ID: 950056204

View in Genome Browser
Species Human (GRCh38)
Location 3:10026672-10026694
Sequence GTTCATCGGGAAGCGGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 1, 2: 2, 3: 2, 4: 63}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950056204_950056211 -7 Left 950056204 3:10026672-10026694 CCCTCACCCGCTTCCCGATGAAC 0: 1
1: 1
2: 2
3: 2
4: 63
Right 950056211 3:10026688-10026710 GATGAACTAATCCAGGCAGTCGG 0: 1
1: 1
2: 0
3: 12
4: 186
950056204_950056216 23 Left 950056204 3:10026672-10026694 CCCTCACCCGCTTCCCGATGAAC 0: 1
1: 1
2: 2
3: 2
4: 63
Right 950056216 3:10026718-10026740 TCACTTCTGTTGGGCTTTTCTGG 0: 1
1: 0
2: 1
3: 9
4: 249
950056204_950056213 13 Left 950056204 3:10026672-10026694 CCCTCACCCGCTTCCCGATGAAC 0: 1
1: 1
2: 2
3: 2
4: 63
Right 950056213 3:10026708-10026730 CGGCCTCATCTCACTTCTGTTGG 0: 1
1: 2
2: 0
3: 14
4: 120
950056204_950056214 14 Left 950056204 3:10026672-10026694 CCCTCACCCGCTTCCCGATGAAC 0: 1
1: 1
2: 2
3: 2
4: 63
Right 950056214 3:10026709-10026731 GGCCTCATCTCACTTCTGTTGGG 0: 1
1: 1
2: 1
3: 22
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950056204 Original CRISPR GTTCATCGGGAAGCGGGTGA GGG (reversed) Intronic
912448923 1:109758001-109758023 GTTCATGGGAAAGCTGGAGAAGG - Exonic
913124482 1:115772475-115772497 GTTCAGCGGGGAGAGGGAGAAGG - Intergenic
924168014 1:241305662-241305684 GTTCATCAGGAAAAGGGTGGGGG - Intronic
1065177182 10:23089709-23089731 CTTCATAGGGAAGAGGGCGATGG + Intergenic
1065957151 10:30703961-30703983 TTTCATGGGGAAGGGGGTGTGGG - Intergenic
1067729749 10:48801792-48801814 GTTTATCGGGAGGCCTGTGAAGG - Intronic
1071333689 10:84585070-84585092 GTTCTTGGGGAATCTGGTGAAGG + Intergenic
1071893871 10:90042370-90042392 GTTGATATGGAAGCGGGTGCAGG - Intergenic
1074706479 10:116137478-116137500 ATTAATTGGGAAGCAGGTGAAGG - Intronic
1081728852 11:45354387-45354409 GATCATTGGGAAGCAGGTGGCGG - Intergenic
1101259463 12:103013600-103013622 GTGGGGCGGGAAGCGGGTGAGGG + Intergenic
1102485092 12:113250121-113250143 GTTAATCGGGAGGTGGGAGAGGG + Intronic
1103705956 12:122872580-122872602 GTGGGTGGGGAAGCGGGTGACGG - Intronic
1113482923 13:110634816-110634838 GTTCGTCCTGAAGAGGGTGAAGG + Intronic
1121633751 14:95439877-95439899 CTTCTTTGGGAAGTGGGTGAGGG + Intronic
1121652599 14:95570451-95570473 GTTCATCGGGAAGAGGAAGCTGG - Intergenic
1123995269 15:25713737-25713759 TCTCATCGGTAAGCGGGTGCCGG + Exonic
1128426042 15:67543089-67543111 GTGCACCGGGAAGCGGGCAAAGG - Exonic
1134857327 16:17531280-17531302 GTACATGGGGAGGGGGGTGAGGG - Intergenic
1136279860 16:29201900-29201922 GTTCATCGCGAAGCGGGTGGAGG - Intergenic
1142084252 16:88168008-88168030 GTTCATCGCGAAGCGGGTGGAGG - Intergenic
1143757610 17:9078410-9078432 GTACATCTGGGAGCAGGTGAGGG + Intronic
1149867263 17:60157798-60157820 GTTCCCCGGGAAGTGGGGGATGG - Intronic
1150595869 17:66604037-66604059 CTTCAGTGGGAAGCGGGGGAAGG - Intronic
1152234454 17:79131383-79131405 GTTCAGCTGGAAGACGGTGAAGG - Intronic
1155922217 18:31614652-31614674 TGTCATGGGGAAGCTGGTGAAGG + Intergenic
1160312866 18:77812184-77812206 GTTGATCAGGAAGCGGGAGCGGG + Intergenic
1161992118 19:7690065-7690087 CTGCATCGGAAAGCGGATGAGGG - Intronic
1162144423 19:8605177-8605199 GTTCAGCAGGAAGTGGGTGCTGG + Exonic
1166352256 19:42204971-42204993 CTCCATCAGGAAGCAGGTGATGG - Intronic
1168459484 19:56541450-56541472 GCTCATCGGGAAGGGGCTGTGGG - Intronic
925972951 2:9120273-9120295 TTTCATCTGGATGTGGGTGAAGG - Intergenic
933649533 2:84839200-84839222 GAGAATAGGGAAGCGGGTGAAGG - Exonic
946240783 2:218354218-218354240 GATCATCGGCAAGCCTGTGATGG + Intergenic
1172022768 20:31925922-31925944 GTTCAGTGTGAAGCGGGTGTTGG - Intronic
1172106614 20:32520866-32520888 GCTCATCAGGAACCGGGTCACGG + Intronic
1173743097 20:45416328-45416350 CTTCAGCGGGAAGGAGGTGAGGG + Exonic
1184217456 22:43077189-43077211 GTACCTGGGGAAGCAGGTGAGGG - Intronic
1184259657 22:43307318-43307340 GTTCATCAGGAGGCTGGGGAAGG + Intronic
1184676464 22:46045734-46045756 GTTCCTTGGGGAGCAGGTGAGGG + Intergenic
950050815 3:9987464-9987486 GTTCATCGGGAAGGGGGTGAGGG - Intronic
950056204 3:10026672-10026694 GTTCATCGGGAAGCGGGTGAGGG - Intronic
950586510 3:13895924-13895946 GTTCACCTGGGAGCGGGTGGGGG + Intergenic
954248319 3:49349130-49349152 CTTCATAGGGAAGCAAGTGAAGG - Intergenic
958161758 3:89825548-89825570 GTTCATTTGGAAACTGGTGAAGG + Intergenic
975476977 4:74834648-74834670 GTTCATTGGGAAGCTGGTGGAGG + Intergenic
976718392 4:88147161-88147183 TTTCATAGGGAAGCCTGTGAGGG - Intronic
977932672 4:102765567-102765589 GTTCATCAGCAATCGGTTGAAGG + Intergenic
978744925 4:112182114-112182136 GGTCATGGGGAAGAGGGAGAGGG + Intronic
979763421 4:124435860-124435882 GTACACTGGGAAGCTGGTGAGGG - Intergenic
982085360 4:151830069-151830091 GTTGTTCGGGATGCGGCTGATGG + Intergenic
998641311 5:144014453-144014475 GTTCCTCGGGAAGCGACTGAGGG + Intergenic
998919278 5:147049917-147049939 GGTGATGGGGCAGCGGGTGAAGG + Intronic
999347426 5:150836597-150836619 TTTCCTCGGGAAGAGGGGGAAGG + Intergenic
1005288942 6:24359824-24359846 GATCATCGGGGAGGGGGTTAGGG - Intergenic
1007289255 6:40772820-40772842 TTTCATAGGGAAGAGGGAGAGGG - Intergenic
1024351438 7:48369226-48369248 TTTCATCAAAAAGCGGGTGAAGG - Intronic
1025839387 7:65130379-65130401 GCTCATCGGCAAACAGGTGAAGG - Intergenic
1025883681 7:65565586-65565608 GCTCATCGGCAAACAGGTGAAGG + Intergenic
1025889765 7:65637020-65637042 GCTCATCGGCAAACAGGTGAAGG - Intergenic
1029361970 7:100094354-100094376 GTTCATGGGGAAGCAGAAGAGGG + Intronic
1034491748 7:151396524-151396546 GAGCAGCGGGAAGCGGGTGGGGG + Intronic
1034986143 7:155516673-155516695 GCTGACCGGGAAGCTGGTGATGG + Intronic
1039564505 8:38541060-38541082 CTTCATAGGGAAGAGGGAGATGG + Intergenic
1046453994 8:114435311-114435333 GTGCATCAGGAAGCAGCTGAAGG + Intergenic
1049199297 8:141332043-141332065 GGTCACCAGGAAGCAGGTGAAGG - Intergenic
1049936610 9:505556-505578 GTTCCACGGGACCCGGGTGAAGG - Intronic
1053202242 9:36160676-36160698 GTGCATTGGGGAGCGAGTGAAGG + Intronic
1056469803 9:86894357-86894379 GCGCATCTGGAAGCTGGTGAGGG - Intergenic