic
1059855487 9:118392776-118392798 CCTTGTGCTGCCCTTTATTGTGG + Intergenic
1059912610 9:119062589-119062611 CATGATCCTGTTCTTTTTTATGG + Intergenic
1060048917 9:120362941-120362963 CCTGGTCCTGCCCTTGATTATGG + Intergenic
1061471809 9:130833116-130833138 CCTTGTGCTGTTCTTTATATTGG - Intronic
1062519479 9:136951764-136951786 CCTGGTCCTGTTCTTGCTCCAGG + Intronic
1062660072 9:137625750-137625772 CTTGGTCTTGTTCTATTTTGGGG + Intronic
1186703706 X:12119157-12119179 CTTGGTCCTGTTCTTTCAAGGGG + Intergenic
1188164036 X:26839175-26839197 TCTGGTCCTGGGCTTTATTTTGG - Intergenic
1190924738 X:54893173-54893195 CATGGTCTTGTTCTTTTTTCTGG - Intergenic
1191209139 X:57866662-57866684 CCTGGTCCTGGACTTTTTTTTGG - Intergenic
1191950638 X:66587897-66587919 TCTGGTCCTGGGCTTTATTTTGG + Intergenic
1192923347 X:75730858-75730880 TCTGGTCCTGGGCTTTTTTGTGG + Intergenic
1193099898 X:77598100-77598122 CATGATTTTGTTCTTTATTGTGG - Intronic
1193264455 X:79452407-79452429 CCTGGTGCTGGGCTTTTTTGTGG - Intergenic
1193267433 X:79488733-79488755 CATGGTCTTGTTCTTTTTTATGG + Intergenic
1193324111 X:80159306-80159328 CGTGATCTTGTTCTTTTTTGTGG - Intergenic
1193733979 X:85134992-85135014 CATGATCTTGTTCTTTTTTGTGG - Intergenic
1194344407 X:92745361-92745383 CATGATCTTGTTCTTTATTGTGG + Intergenic
1194689178 X:96961211-96961233 CCTGGGGCTTTTCTTTACTGGGG + Intronic
1194723773 X:97371074-97371096 CTTTGTCCTCTTCTTTTTTGGGG + Intronic
1194891306 X:99383578-99383600 CATGGTCTTGTTCTTTTTTATGG - Intergenic
1195742801 X:108082231-108082253 CCTGGTGCTTTTCTTTAATTTGG - Intergenic
1195783560 X:108490974-108490996 CATGATCTTGTTCTTTATTATGG + Intronic
1195843937 X:109205928-109205950 TCTGGTCCTGGGCTTTTTTGGGG + Intergenic
1197015956 X:121626643-121626665 CCTGGTCCTCTATTCTATTGTGG - Intergenic
1197970121 X:132106689-132106711 CATGATCCTGTTCTTTTTTATGG - Intronic
1199089084 X:143670402-143670424 CATGGTCATGTTATTTATTGTGG - Intergenic
1200652752 Y:5862002-5862024 CATGATCTTGTTCTTTATTGTGG + Intergenic
1201765595 Y:17571152-17571174 CCTAGGCCTTTTCTTTAGTGGGG - Intergenic
1201835957 Y:18334837-18334859 CCTAGGCCTTTTCTTTAGTGGGG + Intergenic
1202174951 Y:22089568-22089590 CCTGGTCCTGGGCTTTTTTTTGG - Intronic
1202216411 Y:22496815-22496837 CCTGGTCCTGGGCTTTTTTTTGG + Intronic
1202326775 Y:23699249-23699271 CCTGGTCCTGGGCTTTTTTTTGG - Intergenic
1202543994 Y:25970803-25970825 CCTGGTCCTGGGCTTTTTTTTGG + Intergenic