ID: 950058576

View in Genome Browser
Species Human (GRCh38)
Location 3:10049809-10049831
Sequence TTAAATTTAGCCTGGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 1, 2: 0, 3: 18, 4: 244}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950058576 Original CRISPR TTAAATTTAGCCTGGGAAGC TGG Intronic
901423575 1:9166780-9166802 TTCAATGTACCCTGGGAAGGCGG + Intergenic
902470701 1:16646186-16646208 AAAAATTTCCCCTGGGAAGCAGG - Intergenic
902488103 1:16761274-16761296 AAAAATTTCCCCTGGGAAGCAGG + Intronic
903235342 1:21946859-21946881 TGAAACCTAGCCTGGCAAGCTGG + Intergenic
903410020 1:23134626-23134648 TTAAAATTAGCCTGGCATGGTGG + Intronic
903577808 1:24350007-24350029 ATAAATCTAGCGTGGGCAGCAGG + Intronic
904586254 1:31582574-31582596 TTAAAAATACCCTGGGAAGCAGG + Intronic
905434622 1:37947931-37947953 TTAAATTTAGCCGGGTATGGTGG + Intergenic
905624656 1:39480474-39480496 TTAAATTTAGCCTAGCATGGTGG + Intronic
906235365 1:44204401-44204423 TTAAACTTAGCCTGGTACGATGG - Intergenic
908652602 1:66352290-66352312 TTAGTTTAAGCCTGGGAAGGAGG + Intronic
909014162 1:70365345-70365367 TAAAATTTAACCTGAGAGGCTGG + Intronic
909568146 1:77078738-77078760 TTAAAATTAGCCTGGGGTGGTGG + Intergenic
909635632 1:77814040-77814062 TTAAAATTAGCCTGGCATGGTGG - Intronic
909735982 1:78962175-78962197 TTAATTATAGCCTGGAAGGCCGG - Intronic
909966301 1:81915159-81915181 ATCACTTGAGCCTGGGAAGCTGG - Intronic
910434185 1:87188291-87188313 TTAAATATAGCCAGAGAATCTGG - Intergenic
912163065 1:107009583-107009605 ATAAATTAAGTCTGGGAAGAAGG - Intergenic
915369145 1:155333331-155333353 AAACATTTAGGCTGGGAAGCCGG - Intergenic
915476708 1:156156891-156156913 TTAAAATTAGCCTGGCATGGTGG - Intronic
917392150 1:174549524-174549546 TAAAATTTAGCCTGGAATGGTGG - Intronic
918526770 1:185473387-185473409 ATAAATTAAGACTAGGAAGCTGG + Intergenic
919337787 1:196262661-196262683 TTAAATTGAGCTTTGGAAACTGG - Intronic
919528191 1:198680118-198680140 TGAAAACTAGCCAGGGAAGCCGG + Intronic
920782518 1:209007949-209007971 TTAAATCTTGCCTTGGAAGAGGG - Intergenic
922299682 1:224286500-224286522 TGAAAATAAGCCTGAGAAGCTGG - Intronic
922738560 1:228003299-228003321 TTTATTTTAGCCTGAGGAGCTGG + Intergenic
923111393 1:230893252-230893274 TTAAATTTAGCCAGGCATGGTGG + Intergenic
923287046 1:232506251-232506273 TTTAAGTAACCCTGGGAAGCAGG + Intronic
1063328295 10:5127564-5127586 TAAAAATTAGCCTGGCATGCTGG + Intronic
1064073720 10:12251917-12251939 TTAAGTTTAGCTCTGGAAGCTGG + Intergenic
1064361126 10:14665774-14665796 TTCAATTTGCACTGGGAAGCAGG - Intronic
1064480426 10:15735257-15735279 TTAAAATTAGCCTGGAATGGTGG - Intergenic
1064590288 10:16883180-16883202 TTAACTTTACCCTGAGTAGCTGG + Intronic
1064616456 10:17163323-17163345 TTGAATTGAGCCTGAGCAGCAGG + Intronic
1065641515 10:27787267-27787289 TTAAATTTAGCCTGGCATGATGG - Intergenic
1065739422 10:28783805-28783827 ATAAAATTAGCCTGGCAAGGGGG - Intergenic
1068548538 10:58380239-58380261 TTAAATTTACCTGGGAAAGCAGG - Intergenic
1071147638 10:82593593-82593615 TTAAATTAAGCCTGTGAAGTAGG - Intronic
1071773837 10:88762348-88762370 TTAAATTCCTCCTGAGAAGCAGG - Intronic
1072364326 10:94693638-94693660 TTTATTTTAGCCTGGAAGGCAGG - Intronic
1072470827 10:95711598-95711620 TTAAAATTAGCCAGGTATGCTGG - Intergenic
1074138685 10:110651233-110651255 TTAAATTTAGCCATGGACACAGG + Intronic
1074562579 10:114547138-114547160 TTAAATGTAGCCTGGCAATGAGG - Intronic
1074711923 10:116184640-116184662 TTAAATAGAGCCTGAGCAGCTGG - Intronic
1074719427 10:116251705-116251727 TGAAACTGAGCCTGGGATGCTGG - Intronic
1074778117 10:116781145-116781167 TTAAAATTAGCCTGGCATGGTGG + Intergenic
1075141029 10:119835920-119835942 ATCACTTGAGCCTGGGAAGCAGG - Intronic
1075417953 10:122279324-122279346 TTAAAATTAGCCAGGTATGCTGG + Intronic
1076184632 10:128436697-128436719 CTCTATTTATCCTGGGAAGCTGG - Intergenic
1078964921 11:16327894-16327916 TTACAGTTAGACTGGGCAGCCGG - Intronic
1080287378 11:30630954-30630976 TTAAACTTTCCCTGGGATGCAGG + Intergenic
1081089654 11:38847497-38847519 TTAAATATAACCTGGGCAGGTGG - Intergenic
1081949202 11:47028348-47028370 TTAAATTTATCCTTGGATTCAGG + Intronic
1082776626 11:57250083-57250105 TTAATTTTAGCATGGGAAAAAGG + Intergenic
1082939315 11:58687332-58687354 TTTAATTTAGCCAGGCAAGATGG - Intronic
1084175972 11:67422476-67422498 TTAAAATTAGCCAGGCAGGCCGG - Intronic
1085235045 11:75008228-75008250 TTACATTTAGCCTGGCATGTAGG + Exonic
1085281735 11:75335430-75335452 TAAAAATTAGCCTGGGATGGTGG + Intronic
1085796093 11:79541306-79541328 TTGAATTTAGCCTGGCATGGTGG + Intergenic
1088258503 11:107923547-107923569 TTAAATTTAGCCAGGGGAAAAGG - Intronic
1091499413 12:1001205-1001227 TTAAAATTAGCCAGGCAAGGTGG - Intronic
1095506903 12:42907840-42907862 TTAAAATTAGCCAGGGATGGTGG - Intergenic
1096527647 12:52221319-52221341 TTAACATAATCCTGGGAAGCAGG + Intergenic
1096631337 12:52928541-52928563 TAAAATTCAGCCTGGGATGGGGG - Intronic
1098074569 12:66715215-66715237 ATAAAGTTAACCTGGGAGGCAGG - Intronic
1098721193 12:73900405-73900427 TTAATTTTTACCTGGGCAGCTGG + Intergenic
1099281137 12:80647842-80647864 TTATGTTTACCCTGAGAAGCTGG + Intronic
1100077395 12:90802453-90802475 TAAAAATTAGCCTGGCATGCTGG - Intergenic
1100319988 12:93481740-93481762 TAAAATTTAGACTGGGAAGGAGG - Intronic
1100930702 12:99606787-99606809 TTAAATTGATCATGGGAAACAGG + Intronic
1101348753 12:103908540-103908562 TTAAATTTAGCCAGGCATGGTGG + Intergenic
1102019019 12:109668851-109668873 TAAAATTTAGCCTGGCATGGTGG + Intergenic
1102818680 12:115889337-115889359 TTAAAATTAGCCAGGCATGCTGG + Intergenic
1103620676 12:122185320-122185342 TTAAATTTAGCCAGGTATGGTGG + Intronic
1103751286 12:123164854-123164876 TTAAAATTAGCCGGGGGTGCTGG + Intronic
1104996559 12:132661453-132661475 TTAAATTTAGCCCAGAAAGGAGG - Intronic
1105698982 13:22920698-22920720 GTAAATTGAACCTGGGAAGATGG + Intergenic
1105850725 13:24333545-24333567 GTAAATTGAACCTGGGAAGATGG + Intergenic
1107854340 13:44600027-44600049 ATAAAATTAGCCTGGCATGCTGG + Intergenic
1108429735 13:50341659-50341681 TTAATTCCAGCATGGGAAGCAGG - Intronic
1111462036 13:88558147-88558169 ATAAGTTTTGCCAGGGAAGCAGG + Intergenic
1112142445 13:96660264-96660286 TTAAAATAATCCTGGGAGGCAGG - Intronic
1113119058 13:106906802-106906824 TGAAATGTGGCCTGGGTAGCAGG + Intergenic
1115387457 14:32814085-32814107 TCAAATTTTGCCAGAGAAGCTGG + Intronic
1117432598 14:55683586-55683608 TTAAATTTTGCCTTGGATTCTGG - Intronic
1118796484 14:69150389-69150411 TTAATTTTAGCCTGTGAAAGAGG - Intronic
1118968854 14:70614265-70614287 TTAAAGTTAGCCTGGAATGATGG - Intergenic
1119361433 14:74053554-74053576 TTAAAATTAGCCTGGCATGGTGG - Intronic
1125960301 15:43824454-43824476 TTAAAATTCGACTGGGAAGAGGG + Intronic
1125961205 15:43831282-43831304 TCAAAATTAGCCTGGCAAGGTGG - Intronic
1128021071 15:64390910-64390932 TTATATTCCGCCTGGGAAGGAGG + Intronic
1130548803 15:84875955-84875977 TTAAATTTGGCCGGGCACGCTGG + Intergenic
1134006929 16:10824232-10824254 CTAACTTTAGCCTGGGGAGAGGG + Intergenic
1135404340 16:22187462-22187484 TTAAAATTAGCCAGGCAAGGTGG + Intronic
1135887129 16:26320417-26320439 ATAAAATTAGCCTGGCAAGGTGG + Intergenic
1136574202 16:31113614-31113636 TAAAATTTAGCCTGGCATGATGG - Intergenic
1137329554 16:47478426-47478448 TTAAATGTTACCTTGGAAGCAGG + Intronic
1138437442 16:57011567-57011589 TTAAAATTAGCCTGGCATGGTGG + Intronic
1138749690 16:59403665-59403687 TTAAATGTATCCTGGGAAAAGGG - Intergenic
1141081877 16:81060109-81060131 CAAAATCCAGCCTGGGAAGCAGG - Intronic
1141181882 16:81758991-81759013 TTAAATTTAGCCTTTCTAGCAGG + Intronic
1142519629 17:495751-495773 TTAAAATTAGCCTGGCATGGTGG + Intergenic
1149608521 17:57941981-57942003 CTAAATTGAGCCTGGGGGGCAGG + Intronic
1150191156 17:63240770-63240792 TTGAGTTCAGCCTGGGAAGGTGG - Intronic
1150833662 17:68544781-68544803 TTAAAATGAGACTGGGAAGAGGG - Intronic
1155084592 18:22445663-22445685 TTAAATTCAGCCTTGAAAGGAGG + Intergenic
1155119255 18:22801784-22801806 TAAAAATTAGCCTGGCATGCTGG + Intronic
1156197566 18:34792279-34792301 TTAAACCTAGCCTGGGAAAAGGG + Intronic
1156714101 18:39985741-39985763 TTACATAAAGTCTGGGAAGCAGG - Intergenic
1156997879 18:43489752-43489774 TTAACTCTAGTCTGGAAAGCAGG + Intergenic
1159787594 18:72732823-72732845 TAAAATTGATCCTGTGAAGCAGG - Intergenic
1160258669 18:77269582-77269604 TCAAATTTATCCTGTGAAACTGG + Exonic
1161549166 19:4901576-4901598 TTCACTCCAGCCTGGGAAGCAGG + Intronic
1162095035 19:8305170-8305192 GCAAATGAAGCCTGGGAAGCTGG + Intronic
1162825786 19:13250977-13250999 TAAAAATTAGCCTGGCATGCTGG + Intronic
1163764101 19:19152943-19152965 TTAAATTTAGCAAGTCAAGCCGG - Intronic
1164167496 19:22694985-22695007 CTAAAATTAGCCAGGGAAGGTGG - Intergenic
1165765515 19:38348309-38348331 TTAAAATTAGCCAGGTAAGGTGG - Intronic
1167392138 19:49202485-49202507 TTAAAATTAGCCAGGCCAGCAGG + Intronic
1202703096 1_KI270713v1_random:2966-2988 AAAAATTTCCCCTGGGAAGCAGG - Intergenic
925259119 2:2514805-2514827 TTAAATTTAGTTTTGGAACCTGG + Intergenic
926128281 2:10285140-10285162 TTAAACTCATCCTGTGAAGCTGG + Intergenic
929904013 2:46030363-46030385 TTAAACTTAGCTAGGGAAGCAGG - Intronic
930924966 2:56806423-56806445 TGAAATGTAACCTGGGCAGCAGG + Intergenic
931243043 2:60469353-60469375 ATAAATATAGCATGGGAAGAGGG - Intronic
931570961 2:63668694-63668716 TTCAGTTTACCCTGGAAAGCGGG - Intronic
932446402 2:71784367-71784389 TTAAAATTAGCCTGGTATGGTGG + Intergenic
933053064 2:77625002-77625024 TTAAATTTAACTTTAGAAGCGGG - Intergenic
934459751 2:94207536-94207558 TTAAATTTAGCCAGGTGTGCCGG + Intergenic
934920465 2:98340369-98340391 TTAAATTTAACATAGGAATCGGG - Intronic
935372521 2:102362335-102362357 TGAACTTTGGCCTTGGAAGCAGG + Intronic
937834656 2:126460061-126460083 TTAACTTTCTCCTGGGCAGCAGG + Intergenic
941375251 2:164720669-164720691 TGAAATTAAGCATGGTAAGCAGG - Intronic
941978343 2:171430203-171430225 TTAAAATTAGCCAGGGATGGTGG + Intronic
942127072 2:172837718-172837740 ATAAATTTAGCCAGGCAAGGCGG - Intronic
942331520 2:174829697-174829719 TAAAATTTTGCTTGGGAAGGTGG + Intronic
943094119 2:183408230-183408252 TTAAATTTATTCTGGAAGGCAGG - Intergenic
943759198 2:191590490-191590512 TTAAACTTAGACTGTGAGGCAGG + Intergenic
946162538 2:217844593-217844615 TTAAACTGAGCCTTGGAAGATGG - Intronic
946915067 2:224510564-224510586 TTAGATTTCGTCTAGGAAGCAGG + Intronic
947349668 2:229230128-229230150 TTAACCTTGGCCTGGGAAACGGG + Intronic
1168972410 20:1939679-1939701 TTAGCTTTAGCCTGGCAACCTGG + Exonic
1170611838 20:17920580-17920602 TTAAAATTAGCCAGGCATGCTGG + Intergenic
1171974393 20:31585102-31585124 ATAAATTGAGCCTGGGAAATCGG + Intergenic
1172804642 20:37603140-37603162 CAAAATCCAGCCTGGGAAGCTGG - Intergenic
1173153180 20:40585134-40585156 TCAAACTAAGCCTGTGAAGCAGG - Intergenic
1173487663 20:43453313-43453335 TTAAATTTAGGAATGGAAGCTGG - Intergenic
1173889061 20:46489570-46489592 ATCACTTGAGCCTGGGAAGCGGG + Intergenic
1175616521 20:60404641-60404663 ATAAGTTGAACCTGGGAAGCGGG + Intergenic
1177447672 21:21218745-21218767 TTAATTTTAACCTGATAAGCTGG + Intronic
1177567870 21:22847269-22847291 TTAAAATTAGCCTGGTAAACTGG - Intergenic
1177760682 21:25399538-25399560 TTAAATTTATCCTGGGCCCCAGG - Intergenic
1178461339 21:32805512-32805534 TAAAATTTAGCCTGGTATGGTGG - Intronic
1179107401 21:38414850-38414872 TTAGATTTAGCATGAGCAGCTGG - Intronic
1181588320 22:23866763-23866785 TAAAAATTAGCCTGGCATGCTGG + Intronic
1182360222 22:29742097-29742119 ATTAAGTTAGCCTGGGAACCTGG - Intronic
1182375023 22:29840340-29840362 TTAAAATTAGCCAGGCATGCTGG + Intergenic
1183000135 22:34850149-34850171 TGAAATTTAGGCTGGGGAGAGGG + Intergenic
1183755374 22:39757421-39757443 TTAAATTTAGCCTGGCATGGTGG - Intronic
1183767090 22:39888301-39888323 TGTACTTCAGCCTGGGAAGCAGG - Intronic
1184773924 22:46613808-46613830 TCAAAGACAGCCTGGGAAGCAGG - Intronic
1185063127 22:48617377-48617399 TTGACTTTAGCCAGTGAAGCTGG + Intronic
949276539 3:2289679-2289701 TTATATTTATACGGGGAAGCGGG - Intronic
949862078 3:8515199-8515221 TTGAATTTAGCCTGGCATCCAGG + Intronic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
949991633 3:9584050-9584072 ATAAAATTAGCCAGGGAAGAAGG - Intergenic
950058576 3:10049809-10049831 TTAAATTTAGCCTGGGAAGCTGG + Intronic
950288984 3:11768287-11768309 TTAAAATTAGCCTAGTATGCTGG - Intergenic
950300336 3:11871732-11871754 TTAAAGTTAGCCTGGGAAGCTGG + Intergenic
950854829 3:16095379-16095401 TTGACTTAAGCCTGAGAAGCAGG + Intergenic
951014197 3:17712084-17712106 ATAATTTTAGCCTGTGATGCTGG - Intronic
951984868 3:28607813-28607835 TTAAATTTAGCCAGGCATGGTGG - Intergenic
953778727 3:45846202-45846224 TTACATTTAACATGGGAAACAGG - Intronic
954068159 3:48123440-48123462 TTAAAATTAGCTTGGGATGGTGG - Intergenic
954298730 3:49688068-49688090 AAAAATTTCCCCTGGGAAGCAGG + Intronic
955205679 3:56893718-56893740 ATCACTTGAGCCTGGGAAGCAGG + Intronic
956421820 3:69093796-69093818 TAAAAATTAGCCAGGCAAGCTGG + Intronic
958835885 3:99144534-99144556 TCAGACTTGGCCTGGGAAGCTGG + Intergenic
961004768 3:123397482-123397504 TTAAAATTAGCCAGGCAAGGTGG + Intronic
961176345 3:124838425-124838447 TTAAGATTGGCATGGGAAGCAGG - Intronic
961372099 3:126437745-126437767 ATGAATTTAGTCTGGGAAGAGGG + Exonic
961479189 3:127168586-127168608 TTATATTTAGCCTGTGCTGCCGG + Intergenic
961692773 3:128682018-128682040 GAAAATTTGGCCTGGGAAGCAGG + Intergenic
964690808 3:159447689-159447711 TCATATTGAGCCTGGGAAGCAGG - Intronic
964765546 3:160175511-160175533 TTAAATTTGGCCTGGCACGGTGG + Intergenic
965582640 3:170285894-170285916 TTAAAATTAGCCAGGGATGGTGG - Intronic
968717837 4:2174973-2174995 TTAAAATTAGCCTGGCATGGTGG - Intronic
970877212 4:20885101-20885123 CCAAAGTTAGCTTGGGAAGCAGG - Intronic
970945038 4:21681251-21681273 TTAAAATTAGCCTGGCATGGTGG - Intronic
972482099 4:39506644-39506666 TTAAATTTAGGTTGGTAACCGGG + Intronic
974878628 4:67727081-67727103 ATAAAATTAGCCAGGGAAGAAGG + Intergenic
979357764 4:119725679-119725701 TTCAACTTGGCCTTGGAAGCTGG - Intergenic
980047978 4:128010374-128010396 ATAAAATTAGCCTGGCATGCTGG + Intronic
980677727 4:136110771-136110793 TTAAATTTGGCCTGGTGAGGTGG - Intergenic
980771122 4:137374383-137374405 TTAAAATTAACCCGGGAAGAAGG - Intergenic
981489584 4:145325435-145325457 TGATATTTAGGCTGGGCAGCAGG + Intergenic
982104855 4:152002963-152002985 TAAAATTTCACCTGGGAAGCTGG + Intergenic
982666638 4:158272601-158272623 TTAAAATTAGCCTGGCATGATGG + Intergenic
983130380 4:164012108-164012130 TTAAATTTATTCTGGGACCCAGG - Intronic
986343086 5:6808867-6808889 TTAATTTTGGCCAAGGAAGCTGG + Intergenic
986797305 5:11224478-11224500 TTAAATACAGCCAGGGAAGGAGG - Intronic
988224048 5:28389349-28389371 GTAAATTTATCCTGAGAAGTAGG + Intergenic
988557865 5:32253772-32253794 TTAAAATTAGCCTGGTAAGGTGG - Intronic
991406008 5:66301756-66301778 TTAAAATTAGCCTGGCATGGTGG + Intergenic
991702109 5:69325994-69326016 TAAAAATTAGCCTGGCAAGGTGG - Intronic
994805344 5:104440142-104440164 TTAAATTTACCCTGGGCCACAGG + Intergenic
995616048 5:113965446-113965468 GTAAACTTGGGCTGGGAAGCTGG + Intergenic
997487515 5:134243903-134243925 TTAAAATTAGCCTGGCATGGTGG - Intergenic
998739434 5:145181998-145182020 TAAAAATTAGCCTGGCATGCTGG + Intergenic
999629410 5:153554644-153554666 TAAAAATTAGCCTGGCATGCTGG - Intronic
1000444377 5:161301837-161301859 TTAAAGCTGGACTGGGAAGCAGG - Intronic
1000479305 5:161751723-161751745 CAAAATCCAGCCTGGGAAGCTGG - Intergenic
1001815316 5:174663837-174663859 TTTATTTCAGCTTGGGAAGCTGG + Intergenic
1003723060 6:8727005-8727027 TAAAATTTAGCCTCTGAATCTGG + Intergenic
1004158742 6:13194588-13194610 TTAAATGTACCCTGGGAAGATGG - Intronic
1004691044 6:17992425-17992447 TTAGATTTGGCATGGGAAGCAGG - Intergenic
1005226169 6:23644719-23644741 TTAAAGTTTACCTGGGAAGTAGG - Intergenic
1006356164 6:33559431-33559453 TTAAAATTAGCCAGGCATGCTGG + Intergenic
1007453367 6:41957286-41957308 TTAAATTTAACCTGATAAGCAGG - Intronic
1009324240 6:62330200-62330222 TTAAATTTAGCCTGAGATGTGGG + Intergenic
1009511283 6:64552625-64552647 TTGAATTTGGCCTGGCAAGGTGG + Intronic
1015653312 6:135488175-135488197 ATAAATTTTGCCTGGAATGCAGG + Intronic
1017746807 6:157454531-157454553 TGAACTCTAGCCTGGGAAACAGG - Intronic
1018303277 6:162426597-162426619 TGAAAATTAGCCAGGCAAGCTGG - Intronic
1018609750 6:165636614-165636636 TTGCATTTAGGGTGGGAAGCTGG - Intronic
1019290527 7:248017-248039 TTAAATTTAGCCCTGGAATGAGG + Intronic
1019747205 7:2707636-2707658 TTGACTTTAGCCTGGGCAGTGGG - Intronic
1019791362 7:3015943-3015965 TTAAAATTAGCCGGGGATGGTGG + Intronic
1020054089 7:5105013-5105035 TTAAAATTAGCCTGCCATGCTGG - Intergenic
1020167377 7:5818518-5818540 TTAAAATTAGCCGGGCATGCTGG - Intergenic
1021604599 7:22397409-22397431 TTAATTTGGGCCTGGGAAGGTGG - Intergenic
1022679175 7:32527882-32527904 TAAAATTTAACCTGGGAGACTGG + Intronic
1024161196 7:46678280-46678302 TGAAATTTGGCCTGGGAACAGGG + Intronic
1028146695 7:87327679-87327701 TTCAATCTAGCCTGGTAAACTGG - Intergenic
1028611223 7:92714181-92714203 TTAACTTTATCCTGGGGAGTTGG + Intronic
1029600507 7:101560581-101560603 TTAAAGTTAGCCTGGCATGGTGG + Intergenic
1031748719 7:125541417-125541439 TTGAATTTAGCCTGGTAAGATGG - Intergenic
1036724354 8:11206446-11206468 TTAAAATTAGCCTGGCATGGTGG + Intergenic
1037529655 8:19760184-19760206 TTAAATTTAGCCAGGTATGGTGG + Intergenic
1038973303 8:32662353-32662375 TTAAGTGTAGCATGGGAGGCAGG + Intronic
1040416368 8:47199238-47199260 TTAAAATTAGCCAGGCATGCTGG - Intergenic
1044694405 8:94908520-94908542 TAAAAATTAGCCAGGGAAGAGGG - Intronic
1045707659 8:104944992-104945014 GCAAATTTAGCCAGGGAAGAAGG - Intronic
1051739582 9:20238555-20238577 TTAAATGGGGCCTGGGGAGCAGG + Intergenic
1053243892 9:36518833-36518855 TGAAAATTAGCCTGGTGAGCTGG - Intergenic
1053690255 9:40583350-40583372 TTAAATTTAGCCAGGTGTGCCGG + Intergenic
1054301505 9:63384310-63384332 TTAAATTTAGCCAGGTGTGCCGG + Intergenic
1054928022 9:70607616-70607638 ATAAGATTCGCCTGGGAAGCTGG + Intronic
1056528234 9:87463896-87463918 TTAAAATTAGCCTGGCATGGTGG + Intergenic
1056925261 9:90828988-90829010 TTAAAAATCACCTGGGAAGCAGG + Intronic
1057699603 9:97354192-97354214 TCAAGATTAGCCTGGGCAGCAGG - Intronic
1057850322 9:98561729-98561751 TTAAAATTAGCCTGGCATGGTGG + Intronic
1058387622 9:104457347-104457369 TTAAAATAACCCTAGGAAGCAGG + Intergenic
1058586133 9:106507848-106507870 TTAACTTGAACCTGGGAGGCAGG + Intergenic
1058623803 9:106913353-106913375 TTAATTTTCTCCTGGAAAGCAGG + Intronic
1059468687 9:114486801-114486823 TTTTTTTTTGCCTGGGAAGCTGG - Intronic
1060559499 9:124531134-124531156 TTATAGTTAGGCAGGGAAGCTGG + Intronic
1060656273 9:125374644-125374666 TTAATTTTACTCTGGGAAGGTGG + Intergenic
1061909508 9:133715295-133715317 TTTTAATTAGCCTGGGGAGCCGG - Intronic
1194180501 X:90705806-90705828 TTAAATTTACCCTAGGAAGAAGG + Intergenic
1194807392 X:98346203-98346225 TTAAATTTGGCCTTGAAATCAGG + Intergenic
1200414029 Y:2889584-2889606 ATAATTTTAGCCTGGCATGCTGG - Intronic
1200527164 Y:4287966-4287988 TTAAATTTACCCTAGGAAGAAGG + Intergenic