ID: 950059448

View in Genome Browser
Species Human (GRCh38)
Location 3:10057660-10057682
Sequence GCCTCCATTAAGTTTTAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 1, 2: 2, 3: 22, 4: 126}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950059441_950059448 20 Left 950059441 3:10057617-10057639 CCCCTCAAAGTGCTGTGATTACA 0: 126
1: 14573
2: 326031
3: 264002
4: 141815
Right 950059448 3:10057660-10057682 GCCTCCATTAAGTTTTAAGATGG 0: 1
1: 1
2: 2
3: 22
4: 126
950059440_950059448 30 Left 950059440 3:10057607-10057629 CCTGTCTCAGCCCCTCAAAGTGC 0: 4
1: 271
2: 6882
3: 80852
4: 201245
Right 950059448 3:10057660-10057682 GCCTCCATTAAGTTTTAAGATGG 0: 1
1: 1
2: 2
3: 22
4: 126
950059443_950059448 18 Left 950059443 3:10057619-10057641 CCTCAAAGTGCTGTGATTACAGG 0: 41
1: 4199
2: 5495
3: 4463
4: 4966
Right 950059448 3:10057660-10057682 GCCTCCATTAAGTTTTAAGATGG 0: 1
1: 1
2: 2
3: 22
4: 126
950059442_950059448 19 Left 950059442 3:10057618-10057640 CCCTCAAAGTGCTGTGATTACAG 0: 9
1: 506
2: 5205
3: 6507
4: 5521
Right 950059448 3:10057660-10057682 GCCTCCATTAAGTTTTAAGATGG 0: 1
1: 1
2: 2
3: 22
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950059448 Original CRISPR GCCTCCATTAAGTTTTAAGA TGG Intronic
901602724 1:10434519-10434541 GCCTCCTTTCACCTTTAAGAGGG + Intronic
908342640 1:63197407-63197429 GCCACCATAGAGTGTTAAGAAGG + Intergenic
913998901 1:143675606-143675628 TCCTGCATTAAGTTTAAAGAAGG + Intergenic
914793984 1:150904504-150904526 ATCTCCAGTAAGTTTGAAGATGG - Intergenic
915080962 1:153351993-153352015 AGATCCATTAAATTTTAAGAGGG + Intergenic
915408150 1:155677823-155677845 GCCTGCACTTAGTTTTAACAAGG + Intronic
915628095 1:157128965-157128987 TTCTCCATTAAGTTTTAAGATGG - Intronic
919412972 1:197269570-197269592 GCCCACATTAAGTTTCAAGGAGG - Intronic
920412764 1:205775040-205775062 GCCTCACTTCAGTTTGAAGAGGG - Exonic
924526898 1:244860854-244860876 GCCTCCCTTCAGTTTTAATGTGG - Intronic
1066107930 10:32171920-32171942 GCCTCCATTAATTCTTAAAACGG + Intergenic
1066353113 10:34655777-34655799 GTCTCCAGTTACTTTTAAGATGG - Intronic
1066504053 10:36023655-36023677 GACACCATAAAGTTTTAAGCAGG - Intergenic
1068486708 10:57667796-57667818 GCATGCATAAATTTTTAAGAAGG - Intergenic
1070176093 10:73970695-73970717 GCCTTTATTCAGTCTTAAGATGG + Intergenic
1073260132 10:102183455-102183477 GCCGGCATTCAGTTTTAAAAGGG - Intergenic
1074207434 10:111296110-111296132 GACACCACTAAGTTTTAAGGTGG + Intergenic
1074462960 10:113655261-113655283 GCCTCCATTAAAATTTAAAAGGG + Intronic
1078999459 11:16738985-16739007 GCCTCCCTTAATCTTTATGAGGG + Intronic
1080342336 11:31280353-31280375 ATCACCAGTAAGTTTTAAGATGG + Intronic
1080893559 11:36430108-36430130 GCCACCATGTAGTTTCAAGATGG - Intronic
1081047310 11:38292101-38292123 TTCTACATTTAGTTTTAAGAAGG - Intergenic
1081220275 11:40451782-40451804 CCCTCCATTTATTTTTAAGTCGG - Intronic
1082940628 11:58701944-58701966 TCCTCCATTCAGTCTTAAGTTGG + Intronic
1083313671 11:61800650-61800672 GCCTCCACTTAGTTTTGGGAGGG - Exonic
1084235858 11:67787763-67787785 GCCTCTTTTAAGTTTTCAAACGG + Intergenic
1085151535 11:74256281-74256303 TCCTCCATCAAGTGTAAAGAGGG - Intronic
1085175449 11:74482839-74482861 ATCTCCAATAAGTTTTAAGATGG - Intergenic
1086190057 11:84068423-84068445 GCTTGAATTAAGTTTTAAAAGGG - Intronic
1086458666 11:86984203-86984225 GCCTTCAAAAAGTTTGAAGAGGG - Intergenic
1088345674 11:108822026-108822048 ATTTCCATTAAGTTTTAAGATGG + Intronic
1093472432 12:19517040-19517062 GTCAAAATTAAGTTTTAAGATGG - Intronic
1093678703 12:21974945-21974967 GCCTATATTATGTTTTGAGAAGG - Intergenic
1098820447 12:75221103-75221125 CCCTTCATTAATTTTTTAGATGG + Intergenic
1105334861 13:19458082-19458104 ATCTTCAATAAGTTTTAAGATGG + Intronic
1105860059 13:24401309-24401331 ATCTCCAATAAGTTTTAAGATGG - Intergenic
1107489111 13:40863270-40863292 CTCTCCAATAAGTTTTAAGATGG + Intergenic
1108019933 13:46117332-46117354 CTCTCCATTAAGTTTGATGATGG - Intergenic
1108296939 13:49031085-49031107 GTCTGCAGTAAGTTTTAAAATGG - Intronic
1108607333 13:52052738-52052760 GCCACCAGAAATTTTTAAGATGG + Intronic
1115695405 14:35892519-35892541 ATCTCCAATAAGTTTTAAGATGG + Intronic
1117019788 14:51558167-51558189 GCCTCATTTAATTTTTAAAAAGG - Intronic
1117765430 14:59077108-59077130 GCCTACATTAAGGTTTTAAAGGG - Intergenic
1119686261 14:76634316-76634338 ATCTCCAGTGAGTTTTAAGATGG - Intergenic
1122288960 14:100669205-100669227 GCCTCCATTAACTGTTTCGAGGG - Intergenic
1124395336 15:29295662-29295684 GCCACCATTAAGTAATATGAGGG + Intronic
1128431126 15:67595092-67595114 GCCTCCACTTAGATTTAATAAGG + Intronic
1129089253 15:73130986-73131008 GCCTCCATTAACATGTAAGTGGG - Intronic
1129189302 15:73927960-73927982 GCCTCCAGGAAGTTCTAAGGAGG - Intronic
1130708243 15:86253546-86253568 GCCTCCATCAACTTGTAAGGAGG + Intronic
1130733210 15:86521135-86521157 GTTTCCAGTAAGTTGTAAGAAGG + Intronic
1131491878 15:92870171-92870193 GCCTCTTTTAAGTGTTAAGTTGG - Intergenic
1131993730 15:98114559-98114581 GCCTCCACTCAGTTTTACAAAGG + Intergenic
1135796898 16:25454024-25454046 ATCTCCAGTAAGTTTTAAGATGG + Intergenic
1139507823 16:67408092-67408114 TCCTCCATTTAGCTTTGAGATGG - Intronic
1139553672 16:67691877-67691899 ACCTCCAGTATGTTTTCAGAGGG - Intronic
1140962787 16:79932661-79932683 GCTTCAATTAAGATTGAAGAAGG - Intergenic
1156765761 18:40653056-40653078 GACTCAATTTAGTTTTCAGATGG - Intergenic
1157154485 18:45252370-45252392 GCCACCAGCAATTTTTAAGAGGG + Intronic
1159993870 18:74942623-74942645 GCCTCCAGTATGTTTTTATAGGG + Intronic
1163541593 19:17914466-17914488 GCCACCATTTTTTTTTAAGATGG - Intergenic
925095402 2:1194653-1194675 GCCTCCAGTAGGTTTTATAAAGG + Intronic
925460239 2:4056321-4056343 GCTTCCATTTACTTTGAAGAAGG - Intergenic
925569894 2:5297985-5298007 GTCTCTATAGAGTTTTAAGATGG + Intergenic
925894466 2:8460701-8460723 ACCTGAATTAAGTTTTGAGAGGG - Intergenic
926016504 2:9457605-9457627 GCACCTATTAAGTTTAAAGAAGG + Intronic
928211521 2:29327386-29327408 GCATCCATTATGTTTTATGGAGG - Intronic
930356123 2:50323072-50323094 GCTTCCGATAAGTTTTATGAAGG - Intronic
933107968 2:78357290-78357312 GCATCAAATAACTTTTAAGATGG + Intergenic
933111896 2:78412469-78412491 ATATCCAGTAAGTTTTAAGATGG + Intergenic
933873472 2:86594043-86594065 GCCTCCATTAACCTTTTATAAGG + Intronic
934960415 2:98668015-98668037 GCCAGCATTCAGTTTTAAGACGG + Intronic
939855907 2:147358307-147358329 GCCTCCATTAAGTTGAGAGAAGG + Intergenic
940274056 2:151920837-151920859 GCCTCAAGTAAGTTTTAAGATGG - Intronic
940561485 2:155302493-155302515 GCCTACATTAAATTATAGGATGG + Intergenic
940659825 2:156532459-156532481 CCCACCATTAAATTTTAAGGAGG + Intronic
941299902 2:163788100-163788122 GCCTCCATAAAAATTCAAGAGGG - Intergenic
941579685 2:167279552-167279574 GCCACCAATAAATTTTAAAAAGG - Intergenic
942803594 2:179903426-179903448 GCCTCCATCTAGATTTTAGAGGG - Intergenic
947776196 2:232711379-232711401 GCCCTCAATAACTTTTAAGAGGG - Intronic
1174765172 20:53246861-53246883 GCGTACATTAAGTGTTTAGACGG + Intronic
1177259871 21:18715487-18715509 GCATGCTTTAATTTTTAAGAAGG + Intergenic
1177904107 21:26954385-26954407 GTCTCCAGTAACTTCTAAGAAGG + Intronic
1178782938 21:35623387-35623409 GCCTTCCTCAAGTTTTATGATGG + Intronic
950052146 3:10000337-10000359 GCCTCTATTAAGTTTTAAGATGG + Intronic
950059448 3:10057660-10057682 GCCTCCATTAAGTTTTAAGATGG + Intronic
955002031 3:54936536-54936558 GCCTCCATTCAGGTTTATAATGG + Intronic
956122898 3:65983991-65984013 GCCTACACTACCTTTTAAGAAGG - Intronic
956133718 3:66078340-66078362 GCTTCCTTTAACTTTGAAGATGG + Intergenic
957712960 3:83888085-83888107 TTCTCCATTAAGTTTCAATAAGG + Intergenic
959626181 3:108454424-108454446 ACCTGGTTTAAGTTTTAAGATGG + Intronic
959677310 3:109050806-109050828 GCCTGCATTCAGTCTTAAAACGG + Intronic
960641480 3:119828263-119828285 GCATCCATTAACATTTAAGTGGG + Intronic
962003930 3:131329066-131329088 GCCTTAATTAATTTTTAAAAAGG - Intronic
962730203 3:138275010-138275032 ACTTCCATTAAGTTTCAGGAGGG + Intronic
966576467 3:181508255-181508277 GGCTTCATCAAGTTCTAAGAGGG + Intergenic
968175858 3:196549017-196549039 GCCAGCATTCAGTTTTAAAAGGG + Intergenic
974267468 4:59603644-59603666 GCCTCCATCTAGATTTCAGAGGG + Intergenic
974719035 4:65712665-65712687 CCCTTCATTAATTTTTAAGTTGG - Intergenic
975505669 4:75134024-75134046 GCCTCCAGTATGTTTTCTGAGGG - Intergenic
976609486 4:87015253-87015275 GCCTCCTTTTAGAGTTAAGACGG + Intronic
977119417 4:93079037-93079059 GCCTCAATTTAGTTTTGAAAAGG + Intronic
978444195 4:108764898-108764920 GAATCCATAAAGTTTTATGAAGG - Intergenic
981941419 4:150285494-150285516 GCTTCCATTCAGATATAAGACGG + Intronic
983933191 4:173475432-173475454 CCTTCCAGTAAGTTTTAACAGGG - Intergenic
984648266 4:182242459-182242481 GCCACCAAGAAGTTTTAAGAAGG - Intronic
991413898 5:66371636-66371658 GACTCCATGAAATGTTAAGATGG + Intergenic
997667863 5:135646530-135646552 GTCTCCATAAAGTTTTTGGAAGG + Intergenic
998630647 5:143894401-143894423 GCCTCCTTTTAGTTTTAATTTGG + Intergenic
1000477894 5:161733725-161733747 GCCTCCATTAACTTTTAGAATGG + Intergenic
1004490000 6:16105474-16105496 ACATCCATAATGTTTTAAGAAGG - Intergenic
1006469589 6:34220365-34220387 ATCTCCAGTAAGTTTTAAGATGG - Intergenic
1011555770 6:88570184-88570206 GCCTCCATCTAGATTTCAGAGGG - Intergenic
1014085444 6:117337298-117337320 GGCTGCATGAAGTTTTAACATGG + Exonic
1014709092 6:124785621-124785643 GCCTCCATTGAGACTTAAGGTGG + Intronic
1014847482 6:126296472-126296494 ACCTCCATTAGGTTGTTAGAAGG + Intergenic
1015136222 6:129874231-129874253 GATTCCATGAAGTTTTAAGTGGG - Intergenic
1016441362 6:144087479-144087501 GCTTCCTTTCAGTTTTAAAAAGG + Intergenic
1016969363 6:149748508-149748530 GCCTCCAGTAATCTTTTAGAAGG - Intronic
1017795509 6:157840610-157840632 CAATCAATTAAGTTTTAAGAAGG - Intronic
1020482937 7:8684457-8684479 TCCTTCAGTATGTTTTAAGATGG + Intronic
1020546617 7:9541015-9541037 GCCTCCATCTAGATTTCAGAGGG + Intergenic
1021884248 7:25123386-25123408 ATCTCCAGTAAGTTTTAAGATGG + Exonic
1023624299 7:42100878-42100900 TCCTCCCTTAAGATTTCAGAGGG + Intronic
1027125011 7:75550263-75550285 GCATTCCTTAAGTTTTAAGTTGG - Intronic
1029052750 7:97706455-97706477 GCAACTATTAAGTTTTGAGAGGG - Intergenic
1031407107 7:121399069-121399091 ATCTCCAATATGTTTTAAGATGG - Intergenic
1033857028 7:145576017-145576039 CCCTCAATTAAATATTAAGATGG - Intergenic
1034131978 7:148727573-148727595 GCCTGGAGTAAGTGTTAAGAAGG + Intronic
1034851655 7:154499472-154499494 GCCAACATTAAGTCTTGAGATGG + Intronic
1040754980 8:50762177-50762199 ATCTCCAGTAAGTTTTAAGATGG + Intronic
1042692969 8:71523752-71523774 GCTACCATTTTGTTTTAAGATGG + Intronic
1046132435 8:109983179-109983201 GCCCTCAATAATTTTTAAGAGGG - Intergenic
1047090484 8:121568984-121569006 GCCACCAGAAAGTTTTTAGAGGG - Intergenic
1049129043 8:140820398-140820420 GCCTGAATTATGTTTTAACAGGG + Intronic
1050273547 9:3972224-3972246 CCCTCCAGTAAGGCTTAAGATGG + Intronic
1050449048 9:5760456-5760478 GACTACCTTAAGTTTTAAGATGG - Intronic
1054958597 9:70941812-70941834 GAGTCCAATAAGTTTTCAGAAGG - Intronic
1056868411 9:90253168-90253190 GCCTGCATTAACATTTAAAATGG + Intergenic
1057323645 9:94038636-94038658 AACTCCAGTAAGTTTTAAGATGG - Intronic
1058998220 9:110320682-110320704 GCCTTTATTAGATTTTAAGAGGG + Intronic
1185518619 X:719728-719750 GCCACACTTTAGTTTTAAGAAGG + Intergenic
1188880771 X:35489349-35489371 GTCTCCATTGAGTTTAAAGCAGG - Intergenic
1190118658 X:47642524-47642546 GCATTCATTCAGTTTTAGGACGG - Intronic
1192770035 X:74179483-74179505 GACTGCATTAATTATTAAGATGG - Intergenic
1193102424 X:77629617-77629639 GCCCCTCTTAAGTTTTAACAAGG + Intronic
1193830020 X:86278919-86278941 GCCTCCAGAAAGTTTGAAGTGGG + Intronic
1195881707 X:109599903-109599925 GCCTCCTATAAATTTTAACAGGG + Intergenic
1199208474 X:145177194-145177216 AACTCCAATAAGTTTTAAGATGG - Intergenic
1200130568 X:153841861-153841883 ATCTCCAGTAAGTTTTAAGACGG - Intergenic
1201526488 Y:14941237-14941259 ATCTCCAGTAAGTTTTAAGATGG + Intergenic
1202596935 Y:26550041-26550063 ATCTTCATTAAGTTTTAAGATGG - Intergenic