ID: 950055024

View in Genome Browser
Species Human (GRCh38)
Location 3:10017579-10017601
Sequence TCATGGTGCTCTCTACCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950055024_950055026 -6 Left 950055024 3:10017579-10017601 CCAGAAGGTAGAGAGCACCATGA No data
Right 950055026 3:10017596-10017618 CCATGAAAGTACAGCCTGTGAGG 0: 1
1: 1
2: 2
3: 11
4: 135
950055024_950055031 10 Left 950055024 3:10017579-10017601 CCAGAAGGTAGAGAGCACCATGA No data
Right 950055031 3:10017612-10017634 TGTGAGGCCGGACTGCTGAGGGG 0: 1
1: 0
2: 0
3: 19
4: 156
950055024_950055027 -2 Left 950055024 3:10017579-10017601 CCAGAAGGTAGAGAGCACCATGA No data
Right 950055027 3:10017600-10017622 GAAAGTACAGCCTGTGAGGCCGG 0: 1
1: 0
2: 4
3: 24
4: 255
950055024_950055029 8 Left 950055024 3:10017579-10017601 CCAGAAGGTAGAGAGCACCATGA No data
Right 950055029 3:10017610-10017632 CCTGTGAGGCCGGACTGCTGAGG 0: 1
1: 0
2: 0
3: 17
4: 194
950055024_950055030 9 Left 950055024 3:10017579-10017601 CCAGAAGGTAGAGAGCACCATGA No data
Right 950055030 3:10017611-10017633 CTGTGAGGCCGGACTGCTGAGGG 0: 1
1: 0
2: 0
3: 16
4: 147
950055024_950055033 28 Left 950055024 3:10017579-10017601 CCAGAAGGTAGAGAGCACCATGA No data
Right 950055033 3:10017630-10017652 AGGGGCAGACTTCATGCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950055024 Original CRISPR TCATGGTGCTCTCTACCTTC TGG (reversed) Intergenic
No off target data available for this crispr