ID: 950056814

View in Genome Browser
Species Human (GRCh38)
Location 3:10031697-10031719
Sequence AAGGGTAGACAGAATGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 567
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 527}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950056814_950056821 16 Left 950056814 3:10031697-10031719 CCTTCCCCATTCTGTCTACCCTT 0: 1
1: 0
2: 4
3: 35
4: 527
Right 950056821 3:10031736-10031758 TCTCAAATTTGGTGTGTATCAGG 0: 1
1: 0
2: 1
3: 27
4: 237
950056814_950056820 5 Left 950056814 3:10031697-10031719 CCTTCCCCATTCTGTCTACCCTT 0: 1
1: 0
2: 4
3: 35
4: 527
Right 950056820 3:10031725-10031747 AGATCATTGAGTCTCAAATTTGG 0: 1
1: 0
2: 3
3: 31
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950056814 Original CRISPR AAGGGTAGACAGAATGGGGA AGG (reversed) Intronic
900602074 1:3507039-3507061 AAGGGCAGACAAAGTGGGGAAGG + Intronic
901186357 1:7375869-7375891 CAGGGTGGACAGAAGGGGGCAGG + Intronic
901834343 1:11914169-11914191 AAGGGTAGCCAGTCTGAGGATGG + Intergenic
902006481 1:13236370-13236392 AAGGGGAGTTAGAAAGGGGATGG + Intergenic
902025534 1:13380755-13380777 AAGGGGAGTTAGAAAGGGGATGG + Intergenic
902421665 1:16285560-16285582 ATGGGAAGACAGGATGGGCATGG - Intronic
902468741 1:16633353-16633375 AAGAGAACACAGGATGGGGATGG + Intergenic
902513088 1:16976640-16976662 CAGGGTTGACAGGGTGGGGAGGG + Intronic
902997240 1:20236069-20236091 AAGGGAAGACAGAATTGGGGTGG - Intergenic
903207296 1:21792192-21792214 GGGGCTAGACAGAATGAGGATGG - Intergenic
903762271 1:25706997-25707019 CAGAAGAGACAGAATGGGGAGGG + Intronic
904031029 1:27533500-27533522 CAGGGTAGACAGAAAGGGGAGGG + Intergenic
904128685 1:28260103-28260125 GAGGGGAGACAGAGTGGGGGAGG - Intronic
905234763 1:36538330-36538352 AAGGAAGGACAGGATGGGGATGG + Intergenic
905264403 1:36741056-36741078 GAGGGAAGAGGGAATGGGGAGGG - Intergenic
905916334 1:41687003-41687025 AAGGGAACACGGAATGGGGGTGG + Intronic
906139411 1:43524855-43524877 AGGTGTAAAGAGAATGGGGAGGG + Intergenic
906153695 1:43602027-43602049 AAAGGGAGACAGGATGGTGAAGG - Intronic
906255689 1:44348184-44348206 TAGGGAGGACAGAATGGGGTGGG - Intronic
906334890 1:44920528-44920550 AAGGGTAGAGAGTGTGGGGGTGG - Intronic
906523051 1:46478583-46478605 AAGGCTAGACTTGATGGGGAGGG + Intergenic
906536160 1:46552092-46552114 AGAGGTGGACAGGATGGGGATGG - Intergenic
906953205 1:50350783-50350805 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
907289999 1:53407505-53407527 AAGGCTAGAGAGGATGAGGATGG + Intergenic
907330289 1:53666581-53666603 AAGAGTGGGCAGAGTGGGGATGG - Intronic
908182391 1:61618883-61618905 ATGGGCAGGCAGAAGGGGGAGGG + Intergenic
908988654 1:70057464-70057486 TAGGCTAGACATAATGGGAATGG + Intronic
910105517 1:83627603-83627625 ATGGGTATAGAGAAAGGGGAAGG + Intergenic
911054167 1:93696576-93696598 CATGGAAGACAGAATGGAGAAGG - Intronic
911310701 1:96289065-96289087 AATGGCAGTCAGAAGGGGGATGG + Intergenic
911496937 1:98643244-98643266 AAGGGAATGCAGAATGGGTATGG + Intergenic
911720633 1:101187467-101187489 AAGAGTAAACAAAATGTGGAAGG + Intergenic
911764448 1:101657004-101657026 ATGGGGAGCCAGAAAGGGGATGG + Intergenic
912171177 1:107101270-107101292 AGGGGAAGAGAAAATGGGGATGG + Intergenic
912207444 1:107524090-107524112 AAAAGAAGACAGAAGGGGGAAGG - Intergenic
912586651 1:110772580-110772602 AAGGTTATACTGAATGGGGGAGG - Intergenic
912631001 1:111246768-111246790 ATGGGTAGTAAGACTGGGGAAGG + Intergenic
913508794 1:119543787-119543809 CAGAGTAGACTGAATGTGGAGGG - Intergenic
913511903 1:119569755-119569777 CAGAGTAGACTGAATGTGGAGGG - Intergenic
913516136 1:119607069-119607091 CAGAGTAGACTGAATGTGGAGGG - Intergenic
914235477 1:145806660-145806682 AAGGCAAGAGAGAAAGGGGAGGG - Intronic
914774212 1:150721022-150721044 AAAGCCAGACAGAAGGGGGAAGG + Intergenic
914998829 1:152568621-152568643 AACAGTATACAGAAGGGGGAGGG - Intronic
916979721 1:170120871-170120893 AAGGGTAGACAGAGTTGGGGTGG - Intergenic
918077340 1:181180685-181180707 CAGGGCAGAAACAATGGGGAAGG - Intergenic
918128707 1:181606464-181606486 CAGGGTAGATGTAATGGGGAGGG - Intronic
918144267 1:181742036-181742058 AAGGGGAGAGGGAATGGGCATGG - Intronic
918543656 1:185658612-185658634 CATGGTAGACAGAATGAGGGTGG - Intergenic
918720190 1:187842551-187842573 ACAGGTAGAAAGAATGTGGAGGG + Intergenic
919011050 1:191963546-191963568 AAGGGTAAATAGAAAGGGAAAGG - Intergenic
919110888 1:193217436-193217458 TAGGGGAGCCAGAAAGGGGATGG + Intronic
919199891 1:194342756-194342778 ATCGGGAGACAGAAGGGGGATGG - Intergenic
919743918 1:200996762-200996784 AAGAGAAGACAGAATGGTGTGGG + Intronic
919845922 1:201642099-201642121 AAGGGAAGAAAGAAAGAGGAAGG - Intronic
920255611 1:204652219-204652241 AAGGGGAGAGAGGAGGGGGAAGG - Intronic
920394850 1:205637471-205637493 AAGTGTACACACAGTGGGGAGGG - Intergenic
920416964 1:205805396-205805418 AGGAGTAGACAGGATGGGCAGGG + Intronic
920756452 1:208738385-208738407 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
921221714 1:212978371-212978393 ATGGGGAGAAAGACTGGGGAAGG + Intronic
921862151 1:220051316-220051338 AAGGAAAGACAGAATGGTAAAGG + Intergenic
921863957 1:220068991-220069013 TAGGGGAGAGTGAATGGGGAGGG + Intronic
921912147 1:220561142-220561164 AATGGTAGTGAGAATGGGAAGGG + Intronic
922092609 1:222411125-222411147 AAGGGTAAACAGTATATGGATGG + Intergenic
922775876 1:228213983-228214005 AAGGGGAGACGGAGTGGGCAGGG + Intronic
923252676 1:232191852-232191874 AGGGGAAGCCAGAAGGGGGATGG - Intergenic
924011757 1:239672639-239672661 TAGGGGAGAAAGAATGGGAAAGG + Intronic
924457095 1:244227572-244227594 AAGGGTAGACAGATTGCTAAAGG + Intergenic
1063878464 10:10506520-10506542 AAGGGAAAACAGATTGGGGTAGG - Intergenic
1064096731 10:12429325-12429347 AAAGAGAGAGAGAATGGGGAAGG - Intronic
1064497580 10:15929651-15929673 ATGTGTTGACAGAATTGGGAAGG - Intergenic
1064825871 10:19400037-19400059 AAGGGTGAAAAGAATTGGGAAGG - Intronic
1064921151 10:20519932-20519954 AAGGGTAGAAAGGAGGGGAAGGG - Intergenic
1065701871 10:28433639-28433661 AAGGATAGACAGAATCGTTATGG + Intergenic
1066122957 10:32309133-32309155 AGGGGTAGAAAAAGTGGGGATGG + Intronic
1067362265 10:45593946-45593968 AAGGGTAGTTAGCGTGGGGATGG + Intronic
1068062471 10:52086183-52086205 CAGGGTGGAAAGGATGGGGAGGG - Intronic
1068523836 10:58106034-58106056 ATGGGTAGACAGGCTGGGCAGGG + Intergenic
1068876462 10:62001665-62001687 AAGGGAAGACAGAGAGAGGAAGG + Intronic
1069589556 10:69633334-69633356 AAGGATTGAGAGAATTGGGAAGG - Exonic
1069694661 10:70377670-70377692 AAGGGCAGAGAGAAGGGGCATGG + Intronic
1069895582 10:71678462-71678484 TGGGGTAGGCAGCATGGGGAAGG - Intronic
1069987326 10:72293308-72293330 AAGAGGAAGCAGAATGGGGAGGG - Intergenic
1070068118 10:73058154-73058176 AAGGGAAAAAAGAAAGGGGATGG + Intronic
1070363845 10:75716997-75717019 ATGGGGAGAGAGAAAGGGGATGG - Intronic
1070760945 10:79024098-79024120 AAGGGTAGACAGAGGGGGGGGGG + Intergenic
1070763522 10:79042435-79042457 AAGGGAAGAGAGAGAGGGGAAGG + Intergenic
1071031191 10:81183290-81183312 AAAGGAATACAGGATGGGGAGGG + Intergenic
1071038763 10:81280949-81280971 CAGGGGAGACAGTAGGGGGATGG + Intergenic
1071647338 10:87367069-87367091 GAGGGTGGCCTGAATGGGGAGGG + Exonic
1071893797 10:90041989-90042011 GATGGGAGCCAGAATGGGGATGG + Intergenic
1072532372 10:96331505-96331527 AAAGCAAGACAGAGTGGGGAGGG + Intronic
1073054773 10:100692310-100692332 AATGGTTGACAGCAAGGGGAAGG - Intergenic
1073115248 10:101088052-101088074 AGGGGGAGACGGAATGGGGGAGG + Intergenic
1074498847 10:114004195-114004217 AAGAGAAGACAGGATGGAGAAGG - Intergenic
1074508913 10:114095441-114095463 AAGGGTAACCAAAATGGGCAGGG + Intergenic
1074565028 10:114569745-114569767 CAGGGTAGCAAGAATGGTGAAGG + Intronic
1075284483 10:121171785-121171807 AAGGGAAGGCAGAAGGGGAAGGG + Intergenic
1075655276 10:124156942-124156964 CCGGGCACACAGAATGGGGAAGG + Intergenic
1077391338 11:2301962-2301984 AAGGGCAGGCAGGAAGGGGAGGG - Intronic
1077461579 11:2713485-2713507 AAGTGAAGAAATAATGGGGATGG - Intronic
1079224073 11:18589812-18589834 AAGGGTAGGGAGATTGGGGTAGG + Intergenic
1081783137 11:45727358-45727380 GAGGGTAGCCACAGTGGGGAGGG + Intergenic
1081993081 11:47347915-47347937 AAGGGTGGAGAGATGGGGGAAGG + Intronic
1082171932 11:49015387-49015409 AAAGGTGGAGAGAATGGAGATGG - Intergenic
1082710365 11:56547301-56547323 ATGGGGAGCCAGAAAGGGGACGG - Intergenic
1083467436 11:62857837-62857859 AAGGGTAGAAAGACTTGGGAGGG + Intronic
1083569154 11:63747426-63747448 AAGGAGAGAAAGAATTGGGAGGG - Intronic
1083761648 11:64821946-64821968 AAGGCTGGGCTGAATGGGGAAGG - Intergenic
1084557860 11:69885629-69885651 TGGGGAAGGCAGAATGGGGAGGG + Intergenic
1084557879 11:69885685-69885707 TGGGGAAGGCAGAATGGGGAGGG + Intergenic
1084741240 11:71140765-71140787 AAGTGTAGAGTGAATGGCGAGGG + Intronic
1086693837 11:89820567-89820589 AAAGGTGGAGAGAATGGAGATGG + Intergenic
1086712309 11:90024002-90024024 AAAGGTGGAGAGAATGGAGATGG - Intergenic
1087033347 11:93728971-93728993 AATGGTTGACAGAATAGTGAAGG - Intronic
1089001302 11:115054502-115054524 AAGGAAAGAGAGAGTGGGGAGGG + Intergenic
1089418936 11:118316453-118316475 AAGGGAAGAAAGAAAGAGGATGG + Intergenic
1089500743 11:118929899-118929921 AAGGGTAGCCAAAAAGTGGAGGG - Intronic
1090550663 11:127816243-127816265 AAGGGTACAGATTATGGGGAAGG - Intergenic
1090800451 11:130168202-130168224 AAGAGCAAACAGAATGAGGAAGG + Intronic
1091192442 11:133706889-133706911 AAGGGGGGACAGAAAGGGAACGG + Intergenic
1091371483 11:135063731-135063753 AAGGAAAGAGAGAGTGGGGAGGG + Intergenic
1091526713 12:1309596-1309618 AAAGGGAGAGAGAAGGGGGAAGG - Intronic
1091820191 12:3470462-3470484 CATGGTAGACAGCCTGGGGAAGG - Intronic
1091918984 12:4289481-4289503 AAGGGAAGAGAGAGCGGGGAGGG - Intronic
1091935036 12:4428236-4428258 AAGGGGCGAGAGAGTGGGGATGG + Intronic
1092167606 12:6352597-6352619 CAGGGTATACAGAACTGGGATGG - Intronic
1092826132 12:12400717-12400739 AAGGATATAAAGGATGGGGAGGG - Intronic
1093017652 12:14170979-14171001 AAGGGTAAAGGGAAGGGGGAGGG + Intergenic
1093769644 12:23003665-23003687 AAAGGTGGACAGCCTGGGGAGGG - Intergenic
1094070187 12:26404197-26404219 AACTGTAGGCAGAAGGGGGAAGG + Intronic
1095201106 12:39385276-39385298 AAGGGCAGAGAAAATAGGGAAGG + Intronic
1096194912 12:49643480-49643502 GAGGGTAGACTGGATTGGGAGGG + Exonic
1098362296 12:69666560-69666582 AAGGGTAGTCAGAGTAGGAATGG - Intronic
1099479724 12:83150698-83150720 AAGGGTAGAAGAATTGGGGATGG + Intergenic
1099653284 12:85456736-85456758 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1099708065 12:86182482-86182504 CAGGCAAGACAGAATGGGAAAGG - Intronic
1100012619 12:89971935-89971957 AAGGCCAGCCTGAATGGGGATGG - Intergenic
1100402521 12:94244902-94244924 AGGGGAAGAAAGAATGGGGAAGG - Intronic
1100452742 12:94722983-94723005 AAGGATAGATTGAGTGGGGAGGG - Intergenic
1101702999 12:107193143-107193165 AGGGGTAGACATAATTGGGAGGG + Intergenic
1101828178 12:108236953-108236975 GAGGGGAGACAGAAGAGGGAAGG + Intronic
1101910122 12:108855324-108855346 AAGGTTAGGGAGAATGGGGCAGG + Intronic
1102615770 12:114152750-114152772 AAGGGAAGACAGAAGGGCTAGGG + Intergenic
1102786118 12:115606349-115606371 AAGGGGAGAGAGGAGGGGGATGG + Intergenic
1103251845 12:119506633-119506655 AAGGGAAGGGGGAATGGGGAAGG + Intronic
1103800958 12:123536874-123536896 AAAGGAAGAAAGAAAGGGGAGGG - Intergenic
1104232519 12:126898794-126898816 AGGAGGAGAAAGAATGGGGAAGG + Intergenic
1104842583 12:131832000-131832022 AAGGCTGGAGAGGATGGGGAGGG + Intronic
1105015912 12:132786824-132786846 AAGGGGAGACAGGCTGGGGGTGG - Intronic
1105734208 13:23251087-23251109 AAGAGAAGAAAGAACGGGGAGGG - Intronic
1105898978 13:24740841-24740863 TAGGGTAACCAGAATGGGGGCGG + Intergenic
1105947642 13:25203132-25203154 GAGGGATGGCAGAATGGGGAGGG + Intergenic
1106189630 13:27439762-27439784 AAGGGAAGAGATAATGGGCAGGG + Intronic
1107688401 13:42927285-42927307 AAGGGTAGGCAGAATGGGCCAGG - Intronic
1107766612 13:43742072-43742094 AAGAATAGACAAAATGGGCAAGG + Intronic
1107966702 13:45603974-45603996 AAGGGTGGAAGGAATGGGAAAGG - Intronic
1108148094 13:47500976-47500998 AAGGGCAGACAGAATGAGAAGGG - Intergenic
1108645439 13:52422545-52422567 AAGGGTAGAGACTAGGGGGAGGG - Intronic
1109066175 13:57695470-57695492 AAGGAAAGACAGAATGGTGGGGG + Intronic
1109201707 13:59438583-59438605 AATGGTAGTCAAAATGTGGAAGG - Intergenic
1111206720 13:85020445-85020467 ATGGGTAGCCAGAAGGAGGAGGG - Intergenic
1111413810 13:87912463-87912485 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1111497852 13:89076566-89076588 AGGGGGAGACAAAGTGGGGATGG - Intergenic
1112009179 13:95279777-95279799 AAGAGAAGGCAGAAAGGGGATGG + Intronic
1112837996 13:103539581-103539603 TAGGTTAGACAGAAAGGGGAGGG + Intergenic
1112929240 13:104714023-104714045 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1113510020 13:110846476-110846498 AAGGCTTGACAGGGTGGGGAAGG + Intergenic
1113697218 13:112354922-112354944 GAAGGGAGACAGAAGGGGGAGGG + Intergenic
1113869721 13:113551804-113551826 AGGGGCAGACATGATGGGGATGG - Intronic
1114996939 14:28365485-28365507 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1115353685 14:32424644-32424666 GAGGGTAGAGAGTAGGGGGAGGG - Intronic
1116019116 14:39440443-39440465 AGGGGAAGAGAGAATGGAGAAGG + Intergenic
1116809085 14:49522238-49522260 AGGAAGAGACAGAATGGGGAAGG - Intergenic
1116898584 14:50340507-50340529 AAGGGTAGAGAGAAAGGAAAGGG + Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1118277092 14:64394891-64394913 GAAGGTAGAAAGAATGGGGAAGG - Intronic
1118509354 14:66453958-66453980 GAGGGTAGAGAGCAAGGGGAGGG + Intergenic
1120024467 14:79567385-79567407 AATGGGAAACAAAATGGGGAAGG + Intronic
1120280463 14:82431747-82431769 ATGGGAAGGCAGAAGGGGGATGG + Intergenic
1120491152 14:85180126-85180148 AAGGGGAGCTAGAAAGGGGATGG - Intergenic
1120522739 14:85543728-85543750 AATGGTAAACAGCATGGGAAAGG - Intronic
1121098366 14:91233498-91233520 AAGGGAAGACTGGAGGGGGAAGG - Exonic
1121814798 14:96920999-96921021 AAACGTAGACAAAATGGGGCAGG + Intronic
1122120848 14:99552672-99552694 AAGTGGTGACAGGATGGGGAGGG - Intronic
1122227336 14:100287365-100287387 AAGGGCAGAGAGAAGGGGGCAGG - Intergenic
1122302049 14:100736939-100736961 AAGGGTGGGGAGAATGGGAAGGG - Exonic
1122721709 14:103725972-103725994 AAAGGTAGACAGAAACAGGAAGG - Intronic
1124698373 15:31887670-31887692 ATGAGTAGACAGAAGGGGGATGG + Intergenic
1125037962 15:35149065-35149087 AAGGGAGGAGAGAAGGGGGATGG - Intergenic
1125225502 15:37390734-37390756 CAGGAAAGACAGAATGAGGAGGG + Intergenic
1127136182 15:55926448-55926470 AAGGCTAGACAACATGGGGAGGG + Intronic
1128631365 15:69271572-69271594 GAGCTTAGAGAGAATGGGGAGGG + Exonic
1130073751 15:80671052-80671074 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1130139170 15:81209264-81209286 GAGGGCAGACAGTGTGGGGAGGG + Intronic
1130141391 15:81229268-81229290 GAGGGCAGACAGTGTGGGGAGGG + Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130430439 15:83842031-83842053 ATGGGGAGGCAGAAGGGGGATGG - Intronic
1130430447 15:83842050-83842072 ATGGGAAGGCAGAAGGGGGATGG - Intronic
1131449289 15:92525872-92525894 AAGGGAGGAAAGAAGGGGGAAGG - Intergenic
1131569683 15:93522121-93522143 CAGAGTAGACAGAAAGGGGCTGG - Intergenic
1131581962 15:93652153-93652175 GAGGGAAGAGGGAATGGGGAGGG - Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1133865313 16:9636713-9636735 CAGGGGAGAGAGAAAGGGGAGGG + Intergenic
1134313390 16:13096534-13096556 AAGTGTAGAGAAGATGGGGAAGG + Intronic
1134770544 16:16805518-16805540 AAGGGAAGACAGAATGATTATGG + Intergenic
1135518565 16:23156080-23156102 AAGGGAAGACAGGAAGGGAAAGG + Intergenic
1135848367 16:25939798-25939820 TAGGGCAGCCAGAATGAGGAAGG + Intronic
1135928857 16:26719492-26719514 AAGGGTTGAGAGAAGGGGAAAGG - Intergenic
1137420048 16:48325404-48325426 AAGGGGAGAGATAGTGGGGATGG - Intronic
1137552997 16:49453221-49453243 AAGGGAAGCCGGAATGGGGGAGG - Intergenic
1137908446 16:52350916-52350938 AAGGGAAGGCAGAATGGGGAGGG - Intergenic
1139006023 16:62572501-62572523 ATGGGTGGACAGATTTGGGAAGG + Intergenic
1139266079 16:65639761-65639783 GAGGGTAGACAAAATGTGGTAGG - Intergenic
1139284455 16:65798071-65798093 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1140748141 16:77999146-77999168 ATGGGCAGCCAGAAGGGGGATGG + Intergenic
1140752415 16:78037510-78037532 AAGGGAAGAGAGAATGGAGAGGG - Intronic
1141155470 16:81593923-81593945 AAGGGTAGAGGGAAGAGGGAAGG - Intronic
1141252193 16:82368903-82368925 ATGGGGAGAGAGAGTGGGGAGGG + Intergenic
1141918982 16:87122257-87122279 AAGGGGAGACGGAACGGGCAGGG - Intronic
1143005160 17:3827070-3827092 AAGGGTAGGGGGAAAGGGGAAGG + Intronic
1143544456 17:7588293-7588315 AAGGGTTGACAGCCTGGGGTAGG + Exonic
1143646631 17:8234608-8234630 CAGGGTGGCCAGAGTGGGGAAGG + Exonic
1144302859 17:13939090-13939112 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1144320844 17:14117926-14117948 ATGGGGAGCCAGAAGGGGGATGG + Intronic
1144664343 17:17091715-17091737 GAGGGTGCAAAGAATGGGGAGGG + Intronic
1144888168 17:18477853-18477875 GTGGGGAGGCAGAATGGGGAGGG + Intronic
1145144038 17:20466450-20466472 GTGGGGAGACAGAATGGGGAGGG - Intronic
1146007648 17:29170901-29170923 AAAGATACACACAATGGGGATGG + Intronic
1146461486 17:33049284-33049306 AAAGGTAGACAGTTTGGGGCTGG + Intronic
1147760258 17:42793564-42793586 GAGGGTCAACAGGATGGGGAGGG - Intronic
1149551513 17:57543731-57543753 AAGGTAAGACAGCATGGGGGAGG - Intronic
1150104877 17:62455357-62455379 AAGGGTGAGCAGAATGGCGAGGG + Intergenic
1150475168 17:65469461-65469483 AGGGGTAAACAGAATGGGTTTGG + Intergenic
1150999025 17:70352137-70352159 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1151429822 17:74054961-74054983 AAGGAGAGAGAGAAAGGGGAGGG - Intergenic
1152362253 17:79838095-79838117 AAGGGCAGGAAGAAAGGGGAGGG + Intronic
1153128236 18:1822427-1822449 AAAGGAAAACAGAATGGTGAAGG + Intergenic
1153703212 18:7717415-7717437 AAGGGGAGACAAAAAGGGGATGG - Intronic
1155219547 18:23671810-23671832 TGGGGAAGACAGTATGGGGAGGG + Intergenic
1156309959 18:35912570-35912592 AAGGGTGGACAGTGTGGTGAAGG - Intergenic
1156609909 18:38713760-38713782 AGGGATAGACAGGATGGGGTGGG + Intergenic
1157410400 18:47458440-47458462 AAGGGGAGACAGAAGAGAGAGGG + Intergenic
1158870611 18:61683954-61683976 AACGGCAGACAGAGAGGGGAGGG - Intergenic
1158960912 18:62587132-62587154 AAGATCAGAAAGAATGGGGAGGG + Intronic
1159417604 18:68173259-68173281 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1159684813 18:71405399-71405421 ATAGGAAGAGAGAATGGGGAGGG + Intergenic
1159940383 18:74402489-74402511 AAGAGAAGAAAGAAGGGGGAAGG + Intergenic
1166992148 19:46699063-46699085 AGGGTTGGACAGAAAGGGGATGG - Intronic
1167758129 19:51426239-51426261 CAGGGGAGCCATAATGGGGATGG - Intergenic
926039436 2:9660970-9660992 GAGGGAATACAGAATGGGGGAGG - Intergenic
926088015 2:10032297-10032319 GAGGGCAGAGAGAGTGGGGAGGG - Intergenic
926127898 2:10283147-10283169 AAGGGTTCCCAGCATGGGGATGG + Intergenic
928092663 2:28385117-28385139 CAGGGCAGACAGCATGAGGAAGG - Intergenic
928182486 2:29079287-29079309 AAGGGAAGAGAGTATGGGGAAGG + Intergenic
928621807 2:33096980-33097002 TAGGGTAGAAGGAGTGGGGATGG + Intronic
929505571 2:42525502-42525524 AAGGGAAGAAAGGAAGGGGAAGG - Intronic
929916727 2:46142666-46142688 AAGGGTAGAAAGCAAAGGGAGGG + Intronic
930251087 2:49034718-49034740 AAGGGAATACAGAATGGGGCAGG - Intronic
930288528 2:49465358-49465380 AAGGGCAGAGGGAAAGGGGAAGG - Intergenic
930288540 2:49465396-49465418 AAGGGGAGAGGGAAAGGGGAAGG - Intergenic
930288548 2:49465415-49465437 AAGGGGAGAGGGAAAGGGGAAGG - Intergenic
930302206 2:49630628-49630650 AAGGGCAGAGAGAAGGGGAAGGG + Intergenic
930443966 2:51446895-51446917 AAGAGTAGAAAGAATGAGAAAGG - Intergenic
930560817 2:52957924-52957946 GAGGGGAGACAGAATAGAGAGGG + Intergenic
930752261 2:54945224-54945246 GAGGGGAGAGAGAAGGGGGAGGG - Intronic
930752270 2:54945254-54945276 GAGGGGAGAGAGAAGGGGGAGGG - Intronic
931855706 2:66299737-66299759 GAGGGGAGCCAGCATGGGGAGGG + Intergenic
933947466 2:87299002-87299024 AAGGAGAGACAGAAGGGGCATGG - Intergenic
934091129 2:88551507-88551529 AAGGGTAGACAGAGTTGGAGAGG - Intergenic
935138819 2:100333142-100333164 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
936246773 2:110835399-110835421 AAAGGAACACAGAAAGGGGAGGG + Intronic
936332729 2:111562565-111562587 AAGGAGAGACAGAAGGGGCATGG + Intergenic
937027947 2:118714806-118714828 AACGGGAGATGGAATGGGGATGG - Intergenic
937227781 2:120379514-120379536 GTGGGTAGAAAGACTGGGGAGGG + Intergenic
937284466 2:120741477-120741499 AAGGGGAGAGAGAACGGAGAGGG - Intronic
937508898 2:122570722-122570744 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
939141787 2:138362624-138362646 AACGGTAGACAGAAGAAGGAGGG + Intergenic
939870889 2:147524620-147524642 AAGGGTAGCTAGAAGGAGGAAGG + Intergenic
940537407 2:154962851-154962873 TAGGATAGATAAAATGGGGAAGG + Intergenic
940665292 2:156601490-156601512 TAGGGAAGAAAGTATGGGGAAGG - Intronic
940781023 2:157933726-157933748 AAGGGAAGGCAGAATGGGGCTGG + Intronic
941159825 2:162023624-162023646 AAGGGCAGGCAGACTGGGGAAGG - Intronic
942072581 2:172329176-172329198 GAAGGTAGACACAGTGGGGAAGG + Intergenic
942151707 2:173082365-173082387 AAGGGTGAAAGGAATGGGGATGG - Intronic
942286319 2:174420870-174420892 AAGGGGAGAGAAAATAGGGAAGG + Intronic
943173526 2:184435570-184435592 AAGAGTAAAGAGAATGTGGAAGG + Intergenic
943426884 2:187749144-187749166 AAGGGCAAGCAGAATGGTGAGGG + Intergenic
945177074 2:207053566-207053588 AAGGGTAGAGAAAGTGGGAAGGG + Intergenic
945975957 2:216270946-216270968 AGAGGTGGACAGAATAGGGAAGG - Intronic
946030204 2:216697622-216697644 AAGGGTAGAGAGAAGGGGGGAGG + Intergenic
946226607 2:218267217-218267239 TAGAGTGGACAGAAGGGGGAAGG - Intronic
947291516 2:228580808-228580830 ACGGGTAGGTAGAATGGGGAAGG + Intergenic
947459640 2:230292657-230292679 AAGTGTATACAGACTGAGGATGG + Exonic
947469943 2:230392098-230392120 AAGTGTATACAGACTGAGGATGG + Exonic
948785469 2:240350169-240350191 AAGGGTGGCCAGGATGGGGCAGG + Intergenic
948949099 2:241237239-241237261 TAGGGGAGACAGAAAGGGCAAGG + Intronic
1168881023 20:1206125-1206147 AATGGGAGAAAGAATGGAGATGG + Intronic
1169440128 20:5626927-5626949 AAGGGGAGCCAGAAGGGGGATGG - Intergenic
1169641604 20:7758425-7758447 AGGGGTAGGGAGAATGGGGAGGG - Intergenic
1170931550 20:20773406-20773428 CAGGGTGGAGAGAGTGGGGAAGG - Intergenic
1171118884 20:22550952-22550974 AAGGGTAGGCACAGTGGGGAGGG - Intergenic
1172038498 20:32027295-32027317 AAGGGCATACAGTATGAGGAAGG - Intronic
1172731724 20:37094600-37094622 CAGTGTAGACAGAATTGTGATGG - Intronic
1172955257 20:38752404-38752426 AAGGGAATACAAAAAGGGGAAGG - Intronic
1173714898 20:45194905-45194927 AAGGAAAGAGAGAATGGAGATGG + Intergenic
1173848802 20:46204795-46204817 TAGGGTGGAGAAAATGGGGAGGG + Intronic
1174812387 20:53658066-53658088 ATGGGAAGAAAGAAGGGGGAAGG + Intergenic
1175279079 20:57790736-57790758 AGAGGGAGACAGGATGGGGAGGG + Intergenic
1175587778 20:60159020-60159042 AAGGGGAGAAAGAACGGGAAAGG + Intergenic
1177705899 21:24704593-24704615 AAAAGTAGCCAGAATGGGCATGG + Intergenic
1177873547 21:26602857-26602879 AAGGGTAGTCAGAGAGGGAAGGG - Intergenic
1178422361 21:32452707-32452729 ATGGGGAGCCAGAAGGGGGATGG + Intronic
1178917265 21:36713055-36713077 TTGGGGAGAGAGAATGGGGAGGG + Intronic
1179095916 21:38314340-38314362 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1179818993 21:43925525-43925547 GTGGGTAGACAAAAGGGGGAGGG + Intronic
1179900861 21:44393149-44393171 AAGGGTAAACAGACTAGGGCAGG - Intronic
1180636971 22:17269351-17269373 AGGTGTAGAGTGAATGGGGAGGG - Intergenic
1180793967 22:18592831-18592853 AAGGGAGGGGAGAATGGGGAAGG + Intergenic
1181227773 22:21402489-21402511 AAGGGAGGGGAGAATGGGGAAGG - Intergenic
1181250879 22:21532350-21532372 AAGGGAGGGGAGAATGGGGAAGG + Intergenic
1181448730 22:23001381-23001403 AAAGGAAGACAGAAAGGTGAGGG - Intergenic
1181840964 22:25660366-25660388 AAAGGCAGGCAGACTGGGGAAGG - Intronic
1182683595 22:32102698-32102720 AATGGAGGACAGAATGGAGATGG - Intronic
1182842894 22:33406296-33406318 AATGTTGGACAGAATGGGGAAGG - Intronic
1183119562 22:35719905-35719927 ATGGGGAGCCAGAAAGGGGATGG + Intronic
1184172115 22:42765851-42765873 CATGGTTGACAGAATGGGGTGGG - Intergenic
1184912374 22:47544825-47544847 AAGGGTTGAGAGAAGGGAGATGG + Intergenic
1184940890 22:47764062-47764084 AGGGGTAGAGGGAATGGTGAGGG - Intergenic
1184955990 22:47886251-47886273 AAGGGGCGACAGCAAGGGGATGG + Intergenic
1185131848 22:49043780-49043802 AAAGGAAGACAGGAAGGGGAGGG - Intergenic
949148142 3:729605-729627 AAGGATAGACAGAGAGGGAAAGG - Intergenic
949696856 3:6707490-6707512 AAGAGAAGACAGCATGGGGTTGG - Intergenic
950056814 3:10031697-10031719 AAGGGTAGACAGAATGGGGAAGG - Intronic
950187580 3:10954576-10954598 AAGTGTAGACTCACTGGGGAGGG - Intergenic
950584715 3:13883955-13883977 CAGGGTAGACAGGATAAGGAAGG + Intergenic
951828301 3:26894060-26894082 ATGGGTAGACAGAATAAGCATGG - Intergenic
951873483 3:27393844-27393866 GATGGAAGACAGAATGAGGATGG + Intronic
951910281 3:27743172-27743194 AAGGATAGAGATACTGGGGAAGG + Intergenic
953329764 3:42043259-42043281 AAGGGAAGAAAGAACGGGAACGG - Intronic
953493693 3:43369374-43369396 AAAGGTAGAAAGAATGGCCAGGG + Intronic
954108816 3:48423102-48423124 AAGGGAAGAGAGACTGGGGGCGG - Intronic
955451630 3:59074560-59074582 AATGGAAAACAGAATGGGGTAGG + Intergenic
955966943 3:64398426-64398448 AAGCCTAGAGAAAATGGGGATGG + Intronic
956181141 3:66519145-66519167 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
956214210 3:66831833-66831855 AAGGGTGGGCAGAAGGGGGAAGG - Intergenic
956390830 3:68771106-68771128 ATGGGGAGTCAGAAGGGGGATGG - Intronic
956724208 3:72143910-72143932 AAGGGAGGAAAGAATGTGGAAGG - Intergenic
956735276 3:72233254-72233276 ATGGGGAGCCAGAAAGGGGATGG + Intergenic
957128396 3:76192348-76192370 AAGGTTTGAAAGAATGGAGAAGG - Intronic
957823564 3:85410939-85410961 AATGGTAGACAAAATTGGGTAGG + Intronic
958001956 3:87761837-87761859 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
959539603 3:107523961-107523983 AAGGGGAGAGAGAAGAGGGAGGG + Intronic
959559076 3:107758819-107758841 AATAGAAGACAGAATGGGGGAGG - Intronic
960265712 3:115618725-115618747 ACAGGGACACAGAATGGGGAAGG + Intergenic
960501609 3:118445051-118445073 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
961204103 3:125067229-125067251 GAGGCTGGAAAGAATGGGGAAGG + Intergenic
961226863 3:125257695-125257717 GAGGGTAGAGAGAAATGGGAAGG - Intronic
961880221 3:130056495-130056517 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
962595844 3:136942743-136942765 AAGCCTGGACAGAAAGGGGATGG - Intronic
963655899 3:148049711-148049733 ATGGGGAGATAGAAAGGGGATGG - Intergenic
963697675 3:148581866-148581888 AGGGGTGGAGAAAATGGGGATGG + Intergenic
964165579 3:153700979-153701001 GAAGGAAGAGAGAATGGGGACGG - Intergenic
964372635 3:156016930-156016952 AGGGGTAGACAGAAAGGACATGG - Intergenic
964669466 3:159209345-159209367 AAGGGGAGCCGGAAGGGGGATGG - Intronic
965005282 3:163014089-163014111 AAGGGTTAAGAGAAAGGGGAAGG + Intergenic
965098174 3:164260780-164260802 AAGGGTAGTGGGAATGGGGCTGG + Intergenic
965984528 3:174735921-174735943 AAGGGTGAACAGAGTGGTGAGGG + Intronic
966405468 3:179592990-179593012 AAACGTAGGCAGAATGGGGAAGG - Intronic
966855679 3:184192598-184192620 AAGGTTGGAGAGAATGGGGCTGG + Exonic
967501043 3:190197735-190197757 AAGGGGAGAAAGAAGGGGAAAGG + Intergenic
967758805 3:193200919-193200941 AAGGGTATACATAATGGTAAAGG - Intergenic
968002831 3:195219490-195219512 AAGGGAAGAAGGAATGAGGAAGG + Intronic
968470289 4:778315-778337 AAATGTATACAGAATGGTGAAGG - Intergenic
968887198 4:3341287-3341309 AAGGGTAGAGAGATGGGGTATGG + Intronic
968992610 4:3924850-3924872 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
969229198 4:5817921-5817943 AAAGTGAGACAGAATGGGCAAGG - Intronic
969822741 4:9732772-9732794 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
969885243 4:10209440-10209462 GAAGGGAGACAGGATGGGGAAGG + Intergenic
970546082 4:17131774-17131796 AAGGGAACAGAGAATGGGGAAGG - Intergenic
970657761 4:18250568-18250590 AATGGGATACAGATTGGGGAGGG - Intergenic
971005476 4:22370002-22370024 AAGGGGAGCCAAAAAGGGGATGG - Intronic
971055921 4:22912372-22912394 AAGGACAGACAGAAAGTGGAAGG - Intergenic
971216364 4:24665812-24665834 AAGGGCAGACAGAATGGAGAGGG + Intergenic
972390251 4:38607010-38607032 ATGGGGAGTCAGAAGGGGGATGG + Intergenic
974318932 4:60318348-60318370 AGGGGTGGGAAGAATGGGGAGGG + Intergenic
974385670 4:61200605-61200627 AAGAGAAGAAAGAAAGGGGAGGG - Intergenic
975426079 4:74229397-74229419 AGAGGTAGCCAGAACGGGGAGGG + Intronic
975540027 4:75499764-75499786 AAGGGTAGGGAGGATGGGGCAGG + Intronic
975707785 4:77128121-77128143 AAGGGGAGCTGGAATGGGGATGG + Intergenic
976023130 4:80655458-80655480 ATGGGTACACAGAATTGGTATGG + Intronic
976126384 4:81837750-81837772 CAGGGTGGAGGGAATGGGGAAGG - Intronic
976381275 4:84402012-84402034 AAGGTTAAGCAGAATGGGGCTGG + Intergenic
976626972 4:87195599-87195621 AAGGGTAGAGAGAAGGCAGAAGG + Exonic
976987274 4:91317434-91317456 AAGGTGAAAGAGAATGGGGAGGG - Intronic
978063832 4:104371474-104371496 AAGGCAAGACAGAATGGAGGAGG + Intergenic
978310141 4:107378655-107378677 ATGGGGAGACAGTAGGGGGATGG + Intergenic
978833017 4:113112422-113112444 AGGGGGAGACAGAATGTGTATGG + Intronic
979560145 4:122092616-122092638 TAGAGTAGAGAGAATGGGTACGG + Intergenic
981023072 4:140049206-140049228 GAGGGAAGAAAGAATGGGGGAGG - Intronic
981572323 4:146165807-146165829 AAGGGTAGAAAGAAAGGACATGG - Intergenic
982149272 4:152434653-152434675 AAGGATATACAGAAGGGAGAGGG + Intronic
986165274 5:5267444-5267466 ATGGGGAGCCAGAAAGGGGATGG + Intronic
986800703 5:11257213-11257235 AAGGAAAGAAAGAATGGGAAAGG + Intronic
987005705 5:13707253-13707275 ATGGGGAGCCAGAAGGGGGATGG - Intronic
987212137 5:15693838-15693860 ATGGGGAGCCAGAAGGGGGATGG - Intronic
987397988 5:17443576-17443598 CAGGGGAGACAGAAGGGAGATGG - Intergenic
988263085 5:28914499-28914521 AAGAGCAGACACAATGGAGAAGG - Intergenic
988387985 5:30591386-30591408 AAAATTAGACAGAATGTGGAGGG + Intergenic
988515793 5:31903344-31903366 AGGGGTAGAAAGAATAGGAAAGG + Intronic
989281566 5:39649801-39649823 AAGGGGAGACACAATGGCCATGG + Intergenic
990213560 5:53506967-53506989 AAGGATAGTCGGTATGGGGATGG - Intergenic
991960434 5:72038945-72038967 AAGGATAGACTGCAGGGGGAAGG - Intergenic
992052911 5:72956800-72956822 AGGGGTGGAAAGAATGAGGAAGG - Intronic
992530046 5:77644941-77644963 AAGGGGAGAGAGAAAGGGAAAGG - Intergenic
992672752 5:79076138-79076160 ATGGGGAGCCAGAAGGGGGATGG + Intronic
992782446 5:80140482-80140504 AAGGGGAGATAGAGTGGGGGTGG - Exonic
993333454 5:86627905-86627927 TAGGGTAGGGAGAATGGGGATGG + Intergenic
995356727 5:111246268-111246290 GGGGGTAGACAGACTGGGCAGGG - Intronic
995533644 5:113114787-113114809 AAGGGGAGCTAGAAGGGGGATGG - Intronic
996109989 5:119554077-119554099 AAGGGTATTCAGGATGGGCACGG - Intronic
996215056 5:120856195-120856217 TAGGGAAGCCAGAAGGGGGATGG - Intergenic
997213488 5:132092067-132092089 GAGGGTAGCCAGAATGGCTATGG - Intergenic
1000186669 5:158865180-158865202 AAGGGTGAACAGGATGGGAAGGG - Intronic
1000370253 5:160528328-160528350 AAGAGGGGACAGGATGGGGATGG - Intergenic
1000406238 5:160891366-160891388 AAGGTCAGAGAGAATGAGGAAGG - Intergenic
1000658892 5:163915412-163915434 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1000967103 5:167670848-167670870 AAGGATGAACTGAATGGGGAAGG - Intronic
1001083807 5:168685932-168685954 AAGGCAGGAGAGAATGGGGAGGG + Intronic
1001126814 5:169027051-169027073 ATGGGTAGACAGACTTAGGATGG + Intronic
1001184448 5:169555159-169555181 AAGGGAAGACTGAATAAGGAGGG - Intergenic
1001295720 5:170497615-170497637 AAGGGTGGATTGAAAGGGGACGG - Intronic
1001718076 5:173833585-173833607 AAGGGTAGTCAGCCTGGAGAAGG - Intergenic
1002134626 5:177100000-177100022 AAAGGAAGACAGAGAGGGGAGGG - Intergenic
1003016031 6:2468213-2468235 GAGGGTAGACAGAGAGAGGAAGG + Intergenic
1004706966 6:18133577-18133599 AATGGTAAACAAAATGGGAAAGG + Intronic
1005589298 6:27308804-27308826 AAGAGTGGACAGGAAGGGGAAGG + Intronic
1005969318 6:30749043-30749065 GAGGGTAGCAGGAATGGGGATGG - Intergenic
1006180633 6:32151643-32151665 AGGGGGAGACAGAAAGAGGAGGG + Intronic
1006385113 6:33726511-33726533 ACAGCTAGACAGTATGGGGAAGG - Intronic
1006385564 6:33728887-33728909 AAGGGCAGACAGACGGGGGAGGG - Intronic
1006881408 6:37343198-37343220 AAGGGAAGAGAGAATGGGGAAGG - Intergenic
1007120108 6:39372725-39372747 AAGGGTAGAGTGAATTGTGAAGG - Intronic
1007380166 6:41485035-41485057 CAGGGTAGAGAGACTGGGGGTGG + Intergenic
1007436496 6:41816370-41816392 AAGTGTAGAAAAAATGTGGATGG - Intronic
1008077877 6:47164644-47164666 AAGGTTAAAGAGAATGGAGAAGG - Intergenic
1008595737 6:53039944-53039966 AAGGTGAGGCATAATGGGGAGGG + Intronic
1008826634 6:55702413-55702435 AAGGGTAGAGAGAAAAGTGAAGG - Intergenic
1011094679 6:83647157-83647179 AAAGGTATACAGATTTGGGATGG - Intronic
1011404761 6:87007339-87007361 GGGGGTGGAGAGAATGGGGATGG + Intronic
1011596995 6:89025693-89025715 AAGGGAAGACAAAGTTGGGAAGG - Intergenic
1011732585 6:90280821-90280843 AAGGGTAGACATTACAGGGAGGG + Intronic
1012268709 6:97180432-97180454 CAGGGTAGAGAGGATGGGGATGG + Intronic
1012319046 6:97819806-97819828 AAGGGGAGGCAGAACAGGGAAGG - Intergenic
1012386902 6:98692891-98692913 AAGGGTTGAAGGAAAGGGGAAGG - Intergenic
1012861903 6:104570375-104570397 AGGGGAAGACAGAGTCGGGAAGG - Intergenic
1012909615 6:105104298-105104320 AATGTTACACAGAATGTGGAAGG - Intronic
1015042867 6:128742809-128742831 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1016567265 6:145470036-145470058 AGGGGTAGGGGGAATGGGGATGG + Intergenic
1016894876 6:149041792-149041814 AAGGGTGGTCAGCATGGAGAGGG - Intronic
1017702103 6:157084401-157084423 AAGGGCAAACTGTATGGGGATGG + Intronic
1017858056 6:158368712-158368734 CAGGGTATACAGCCTGGGGATGG + Intronic
1017980135 6:159394173-159394195 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1018148573 6:160917558-160917580 TAGGGTAGAGAGGCTGGGGAAGG - Intergenic
1018245253 6:161816351-161816373 AAGGGGAGGCAGAGTGGGGTGGG + Intronic
1018347817 6:162921206-162921228 CAGGAGAGACAGAGTGGGGAGGG + Intronic
1020315256 7:6901206-6901228 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1022992760 7:35724910-35724932 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1023447212 7:40244269-40244291 AAAGATAGATAGAATGTGGATGG + Intronic
1023684712 7:42722396-42722418 AAGGTTAGACAAAATGCTGATGG - Intergenic
1024382568 7:48715246-48715268 GAGAGTAAAGAGAATGGGGAAGG - Intergenic
1026272018 7:68844936-68844958 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1028248729 7:88514494-88514516 GAGGGCAGAGAGAATGGAGAGGG + Intergenic
1028281122 7:88929220-88929242 ACGGGGAGAGAGACTGGGGATGG + Intronic
1029611601 7:101629567-101629589 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1029903612 7:104068308-104068330 CAGGGTAGGAAGAATGGAGAGGG + Intergenic
1030380258 7:108803247-108803269 AAGGGAAGAAAGAAGGGGAAGGG - Intergenic
1030742976 7:113131610-113131632 TAGGGTAGAGACAATGAGGATGG + Intergenic
1032034048 7:128508575-128508597 AAGGGTGAGCAGAATGGCGAGGG + Intergenic
1032760092 7:134932540-134932562 AAGGTAAGACAGAAAAGGGAAGG + Intronic
1032894004 7:136230906-136230928 AAAGGTATGCAGAATTGGGAAGG - Intergenic
1033015655 7:137668717-137668739 AAAGGTTGACAGAATGGTGAAGG + Intronic
1033301319 7:140188696-140188718 AAGGAAAGAAAGAAAGGGGAAGG + Intergenic
1033354374 7:140587583-140587605 AAGGGGAGGGAGAATGGGGCTGG - Intronic
1033568626 7:142604928-142604950 AAGGGGAGAGAGAAAGGGGCTGG - Intergenic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1034059148 7:148069778-148069800 AAAGAAAGAAAGAATGGGGAGGG + Intronic
1034263890 7:149772484-149772506 GAGGGGAGACGGAGTGGGGAGGG - Intronic
1034758555 7:153648103-153648125 AAGGGTTGACATTATAGGGACGG - Intergenic
1035111228 7:156483713-156483735 AGGGGGAGACAGGAGGGGGAGGG + Intergenic
1035651098 8:1265844-1265866 AAGAGTAGACAGGTAGGGGAGGG + Intergenic
1035832570 8:2713610-2713632 GAGTGAAGAAAGAATGGGGAAGG - Intergenic
1036101859 8:5795690-5795712 ATGGGGAGAGAGAAGGGGGATGG - Intergenic
1038030514 8:23634541-23634563 AAGGGAAGAAAGGAAGGGGAGGG - Intergenic
1038134832 8:24773884-24773906 AAGGGGAGGGAGAAAGGGGAGGG + Intergenic
1038404051 8:27308888-27308910 AAGGGTAGTTAGAATGAGGAGGG - Intronic
1039256930 8:35729568-35729590 AAGAGAAGACAGAATGTCGAGGG + Intronic
1039604035 8:38866240-38866262 CAGGGGAGGCAGACTGGGGAAGG + Intergenic
1039614801 8:38946805-38946827 AAGGGTAGGAAGGATGGAGAGGG + Intronic
1039931257 8:41991800-41991822 AAGGGTAGAAAGTAAGGAGAGGG + Intronic
1040845617 8:51835232-51835254 AAGGGTAGAAGGAGAGGGGAAGG - Intronic
1041171887 8:55150936-55150958 AAGGTTAGACGGAATGGTGCAGG - Intronic
1041389845 8:57338589-57338611 AAGGGTGGACAGAGTTAGGAGGG - Intergenic
1041568001 8:59302712-59302734 AAGGGGAGAAGAAATGGGGAAGG + Intergenic
1041918302 8:63157864-63157886 ATGGGGAGTCAGAAAGGGGATGG + Intergenic
1042850582 8:73212253-73212275 TTGGGTAGACAGGATGAGGAAGG - Intergenic
1042934593 8:74045950-74045972 AAGGGTAGAGAGCATCTGGAGGG + Intergenic
1043623003 8:82220138-82220160 AAGGGTTGACAAATTGGTGAAGG - Intergenic
1045603015 8:103739379-103739401 TAGGGTAGAGGGAAGGGGGAGGG + Intronic
1046555561 8:115768716-115768738 AAGGGAAGAAAGGATGGGAAGGG - Intronic
1047024850 8:120813235-120813257 GAGGGTAGACAGCAGTGGGAAGG - Exonic
1049478319 8:142807118-142807140 GAGGGCAGACAGGATGAGGAGGG - Intergenic
1050145261 9:2560437-2560459 AAGGGTAGATAAAAGTGGGAAGG + Intergenic
1050829109 9:9989531-9989553 AAGGGGAGCTAGAAGGGGGATGG - Intronic
1051487073 9:17620562-17620584 AAGGGCAGACAGAAGAGGGTTGG + Intronic
1051913009 9:22176448-22176470 AAGGCTAGAAAGGCTGGGGAAGG + Intergenic
1055126837 9:72728605-72728627 AAGGGTAGAGACAATTTGGAGGG - Intronic
1055762506 9:79624038-79624060 AAGAGAGGACAGATTGGGGAGGG + Intronic
1055811655 9:80155727-80155749 AAGGGTAGTCAGCATGGGAGTGG + Intergenic
1056237933 9:84614666-84614688 AAGGGTCGAAAGCATGTGGAAGG + Intergenic
1056871905 9:90289626-90289648 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1057226229 9:93294707-93294729 GAGGGTAGAGATAATGGGGTGGG + Intronic
1058236598 9:102498123-102498145 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1058832918 9:108835398-108835420 AAGCATAGGCAGAATGGGCATGG + Intergenic
1059636025 9:116171496-116171518 AAGGGTGGACAGAGTGGTGGGGG - Intronic
1060232795 9:121838153-121838175 AAGGAAAAACAGAATTGGGAAGG - Intronic
1060447534 9:123705366-123705388 AAGGGTACAAAGAATAGGAAAGG + Intronic
1060716215 9:125931823-125931845 AAGGGGAGAGAAAATGGAGAGGG + Intronic
1060781385 9:126415890-126415912 AAGGGTGGCCTGACTGGGGAGGG + Intronic
1061002095 9:127908234-127908256 AAGTGTCGCCAGAATGGGGCGGG + Exonic
1061414025 9:130436232-130436254 AAGGGAAGACAGAAAGGTCAAGG + Intergenic
1061525568 9:131158783-131158805 AAAGGGAAACAGAATGGGTATGG - Intronic
1061537365 9:131258434-131258456 AAGGGCAGAAAGAAGGGGCACGG + Exonic
1186017818 X:5217994-5218016 AGGGGTAGAGAGAAGGAGGAGGG + Intergenic
1186130934 X:6464661-6464683 CAGGTAAGACAGAAAGGGGAGGG - Intergenic
1186286230 X:8046718-8046740 ATGGGGAGCCAGAAAGGGGATGG + Intergenic
1186563026 X:10632910-10632932 AATGGTAGACTGAATGGGCATGG - Intronic
1186809168 X:13170258-13170280 AAGGAAAGAAAGAATGGGCATGG - Intergenic
1187097280 X:16161906-16161928 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1187138524 X:16571154-16571176 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1188981860 X:36733883-36733905 AAGGGCAGGCAGAATGTGCATGG - Intergenic
1191052963 X:56213969-56213991 AAGGGGAGCTAGAAAGGGGATGG + Intergenic
1191884498 X:65874575-65874597 CAGGGGAGACAGACTGGGGTTGG + Intergenic
1191974902 X:66861309-66861331 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1193415407 X:81216569-81216591 TAGGGTAGGGAGGATGGGGATGG - Intronic
1195310622 X:103629088-103629110 TGGGGTTGACAGAATCGGGATGG + Intronic
1195756241 X:108201818-108201840 AAGGGGAGAGGGAATGGGAAGGG - Intronic
1195758168 X:108219855-108219877 AAGGGAATACAATATGGGGAGGG - Intronic
1195829592 X:109041402-109041424 AAGGGTAGAGAAGGTGGGGATGG - Intergenic
1195888134 X:109662911-109662933 GAGTGTAGAGAGAATGGGCAGGG - Intronic
1196713347 X:118786666-118786688 AAAGGTAGACAGAAAGGGCCAGG - Intronic
1197113702 X:122806269-122806291 AAAAGTAGGCAGAATGTGGAAGG + Intergenic
1197462094 X:126755318-126755340 AAGGGGAGCTAGAAAGGGGATGG + Intergenic
1197490757 X:127114566-127114588 AAGTGAAGATAGAGTGGGGAGGG + Intergenic
1198394617 X:136208946-136208968 GAGGGTAGAAAGAAGGGGGTGGG + Intronic
1198581416 X:138069039-138069061 AAGGGGAGATAAAATGGGGTTGG - Intergenic
1199432437 X:147776559-147776581 AAGGGAAGCTAGAAGGGGGATGG + Intergenic
1199805871 X:151299868-151299890 AAGAGGAAACAGAATGGGCAGGG - Intergenic
1199899603 X:152160020-152160042 GAGGGGAGACAGAAAAGGGAAGG - Intergenic
1200080218 X:153572560-153572582 GAGGTTAGACAGGGTGGGGAGGG - Intronic
1200136498 X:153877633-153877655 AAAGAGAGAAAGAATGGGGAAGG + Intronic
1200710125 Y:6475873-6475895 ATGGGGAGCCAGAATGGAGATGG + Intergenic
1201023990 Y:9688835-9688857 ATGGGGAGCCAGAATGGAGATGG - Intergenic
1201613395 Y:15868354-15868376 CAGGTAAGACAGAAAGGGGAAGG - Intergenic
1201895282 Y:18986025-18986047 CAGGGAAGCCAGAATGGGCATGG - Intergenic
1202183592 Y:22160047-22160069 ATGGGGAGCCAGAATGGAGATGG + Intergenic
1202207767 Y:22426354-22426376 ATGGGGAGCCAGAATGGAGATGG - Intergenic