ID: 950060661

View in Genome Browser
Species Human (GRCh38)
Location 3:10069485-10069507
Sequence CATCAGAGGGAGACGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 801
Summary {0: 1, 1: 4, 2: 6, 3: 166, 4: 624}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950060661_950060670 13 Left 950060661 3:10069485-10069507 CCCTCTCCCGTCTCCCTCTGATG 0: 1
1: 4
2: 6
3: 166
4: 624
Right 950060670 3:10069521-10069543 GGACTGTACTGCTGCCATCTCGG 0: 791
1: 492
2: 154
3: 345
4: 7246
950060661_950060667 -8 Left 950060661 3:10069485-10069507 CCCTCTCCCGTCTCCCTCTGATG 0: 1
1: 4
2: 6
3: 166
4: 624
Right 950060667 3:10069500-10069522 CTCTGATGCCGAGCCAAAGCTGG 0: 142
1: 549
2: 481
3: 358
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950060661 Original CRISPR CATCAGAGGGAGACGGGAGA GGG (reversed) Intronic
900298789 1:1966226-1966248 CAGGAGAGGGTGGCGGGAGATGG + Intronic
900746151 1:4362060-4362082 CAGCTGGGGGAGAGGGGAGATGG + Intergenic
900816258 1:4848660-4848682 CTTCACAGGGAGAGGGGAGATGG + Intergenic
900916664 1:5644338-5644360 CAGCAGAGGAAGCCGGGAAAGGG + Intergenic
901108485 1:6776377-6776399 CATCAGAGTGAGACTTGAGATGG + Intergenic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901428331 1:9197691-9197713 GAGGAGAGGGAGACTGGAGAGGG - Intergenic
901669434 1:10847004-10847026 CATCAGATGGAGACCCCAGAAGG - Intergenic
901961318 1:12828583-12828605 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901967910 1:12883188-12883210 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901975714 1:12942318-12942340 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901983308 1:13053453-13053475 CCTCAGAGGGAGGCGGCGGAAGG + Intronic
901985702 1:13073878-13073900 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
901996107 1:13152889-13152911 CCTCAGAGGGAGGCGGCGGAAGG + Intergenic
901998780 1:13175465-13175487 CCTCAGAGGGAGGCGGCGGAAGG - Intergenic
902009460 1:13259447-13259469 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902017266 1:13318592-13318614 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902018440 1:13327503-13327525 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
902018446 1:13327522-13327544 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
902018452 1:13327541-13327563 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
902018458 1:13327560-13327582 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
902018464 1:13327579-13327601 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
902018470 1:13327598-13327620 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
902018476 1:13327617-13327639 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
902018482 1:13327636-13327658 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
902018488 1:13327655-13327677 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
902339330 1:15772455-15772477 CATGAGAGGGAGGGGGGAGTGGG + Intronic
902595942 1:17509549-17509571 CTTCAGAGGGGCAGGGGAGAGGG + Intergenic
902919597 1:19657981-19658003 CATCCCTGGGAGAGGGGAGAAGG - Exonic
902939205 1:19787607-19787629 CATCAGATGGGGAAGGGAGATGG + Intronic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903147868 1:21387055-21387077 GGGGAGAGGGAGACGGGAGAGGG - Intergenic
903338989 1:22642673-22642695 GAGAAGAGGGAGAGGGGAGAAGG + Intergenic
903638148 1:24834799-24834821 AGGGAGAGGGAGACGGGAGAGGG + Intronic
903638154 1:24834818-24834840 AGGGAGAGGGAGACGGGAGAGGG + Intronic
903638160 1:24834837-24834859 AGGGAGAGGGAGACGGGAGAGGG + Intronic
903638166 1:24834856-24834878 AGGGAGAGGGAGACGGGAGAGGG + Intronic
903638170 1:24834869-24834891 CGGGAGAGGGAGACGGGAGAGGG + Intronic
903638176 1:24834888-24834910 AGGGAGAGGGAGACGGGAGAGGG + Intronic
903638180 1:24834901-24834923 CGGGAGAGGGAGACGGGAGAGGG + Intronic
903638188 1:24834926-24834948 AGGGAGAGGGAGACGGGAGAGGG + Intronic
903638194 1:24834945-24834967 AGGGAGAGGGAGACGGGAGAGGG + Intronic
903638198 1:24834958-24834980 CGGGAGAGGGAGACGGGAGAGGG + Intronic
903638204 1:24834977-24834999 AGGGAGAGGGAGACGGGAGAGGG + Intronic
903921802 1:26804853-26804875 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
903921808 1:26804872-26804894 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
903921814 1:26804891-26804913 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904039865 1:27577515-27577537 CATCTGGGGGTGAGGGGAGATGG + Intronic
904305285 1:29585023-29585045 CATCAGAGGAGGGAGGGAGACGG + Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
904899867 1:33848406-33848428 AATCAGTGGGAGACTGGAGGAGG - Intronic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
908046230 1:60172090-60172112 CAAGAGAGGGATGCGGGAGAGGG - Intergenic
908370037 1:63472494-63472516 CATCAGAGGGAGACCATGGAAGG - Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
910450734 1:87342026-87342048 CATCAGAAGGAGTGGAGAGAAGG - Intronic
910777688 1:90892511-90892533 CATCAGAGGGAGACGTGGAGAGG + Intergenic
910806350 1:91192724-91192746 CTTCAGAGGGAGTGGGGACACGG + Intergenic
910830262 1:91454098-91454120 CATGAGAGGGAAATGGGTGAAGG - Intergenic
911568535 1:99494305-99494327 CACCAGAGGGAGAAGGCACAAGG - Intergenic
912052188 1:105542863-105542885 CTTCACAGGGAGGCAGGAGAGGG + Intergenic
912303119 1:108536854-108536876 GAGAGGAGGGAGACGGGAGAGGG + Intergenic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914707816 1:150185569-150185591 CGTCAGGGGGAGGCAGGAGAAGG + Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915388471 1:155518784-155518806 CAGGAGAGGTAGAGGGGAGACGG + Intronic
915528482 1:156490227-156490249 CATGAGAAGGAGACCCGAGAGGG - Intronic
915607161 1:156959822-156959844 GATTAGAAGGAGAAGGGAGACGG + Intronic
916008199 1:160680858-160680880 CATCAGGGTGAGCAGGGAGAAGG - Intronic
916040228 1:160955130-160955152 CATCTGGGGGAGGTGGGAGAGGG - Intergenic
916320666 1:163499733-163499755 CAAGAGAGGGAGACCGTAGAAGG + Intergenic
916594289 1:166228034-166228056 CATCAGTGGTAGACTGGATAAGG - Intergenic
917295924 1:173519165-173519187 CATCAGAGAGAGATGTGTGAAGG + Intronic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
917596557 1:176535024-176535046 AACCAGAGGGAGACTGTAGAAGG + Intronic
917722219 1:177796682-177796704 CTTCAGAGAGGGACAGGAGAGGG - Intergenic
917848617 1:179041679-179041701 AGGGAGAGGGAGACGGGAGACGG + Intronic
918015349 1:180628328-180628350 CAACAGAGGGAGAAGGAAGAAGG - Intergenic
920780906 1:208990187-208990209 AAACAGAGGGAGAGGGGAAAGGG + Intergenic
922306689 1:224350665-224350687 CGGGAGAGGGAGACGGGAGAGGG + Intergenic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922812733 1:228426836-228426858 CGCCAGAGAGAGAGGGGAGAGGG - Intergenic
923321269 1:232835991-232836013 CATCCAAGTGAGACAGGAGAAGG - Intergenic
923841037 1:237670326-237670348 AGGGAGAGGGAGACGGGAGAGGG + Intronic
923994053 1:239471635-239471657 CCTCAGTGGGAGAGGAGAGAAGG - Intronic
924037145 1:239949300-239949322 AATCAGATGGAGACGGGAACGGG - Intergenic
924719983 1:246613696-246613718 CAGAAGAGGGAGACGGGAAGAGG - Intronic
924943591 1:248829775-248829797 CATCAGAGGGAGACCGTGCAGGG - Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063501834 10:6562264-6562286 CTTGTGAGGGAGACAGGAGATGG - Intronic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1065840144 10:29695798-29695820 CGGGAGAGGGAGACGGGAGAGGG - Intronic
1065840148 10:29695811-29695833 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1065840154 10:29695830-29695852 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1065840162 10:29695855-29695877 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1065840168 10:29695874-29695896 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1065840174 10:29695893-29695915 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1065840180 10:29695912-29695934 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1065840192 10:29695949-29695971 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1066085112 10:31968968-31968990 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1066085118 10:31968987-31969009 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1066085124 10:31969006-31969028 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1066085130 10:31969025-31969047 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1066085136 10:31969044-31969066 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1066085142 10:31969063-31969085 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1066085148 10:31969082-31969104 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1066085154 10:31969101-31969123 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1066174889 10:32893284-32893306 CAACAGAGGGAGGCGGGAAGCGG + Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069607699 10:69750106-69750128 CCACAGAGGGAGACGAGAGGAGG - Intergenic
1069741622 10:70688829-70688851 CATGAGAGGGAGACCGGAGGGGG + Intronic
1070617072 10:77977420-77977442 CATCAGCTGGAGACAGGACAAGG + Exonic
1070791010 10:79189360-79189382 CATCAGAGGCAGAAGGAAGCTGG - Intronic
1070845235 10:79516928-79516950 CTTCTCAGGGAAACGGGAGATGG - Intergenic
1071173704 10:82898600-82898622 AATCAGAGTGAGAAGGGAAAGGG + Intronic
1071265068 10:83957714-83957736 CAAGAGAGGGAGCTGGGAGAAGG + Intergenic
1071530633 10:86388418-86388440 CCTCTGAGGGAGGCGGGAGGCGG - Intergenic
1072180135 10:92974548-92974570 GGGGAGAGGGAGACGGGAGAGGG - Intronic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1072999450 10:100276308-100276330 AGAGAGAGGGAGACGGGAGAGGG - Intronic
1072999458 10:100276340-100276362 CGGGAGAGGGAGACGGGAGAGGG - Intronic
1072999462 10:100276353-100276375 CGGGAGAGGGAGACGGGAGAGGG - Intronic
1072999466 10:100276366-100276388 CGGGAGAGGGAGACGGGAGAGGG - Intronic
1072999470 10:100276379-100276401 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1072999476 10:100276398-100276420 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1072999482 10:100276417-100276439 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1072999488 10:100276436-100276458 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1072999494 10:100276455-100276477 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1072999500 10:100276474-100276496 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1072999508 10:100276499-100276521 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1073122887 10:101132891-101132913 CAGCAGAGGAAGGCGGGAGCGGG - Intronic
1073288242 10:102401023-102401045 CTTCAGAAGGAGGCGGGTGAGGG - Exonic
1074509825 10:114101792-114101814 CATGTGAGGGAGACAGGACAAGG - Intergenic
1074843887 10:117379779-117379801 CATCAAGGAGAGAAGGGAGATGG + Intergenic
1074897711 10:117791464-117791486 GGTCAGAGGGAGACTGAAGAAGG - Intergenic
1074944498 10:118268254-118268276 CATCAGAGGATGACCGGAAATGG - Intergenic
1076108990 10:127846655-127846677 CATCACTGGGAGAAGGGAGGTGG - Intergenic
1076284680 10:129282000-129282022 CATAGGAGGGAGAGGGTAGAGGG - Intergenic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078755781 11:14207961-14207983 CATCAGTGGTAGACTGGATAAGG + Intronic
1081785683 11:45745245-45745267 CAGCCAAGGGAGACAGGAGAGGG + Intergenic
1082871168 11:57944618-57944640 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1083616348 11:64028420-64028442 CTGCAGAGGGAGGAGGGAGAGGG + Intronic
1083765713 11:64840500-64840522 CATCCTAGGGACACAGGAGAGGG - Intronic
1083865259 11:65450316-65450338 CGGGAGAGGGAGACGGGAGAGGG - Intergenic
1083865263 11:65450329-65450351 CGGGAGAGGGAGACGGGAGAGGG - Intergenic
1083865267 11:65450342-65450364 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1083865273 11:65450361-65450383 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1083865279 11:65450380-65450402 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1084303750 11:68267954-68267976 CATCAGAGGGTCAAGGGAAAAGG - Intronic
1084582470 11:70032516-70032538 GAGCAGAGGGAGGCGGGAGAGGG + Intergenic
1085116894 11:73937671-73937693 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1085116904 11:73937702-73937724 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1085116910 11:73937721-73937743 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1085157472 11:74309482-74309504 GCTCAGATGGAGACGGGAGTGGG - Intronic
1085410139 11:76285937-76285959 CATCAGATGGACAAGGGAGTGGG + Intergenic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085754201 11:79190776-79190798 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754209 11:79190801-79190823 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754221 11:79190839-79190861 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754227 11:79190858-79190880 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754233 11:79190877-79190899 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754239 11:79190896-79190918 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754245 11:79190915-79190937 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754251 11:79190934-79190956 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754260 11:79190960-79190982 AGGGAGAGGGAGACGGGAGACGG - Intronic
1085754265 11:79190979-79191001 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754271 11:79190998-79191020 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754277 11:79191017-79191039 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754283 11:79191036-79191058 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754289 11:79191055-79191077 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754295 11:79191074-79191096 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754303 11:79191099-79191121 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754311 11:79191124-79191146 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1086115630 11:83246550-83246572 GAGCAGAGAGAGACAGGAGAGGG + Intronic
1086504774 11:87493864-87493886 CCTCAGAAGGTGACTGGAGAGGG - Intergenic
1086813705 11:91342420-91342442 CAACAGGGGGAGAGGAGAGAAGG + Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1088184103 11:107144246-107144268 CAGCAGTGGGAGACTGTAGAGGG - Intergenic
1088432466 11:109773915-109773937 CCTCAGAGGGAGAAGGAGGAAGG - Intergenic
1088496615 11:110437788-110437810 TACCAGAGGGGGAAGGGAGAGGG - Intronic
1088799611 11:113293519-113293541 CAACAGAGGAAGGCGGGGGAGGG - Intergenic
1088887921 11:114022047-114022069 GATCAGAAGAAGACAGGAGAAGG + Intergenic
1089469083 11:118706520-118706542 GGCCAGAGGGAGACAGGAGAGGG - Intergenic
1089496278 11:118910063-118910085 TGTCAGAGGGGGAGGGGAGAAGG + Exonic
1089526025 11:119097245-119097267 CACCAGAGTGAGACTGAAGATGG - Exonic
1089742773 11:120596456-120596478 CTTCAGAGAGAGACTGGAGAAGG + Intronic
1089770962 11:120802612-120802634 CAGCAGGGGGAGGCTGGAGAAGG + Intronic
1090376709 11:126294702-126294724 CATGATAGGGAGAAGTGAGAGGG - Intronic
1090596418 11:128325332-128325354 CTTCTGAGGGAGAAGGTAGATGG + Intergenic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091242796 11:134065335-134065357 CCTTAGAGGGAGGTGGGAGAAGG + Intergenic
1091378391 12:41237-41259 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1091378397 12:41256-41278 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1091378403 12:41275-41297 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1091584591 12:1808905-1808927 CATGAAAGGGAGAAGGGGGAGGG + Intronic
1092181745 12:6451207-6451229 GGGCAGGGGGAGACGGGAGAAGG - Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092487293 12:8914188-8914210 GAGGAGAGGGAGATGGGAGAAGG - Intronic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1092938915 12:13389555-13389577 CATCTGGGGGTGATGGGAGACGG - Intergenic
1093316500 12:17657631-17657653 CCTGAGAGGGACACTGGAGAAGG - Intergenic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1095539855 12:43296922-43296944 CATCAGTGGTAGACTGGATAAGG + Intergenic
1096039581 12:48501481-48501503 CATGAGAGGGAGACCGTGGAAGG + Intergenic
1096751104 12:53759306-53759328 CAGCATAGGGAGAAAGGAGAAGG + Intergenic
1097689856 12:62724526-62724548 CCTCAGAGGGAGAGGGTAGGTGG - Intronic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1099436826 12:82655985-82656007 GATCAGAGTGGGAAGGGAGAGGG + Intergenic
1100570932 12:95842373-95842395 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1100570938 12:95842392-95842414 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1100570944 12:95842411-95842433 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1100570950 12:95842430-95842452 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1100570956 12:95842449-95842471 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1100570962 12:95842468-95842490 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1100570968 12:95842487-95842509 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1100570974 12:95842506-95842528 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1101397696 12:104363028-104363050 CAGCAGAGGGAGATGGTAAAGGG + Intergenic
1102825926 12:115947924-115947946 CACCAGGGGGAGACGAGTGAAGG + Intergenic
1104258157 12:127157943-127157965 CAGCAAAGGGAGATAGGAGAGGG - Intergenic
1104502595 12:129300949-129300971 TATAAGAGGGAGACAGGAGTGGG - Intronic
1106434264 13:29709832-29709854 CATCAGAAGGAGACTGCAGGAGG + Intergenic
1106521025 13:30497838-30497860 CATCAGTGGTAGACTGGATAAGG - Intronic
1106679970 13:31999469-31999491 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1106701044 13:32228921-32228943 CAGCAGATGGAGGCAGGAGATGG + Intronic
1107274813 13:38666497-38666519 CATCATAGGGAGTGGGGAGAAGG - Intergenic
1107562504 13:41571274-41571296 CGGGAGAGGGAGACGGGAGAGGG - Intronic
1107562508 13:41571287-41571309 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1107562519 13:41571319-41571341 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1107562525 13:41571338-41571360 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1107737880 13:43417187-43417209 CAACAGAGGGAGACGGGAGACGG + Intronic
1107953525 13:45486284-45486306 GACCATCGGGAGACGGGAGACGG + Intronic
1111048680 13:82849100-82849122 CATCAGAGTGAGAAAGGAAAAGG - Intergenic
1111489538 13:88953903-88953925 CATCAGCTGAAGACTGGAGATGG + Intergenic
1112250451 13:97774481-97774503 CAACAGAGGCAGATGGAAGAAGG - Intergenic
1113401443 13:109997747-109997769 CATCTGGGGGTGATGGGAGACGG - Intergenic
1113580568 13:111425793-111425815 CAAGAGTGAGAGACGGGAGAGGG - Intergenic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1114058404 14:18996653-18996675 CATCTGGGGGTGATGGGAGATGG - Intronic
1114104142 14:19405101-19405123 CATCTGGGGGTGATGGGAGATGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114427501 14:22636434-22636456 CATCAGAGGGAGACCCTGGAGGG - Intergenic
1114757330 14:25274242-25274264 CATCAGAGAGAAAAGGGAGTAGG + Intergenic
1115490368 14:33952492-33952514 CCTCAGAGGCAGAGAGGAGAGGG - Intronic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116840949 14:49820641-49820663 CATGAGAGGGAGACCGTGGAAGG - Intronic
1117642552 14:57815590-57815612 CATCAGAGGTAGAAGTAAGAAGG - Intronic
1117728661 14:58698880-58698902 CTTCAGAGGGAGACAGGTGGAGG + Intergenic
1118013243 14:61631572-61631594 CATCAGTGGGGGACAGGAGCTGG + Intronic
1118062181 14:62151591-62151613 CATGAGAGGGAGAAAGGAGGGGG + Intergenic
1118341420 14:64896659-64896681 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1118341426 14:64896678-64896700 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1118341432 14:64896697-64896719 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1118341438 14:64896716-64896738 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1118341444 14:64896735-64896757 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1118341450 14:64896754-64896776 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1118341456 14:64896773-64896795 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1118341462 14:64896792-64896814 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1119190155 14:72676005-72676027 CAATTGAGGGAGAAGGGAGAAGG - Intronic
1121321650 14:92995065-92995087 CACCACTGGGAGCCGGGAGAGGG + Intronic
1121914281 14:97821568-97821590 CTTCAGAAGGTGACAGGAGAGGG - Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122569029 14:102681744-102681766 CATCAGAGTGAGGATGGAGATGG - Intronic
1123103151 14:105819160-105819182 AGGCAGAGGGAGACGTGAGAAGG - Intergenic
1125868324 15:43075998-43076020 CATCAGAGGGAGACCATGGAAGG - Intronic
1125943769 15:43696836-43696858 GTTCAGAGGGAGACTGGGGAAGG + Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126799268 15:52285452-52285474 GAGAGGAGGGAGACGGGAGAGGG - Intronic
1127360799 15:58243394-58243416 CATCTGGGGAAGAAGGGAGATGG - Intronic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1127762770 15:62155335-62155357 CAGCAGAGGAATACTGGAGACGG + Intergenic
1128891605 15:71336999-71337021 AATCAGAGAGAGAGGGGAGAGGG + Intronic
1129989194 15:79947427-79947449 CATTGGAGGGAGAGGAGAGAAGG + Intergenic
1130720973 15:86385968-86385990 GATGAGAGGGAGAGGGGAGGAGG - Intronic
1130720990 15:86386013-86386035 GATGAGAGGGAGAGGGGAGGAGG - Intronic
1130894913 15:88162460-88162482 CAGCAGAAGGAGAGGGGAGAAGG + Intronic
1131479552 15:92769334-92769356 GGGGAGAGGGAGACGGGAGAGGG + Intronic
1131479579 15:92769422-92769444 GGGGAGAGGGAGACGGGAGAGGG + Intronic
1133233613 16:4377762-4377784 CATCAAAGGGAGGAGGGAGGAGG - Intronic
1133365206 16:5203715-5203737 CATCAGAAGGAGACCGTGGAGGG + Intergenic
1133606153 16:7390095-7390117 AAACAGAGCGAGAAGGGAGAGGG + Intronic
1134248733 16:12559381-12559403 CTTCAGGGGGCGATGGGAGAGGG - Intronic
1134750316 16:16619849-16619871 CGGGAGAGGGAGACGGGAGGGGG + Intergenic
1134995142 16:18733749-18733771 CGGGAGAGGGAGACGGGAGGGGG - Intergenic
1136381510 16:29898189-29898211 CAGCCCAGGGAGAAGGGAGAGGG - Intronic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1138650642 16:58459056-58459078 CAGCAGATGGAGATGGGAGGCGG - Intergenic
1138699493 16:58847020-58847042 CATGAGAGGGAGACCGTGGAGGG + Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1140958770 16:79892707-79892729 GCTCAGAGGGAGATGGGAGGGGG - Intergenic
1141660361 16:85438047-85438069 CATCTGGGGGAGGCGGGAGAGGG + Intergenic
1141859194 16:86704917-86704939 CAGCAGAGGTAGAGGTGAGATGG + Intergenic
1141866196 16:86751771-86751793 CAACAGAGGGTGCCGGGGGAGGG - Intergenic
1142700267 17:1655520-1655542 AATCAGGATGAGACGGGAGAAGG + Exonic
1142753590 17:2002690-2002712 CAACAGAGAGAGACGGGCGTGGG - Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1143041760 17:4043422-4043444 CATCAGATAGAGAGGGCAGAAGG + Intronic
1143814031 17:9496760-9496782 CATCAGAGGGAGTATGAAGAAGG + Intronic
1144076363 17:11723142-11723164 CATTAGAGAGAGACGGGACTAGG - Intronic
1144386741 17:14755187-14755209 TGTCAGAAGGAGATGGGAGATGG + Intergenic
1144763046 17:17718121-17718143 AAGCAGGGGGAGAGGGGAGAGGG - Intronic
1145733429 17:27211250-27211272 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1145733441 17:27211288-27211310 AGGCAGAGGGAGACGGGAGAGGG - Intergenic
1145733452 17:27211326-27211348 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1145733460 17:27211351-27211373 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1145733466 17:27211370-27211392 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1145733472 17:27211389-27211411 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1145733478 17:27211408-27211430 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1147689400 17:42306219-42306241 CCTGAGAGGGAGACAAGAGAGGG - Exonic
1148212671 17:45817768-45817790 CATGGGAGGGACTCGGGAGAGGG + Intronic
1148353575 17:46958652-46958674 CATCAGAGGGAGTGGTGGGAGGG - Intronic
1148458542 17:47824261-47824283 CATCAGAGAGCAACGCGAGAAGG - Exonic
1148598299 17:48874646-48874668 CATCAAGGGGAGACGGGATGGGG - Intergenic
1149546347 17:57506604-57506626 CTTCCGAGGGAGTAGGGAGAAGG + Intronic
1151430027 17:74056107-74056129 GAGAGGAGGGAGACGGGAGAAGG + Intergenic
1151432401 17:74072377-74072399 CCTCAGAGGCACAGGGGAGAAGG - Intergenic
1152003639 17:77663212-77663234 CATCTGGGGGTGATGGGAGATGG - Intergenic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152422351 17:80200795-80200817 CATCTGGGGGTGATGGGAGACGG + Intronic
1152823468 17:82449207-82449229 CTTCAGATGGAGGCGGGAGCTGG + Exonic
1152903979 17:82960592-82960614 CCTCACAGTGACACGGGAGAGGG + Intronic
1153457049 18:5294501-5294523 CTTGAGAGAGAGAGGGGAGAGGG - Intronic
1154146677 18:11872739-11872761 CATCTGAGGGTGAAGTGAGAAGG - Intronic
1154202248 18:12307951-12307973 CGCCAGAGGGAGACGCGAGTCGG - Intronic
1155433367 18:25785609-25785631 CAGCAGAGGCAGAGGGGAGAGGG - Intergenic
1156269050 18:35514332-35514354 CATCAAAGGGAGATGGAGGATGG - Intergenic
1157279444 18:46335969-46335991 CCTCAGATGGAGACAGGAAATGG - Intronic
1157730963 18:50003902-50003924 CATCAGTGGAGGAGGGGAGATGG + Intronic
1158739198 18:60120364-60120386 CATTAGAGGGAGATGGGGGATGG - Intergenic
1158868961 18:61665752-61665774 CATCTGAGGGAGAAGGGGGAAGG - Intergenic
1159751921 18:72313348-72313370 CATCAGTGGTAGACAGGACAAGG + Intergenic
1160080996 18:75727030-75727052 GAGCACAGGGAGAGGGGAGAAGG - Intergenic
1160417522 18:78721439-78721461 CTTCAGAAGGGGAAGGGAGAGGG + Intergenic
1160765909 19:807824-807846 CAGCGGAGGGACAGGGGAGAGGG - Intronic
1161071927 19:2266729-2266751 CATCAGAGGCAGGCAGGAGGAGG + Intronic
1161349575 19:3784452-3784474 CTGCAGAGGGGGCCGGGAGAGGG + Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1164004328 19:21134883-21134905 CAGCAAAGGGAGATAGGAGAGGG + Intergenic
1164066240 19:21720271-21720293 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1164066246 19:21720290-21720312 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1164066252 19:21720309-21720331 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1164066258 19:21720328-21720350 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1164066264 19:21720347-21720369 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1164066270 19:21720366-21720388 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1165295595 19:34923009-34923031 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1165422986 19:35731661-35731683 CAGCAGAGGCAGAGAGGAGATGG + Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166818310 19:45560498-45560520 CAGGAGAGAGAGAAGGGAGATGG - Intronic
1166881240 19:45931388-45931410 CAACAGAGGGGGATGGAAGAAGG - Intergenic
1167547939 19:50140418-50140440 GTGGAGAGGGAGACGGGAGACGG - Intergenic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168402793 19:56095604-56095626 CAACAGAGGAAGGCAGGAGAAGG - Intronic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925522010 2:4757300-4757322 CGTCAGAGGAAGAGGGAAGAAGG - Intergenic
925644709 2:6023940-6023962 CACCAGAGGGAGAAGGTGGAAGG + Intergenic
926190351 2:10723016-10723038 GGTCAGGGGGAGACAGGAGAGGG + Intronic
926909959 2:17843361-17843383 CATGAGAAGAAGACGGGAGAGGG + Intergenic
927148933 2:20184858-20184880 GAACAGAGGGACACTGGAGACGG - Intergenic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928009654 2:27595107-27595129 CAACAGAGGGAGACCGAAGAAGG + Intronic
928542368 2:32295039-32295061 CATCAGAGGGAGAGGGGGAGGGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
930094548 2:47557017-47557039 CATCTGTGGGAGGCTGGAGAAGG + Intronic
930209006 2:48615471-48615493 AGGGAGAGGGAGACGGGAGAGGG + Intronic
930209012 2:48615490-48615512 AGGGAGAGGGAGACGGGAGAGGG + Intronic
930209018 2:48615509-48615531 AGGGAGAGGGAGACGGGAGAGGG + Intronic
930209024 2:48615528-48615550 AGGGAGAGGGAGACGGGAGAGGG + Intronic
930768413 2:55108397-55108419 CAGGAGAGGGAGAAGGGTGAAGG + Intronic
931113308 2:59137090-59137112 CATCAGAAAGAGACAGGATAAGG + Intergenic
931751856 2:65338148-65338170 CGGGAGAGGGAGACGGGAGAGGG - Intronic
931751863 2:65338168-65338190 AGGGAGAGGGAGACGGGAGACGG - Intronic
931751868 2:65338187-65338209 AGGGAGAGGGAGACGGGAGAGGG - Intronic
931751874 2:65338206-65338228 AGGGAGAGGGAGACGGGAGAGGG - Intronic
931751880 2:65338225-65338247 CGGGAGAGGGAGACGGGAGAGGG - Intronic
931751884 2:65338238-65338260 AGGGAGAGGGAGACGGGAGAGGG - Intronic
931751890 2:65338257-65338279 AGGGAGAGGGAGACGGGAGAGGG - Intronic
931751896 2:65338276-65338298 AGGGAGAGGGAGACGGGAGAGGG - Intronic
931751902 2:65338295-65338317 AGGGAGAGGGAGACGGGAGAGGG - Intronic
932132101 2:69197085-69197107 AAAAAGAGGGAGACGGGTGATGG - Intronic
932399214 2:71468156-71468178 CATCAGGTGGACACTGGAGAAGG - Intronic
932451178 2:71811826-71811848 TATTAGAGTGAGATGGGAGAGGG + Intergenic
932568175 2:72922498-72922520 CATCACAGGGAGATGGGTGAGGG - Intronic
933764707 2:85698689-85698711 CAGCAGAGGGAGTCAGGGGAGGG - Exonic
934784865 2:96997681-96997703 CATGAGAGAGAGACGGGAGGGGG + Intronic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
935671719 2:105561899-105561921 CATCTGAGAGAGGCTGGAGATGG - Intergenic
936001310 2:108832921-108832943 GATAAGAGGGAGACAGGAAATGG + Intronic
936158371 2:110064631-110064653 GCAAAGAGGGAGACGGGAGAGGG + Intergenic
936186290 2:110306695-110306717 GCAAAGAGGGAGACGGGAGAGGG - Intergenic
936254900 2:110903211-110903233 GACCAGAGGGAGAGGGGAGAAGG + Intronic
936344346 2:111663795-111663817 CAGCAGAGGGAGACGGCATTTGG - Intergenic
937291751 2:120786010-120786032 CATAAGAGGGAGAAGACAGAGGG + Intronic
937308725 2:120888152-120888174 CTCCAGAGGGAGAAGGGAGTCGG + Intronic
937682111 2:124655140-124655162 CATCAGAGGGTTAGGGGAAAGGG - Intronic
938079544 2:128362457-128362479 CAGTAGATGGAGACGGCAGATGG - Intergenic
938253272 2:129833044-129833066 CATCAGAGGGAGACTGTGGGGGG - Intergenic
938476820 2:131623589-131623611 TATCTGGGGGTGACGGGAGATGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
938720463 2:134063381-134063403 TGGGAGAGGGAGACGGGAGAGGG - Intergenic
938785856 2:134628742-134628764 CAGCAAAGGGAGACGGCACATGG - Intronic
939278086 2:140027702-140027724 CATCTGGGGGTGACGGTAGACGG - Intergenic
939320141 2:140609366-140609388 CATAAGAGAGAGAGGGGAAAAGG - Intronic
939781590 2:146457133-146457155 CATCAGTGGTAGACTGGATAAGG - Intergenic
940161176 2:150715159-150715181 CATCAGAGGGACCTGGTAGAAGG - Intergenic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
941024944 2:160448301-160448323 GCAAAGAGGGAGACGGGAGAGGG - Intronic
941663178 2:168216250-168216272 AATCAGAGGGAGACAGATGAAGG + Intronic
942687193 2:178545751-178545773 AATCAGGGGGAGAAGGGAGAAGG - Intronic
942937431 2:181575115-181575137 CATCAGTGGGAGAAGGGAGAAGG - Intronic
943058901 2:183017377-183017399 CATCTGGGGGTGATGGGAGACGG + Intronic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
943773166 2:191741093-191741115 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
943773172 2:191741112-191741134 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
943773178 2:191741131-191741153 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
943773186 2:191741156-191741178 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
943773198 2:191741195-191741217 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
943773204 2:191741214-191741236 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
943863051 2:192893487-192893509 GCAAAGAGGGAGACGGGAGAAGG - Intergenic
943979473 2:194529638-194529660 CATCTGGGGGTGATGGGAGATGG + Intergenic
945090544 2:206172597-206172619 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090550 2:206172616-206172638 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090556 2:206172635-206172657 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090562 2:206172654-206172676 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090568 2:206172673-206172695 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090574 2:206172692-206172714 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090580 2:206172711-206172733 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090592 2:206172748-206172770 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090604 2:206172785-206172807 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090612 2:206172810-206172832 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090618 2:206172829-206172851 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090626 2:206172854-206172876 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090634 2:206172879-206172901 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090642 2:206172904-206172926 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090650 2:206172929-206172951 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090658 2:206172954-206172976 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090664 2:206172973-206172995 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090670 2:206172992-206173014 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090674 2:206173005-206173027 CGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090680 2:206173024-206173046 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090684 2:206173037-206173059 CGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090690 2:206173056-206173078 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090696 2:206173075-206173097 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090702 2:206173094-206173116 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090708 2:206173113-206173135 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090716 2:206173138-206173160 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
945882599 2:215341957-215341979 CTTCAGAGGGCGGCAGGAGAGGG + Intronic
945970611 2:216227534-216227556 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945970617 2:216227553-216227575 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945970623 2:216227572-216227594 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945970629 2:216227591-216227613 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945970635 2:216227610-216227632 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945970639 2:216227623-216227645 CGGGAGAGGGAGACGGGAGAGGG + Intergenic
945970645 2:216227642-216227664 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945970651 2:216227661-216227683 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945970657 2:216227680-216227702 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945970663 2:216227699-216227721 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945970669 2:216227718-216227740 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945970675 2:216227737-216227759 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945974387 2:216259208-216259230 CAACAGAGGGAGCAGGCAGAGGG - Exonic
946061574 2:216946297-216946319 AAAGAGAGGAAGACGGGAGAAGG - Intergenic
946917960 2:224545707-224545729 TCTCTGAGGGAGAGGGGAGAAGG + Intronic
947004810 2:225498846-225498868 CATTAGAGGGAAAAGGGAGATGG + Intronic
947287220 2:228530281-228530303 CATCTGGGGGTGATGGGAGACGG - Intergenic
1169085316 20:2822522-2822544 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085322 20:2822541-2822563 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085330 20:2822566-2822588 CGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085334 20:2822579-2822601 CGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085338 20:2822592-2822614 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085344 20:2822611-2822633 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085350 20:2822630-2822652 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085356 20:2822649-2822671 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085362 20:2822668-2822690 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085368 20:2822687-2822709 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085374 20:2822706-2822728 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085380 20:2822725-2822747 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085386 20:2822744-2822766 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085392 20:2822763-2822785 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085398 20:2822782-2822804 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085404 20:2822801-2822823 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085410 20:2822820-2822842 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085416 20:2822839-2822861 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085422 20:2822858-2822880 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085428 20:2822877-2822899 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085434 20:2822896-2822918 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085440 20:2822915-2822937 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085446 20:2822934-2822956 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085452 20:2822953-2822975 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085458 20:2822972-2822994 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085464 20:2822991-2823013 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085492 20:2823076-2823098 CCGTGGAGGGAGACGGGAGAGGG - Intergenic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169246719 20:4031872-4031894 CATCAGAGGGGGGCGGGGGAGGG - Intergenic
1169422823 20:5473435-5473457 CATCCGAGGGAGGGAGGAGAGGG + Intergenic
1170684399 20:18555973-18555995 CAGCTGGGGGTGACGGGAGACGG + Intronic
1170786353 20:19470974-19470996 CCTCAGAGGGAGACGGCACAAGG + Intronic
1172127293 20:32632229-32632251 CAGGAGTGGGAGAGGGGAGAAGG + Intergenic
1172198666 20:33110002-33110024 CATTAGGGGGAGCTGGGAGAAGG - Intronic
1173876648 20:46376481-46376503 CATCAGAGGGACAAAGGAGGAGG - Intronic
1174282089 20:49446870-49446892 CTTCAGAGGGAGATGAGGGATGG - Intronic
1175239366 20:57535456-57535478 GGTCAGAGGGAGGCTGGAGAAGG + Intergenic
1175639846 20:60619744-60619766 CTTCAGAGGGAGAGTGGAGTTGG + Intergenic
1175743577 20:61437393-61437415 CGTCACAGGGAGACAGAAGATGG - Intronic
1176024369 20:62978344-62978366 CAGCAGAGGGAGATGGGGGTGGG - Intergenic
1177447137 21:21212390-21212412 CATCAGAGGGGCAAGTGAGAAGG + Intronic
1178075341 21:29010655-29010677 GACCATGGGGAGACGGGAGAGGG - Intronic
1178627055 21:34227146-34227168 CATCGGAGGCAGGAGGGAGAGGG + Intergenic
1179195007 21:39156532-39156554 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1179195015 21:39156557-39156579 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1179195023 21:39156582-39156604 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1179195029 21:39156601-39156623 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1179195037 21:39156626-39156648 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1179532404 21:42028867-42028889 CAGCATAGGGAGGCTGGAGAGGG + Intergenic
1179614562 21:42573391-42573413 CCTCAGAGGGAGACAGCACAGGG - Intronic
1180109215 21:45640165-45640187 CAGCAGGGGGACAGGGGAGAGGG + Intergenic
1180476892 22:15719272-15719294 CATCTGGGGGTGATGGGAGATGG - Intronic
1180635063 22:17257467-17257489 CCTCTGGGGGAGGCGGGAGAGGG + Intergenic
1181437929 22:22921192-22921214 CCCCAGAGGGAGAGGGGAGAGGG - Intergenic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1182043828 22:27259120-27259142 CAACAGAGAGAGAAGGGAGAAGG - Intergenic
1182372287 22:29819720-29819742 CAGCAGCAGGAGACGGGGGAGGG - Intronic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1183270122 22:36856720-36856742 CAGCAGAGGGAGACAGAAAAGGG + Intergenic
1183871894 22:40746373-40746395 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871900 22:40746392-40746414 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871906 22:40746411-40746433 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871912 22:40746430-40746452 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871920 22:40746455-40746477 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871926 22:40746474-40746496 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871932 22:40746493-40746515 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871938 22:40746512-40746534 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871944 22:40746531-40746553 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871950 22:40746550-40746572 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871956 22:40746569-40746591 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871960 22:40746582-40746604 CGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871966 22:40746601-40746623 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184523951 22:45010366-45010388 TATCAGAGGGAGGCGGAGGAGGG - Intergenic
1185283869 22:49990568-49990590 CAACAGAGGGAGACCAGAGAGGG + Intergenic
949721234 3:6992784-6992806 CATCAGAGGGTGGGAGGAGAAGG - Intronic
950060661 3:10069485-10069507 CATCAGAGGGAGACGGGAGAGGG - Intronic
950715062 3:14842135-14842157 CCTCAGAGGGAAATGGTAGAAGG - Intronic
950798466 3:15530513-15530535 CATCAGAAGAAGACAGGGGAGGG - Intergenic
951596341 3:24322464-24322486 CATCAGACAGAGATGGGAGGTGG - Intronic
951715814 3:25644707-25644729 CATCAGGGGGTGATGGGAGATGG + Intronic
951718062 3:25670178-25670200 CAATTGAGGGAGAGGGGAGATGG + Intergenic
951743363 3:25948784-25948806 GAAATGAGGGAGACGGGAGAGGG - Intergenic
951775587 3:26307073-26307095 CAGCAAAGGGAGATAGGAGAGGG + Intergenic
951793713 3:26515481-26515503 CAACAGAGGGAGACGGGAGAGGG - Intergenic
953197983 3:40751988-40752010 GATCAGAGGGAAGTGGGAGAAGG + Intergenic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
955333806 3:58068858-58068880 CATTAGAGGGAGAGGGGATGGGG + Intronic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960073466 3:113458163-113458185 CGGGAGAGGGAGACGGGAGAGGG - Intronic
960073470 3:113458176-113458198 CGGGAGAGGGAGACGGGAGAGGG - Intronic
960073474 3:113458189-113458211 CGGGAGAGGGAGACGGGAGAGGG - Intronic
960073478 3:113458202-113458224 CGGGAGAGGGAGACGGGAGAGGG - Intronic
960073482 3:113458215-113458237 GAGGAGAGGGAGACGGGAGAGGG - Intronic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
960814426 3:121658345-121658367 CATCTGAGAGTGACCGGAGATGG + Exonic
961057195 3:123799185-123799207 CATCAGGGGGTGAGGGGTGAGGG - Intronic
961371374 3:126433927-126433949 CACCAGAGGCAGCTGGGAGAGGG + Intronic
962414145 3:135167181-135167203 CATGACAGGTAGACGGCAGATGG - Intronic
962815591 3:138994955-138994977 CATCAAGGGGAGAAAGGAGAAGG - Intergenic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
964108363 3:153063159-153063181 CAGCAGAGGGAGAGGGGAAGTGG - Intergenic
964300766 3:155282879-155282901 CAGCAAAGGGAGATAGGAGAGGG + Intergenic
966672842 3:182547850-182547872 AATCAGTCGGAGAAGGGAGAAGG + Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
967040003 3:185683263-185683285 TACCAGAGGCTGACGGGAGAGGG + Intronic
967812181 3:193769682-193769704 CAGCAGAGGGAGAGGGGCAAGGG + Intergenic
967984058 3:195082380-195082402 CACCAGAGGGAGAGAGAAGATGG - Intronic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
969228727 4:5815449-5815471 CCTCATAGGGAGACGGGAAATGG + Intronic
969301648 4:6300581-6300603 GGTCAGAGGGAGGCGTGAGATGG + Intronic
969457359 4:7307633-7307655 CATCAGAGGGAAGCGGCTGAGGG + Intronic
970022831 4:11588279-11588301 CTTCAGGAGGAGTCGGGAGATGG - Intergenic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
970889802 4:21030313-21030335 CATCTGAGGGTAATGGGAGATGG - Intronic
971097068 4:23418580-23418602 GATCCGAGGAAGACTGGAGAAGG + Intergenic
971282224 4:25250211-25250233 AAGAAGAGGGAGAGGGGAGAGGG + Intronic
971366065 4:25978046-25978068 AATCAGAGAGAGACAGGAGCAGG - Intergenic
972350680 4:38233506-38233528 GAGGAGAGTGAGACGGGAGAGGG + Intergenic
972589867 4:40474870-40474892 CATCATAATGAGAAGGGAGAAGG + Intronic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
973263199 4:48185847-48185869 AGGGAGAGGGAGACGGGAGAGGG - Intronic
973752177 4:54032289-54032311 CATCAGAGGGAGACCGTAGAGGG - Intronic
973810270 4:54562582-54562604 AATCAGAGGGAGCTGGGAGATGG + Intergenic
975658926 4:76669029-76669051 CATCACATGGAGACGGGATAGGG + Intronic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
976599959 4:86928916-86928938 CAAAAGAGGGAGAAGAGAGAAGG - Intronic
976633843 4:87267529-87267551 AATAAGAAGGAGAAGGGAGATGG - Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978718931 4:111882179-111882201 CATCAGAGTCAGAAGGAAGAGGG + Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979425699 4:120562792-120562814 CACTAGAGAGAGAGGGGAGAGGG - Intergenic
979858366 4:125662988-125663010 CTTCATAGGGAGAGGGGAGAAGG + Intergenic
982015097 4:151145545-151145567 CAGCAAAGGGAGACAGGAGTGGG - Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982078822 4:151766757-151766779 CATCTGGGGGTGATGGGAGATGG + Intergenic
982711368 4:158761430-158761452 TATAAGAGGGAGAAGAGAGAAGG + Intergenic
983613911 4:169679857-169679879 CAACAGAGGGAGACCGTGGAAGG + Intronic
983688450 4:170438433-170438455 TATGAGAGGAAGACTGGAGATGG - Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
985082493 4:186280415-186280437 CCTCACAGGCAGACGGGACAAGG - Intronic
986122756 5:4857429-4857451 CATCAGAGGGTGATGGGAGATGG - Intergenic
986122831 5:4857784-4857806 CATCAGAGGGTGCTGGGAGATGG - Intergenic
986685234 5:10270577-10270599 CCTCAGTGGGGGAGGGGAGAGGG + Intergenic
986859175 5:11905383-11905405 AATCAGAGGGACAGGGGCGAAGG - Intergenic
987936972 5:24479433-24479455 CATTAGAGGGAGCCAGGAGGTGG + Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
991073996 5:62514590-62514612 AGGGAGAGGGAGACGGGAGAGGG + Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
992088476 5:73298410-73298432 GAACAGGGGGACACGGGAGAGGG - Intergenic
992415976 5:76551843-76551865 GCAAAGAGGGAGACGGGAGAGGG + Intronic
992426370 5:76662158-76662180 CCTCACAGGGAGAAGGAAGAGGG + Intronic
993923542 5:93837347-93837369 CATCAGTGGTAGACTGCAGAAGG - Intronic
996085745 5:119303372-119303394 CAGCAGAGGGAGAAGGAAGGAGG - Intronic
997393862 5:133540685-133540707 CATGAGAGGGAGAGGTGAGCTGG - Intronic
998679697 5:144453192-144453214 CACCTGAGGGAAAAGGGAGATGG - Intronic
1000041247 5:157486676-157486698 CAGCAGAGGGAGGAGGGAGTGGG - Intronic
1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1000372896 5:160554273-160554295 TATGAGAGGGAGACAGAAGAAGG - Intergenic
1000603947 5:163308056-163308078 CATCTGGGGGTGATGGGAGATGG + Intergenic
1001397017 5:171424839-171424861 CAGCAGAGGGGGAAGGGGGAGGG + Intronic
1001628725 5:173158644-173158666 CAACAAAGGCACACGGGAGAAGG - Intronic
1003024464 6:2541947-2541969 AACCAGAGGGAGATGGGGGAAGG + Intergenic
1003319629 6:5038849-5038871 CATCAGAGGGAGACCGCGGAAGG + Intergenic
1004755630 6:18607737-18607759 CAAGAGAGGAAGAAGGGAGAAGG + Intergenic
1005167764 6:22944738-22944760 CATCAGAGGAAGATGGAAGAGGG + Intergenic
1005206824 6:23414499-23414521 CAACAGAAGGACACTGGAGAGGG + Intergenic
1005836965 6:29717712-29717734 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1005836971 6:29717731-29717753 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1005836977 6:29717750-29717772 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1005836983 6:29717769-29717791 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1005836989 6:29717788-29717810 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1005836995 6:29717807-29717829 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1005837001 6:29717826-29717848 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1005837007 6:29717845-29717867 CGGGAGAGGGAGAGGGGAGAGGG - Intergenic
1005837012 6:29717858-29717880 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1005837018 6:29717877-29717899 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1005837024 6:29717896-29717918 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1005837030 6:29717915-29717937 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1007079007 6:39085565-39085587 AAACACAGGGAGACAGGAGATGG - Intronic
1007751202 6:44073031-44073053 CAGCAGAGGCAGGCGGGTGAGGG + Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1008897249 6:56570398-56570420 CATCTGGGGGTGATGGGAGATGG + Intronic
1008926787 6:56895995-56896017 AGGGAGAGGGAGACGGGAGAGGG + Intronic
1008926793 6:56896014-56896036 AGGGAGAGGGAGACGGGAGAGGG + Intronic
1008926799 6:56896033-56896055 AGGGAGAGGGAGACGGGAGAGGG + Intronic
1008926805 6:56896052-56896074 AGGGAGAGGGAGACGGGAGAGGG + Intronic
1008926811 6:56896071-56896093 AGGGAGAGGGAGACGGGAGAGGG + Intronic
1008926817 6:56896090-56896112 AGGGAGAGGGAGACGGGAGAGGG + Intronic
1008926823 6:56896109-56896131 AGGGAGAGGGAGACGGGAGAGGG + Intronic
1009043521 6:58210702-58210724 GATCAGGGAGGGACGGGAGAGGG + Intergenic
1009392613 6:63163369-63163391 CAACAGAGGGAGACCGAAGAAGG - Intergenic
1010336166 6:74685677-74685699 CATCAGTGGTAGACTGGATAAGG + Intergenic
1012710821 6:102602119-102602141 CATCAGTGAAAGACCGGAGAAGG + Intergenic
1013530951 6:111018185-111018207 CATCAGGGGGAGACCGGGGAGGG + Intronic
1013751705 6:113414693-113414715 CAACAGAGGGAGCCTGGAGATGG + Intergenic
1013758024 6:113483816-113483838 CAAAAGAGGGAGCCTGGAGATGG - Intergenic
1014764410 6:125390105-125390127 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1014764416 6:125390124-125390146 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1014764422 6:125390143-125390165 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1014764428 6:125390162-125390184 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1014764434 6:125390181-125390203 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1014987443 6:128029202-128029224 CAAGAGAGGGAGACAGGAGAGGG - Intronic
1015093242 6:129384670-129384692 CAACAGGGGTAGACTGGAGATGG + Intronic
1019117881 6:169779958-169779980 CAGCCGAGGGAGACTGGAGCTGG - Intronic
1019277134 7:181752-181774 AATCTGAGGAAGAGGGGAGAGGG + Intergenic
1019450933 7:1097582-1097604 TTTCAGAGGGAGACGGGGGCAGG + Intronic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019559703 7:1649895-1649917 CAGGAGAGGTAGAGGGGAGATGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019830286 7:3321714-3321736 GATGGGAGGGAGAGGGGAGAGGG - Intronic
1019907370 7:4074991-4075013 CCTCCCAGGGAGAGGGGAGAAGG - Intronic
1020260557 7:6528581-6528603 GATGAGGGGGAGAAGGGAGAAGG + Intronic
1020669001 7:11083034-11083056 CATAAGGGAGAGAGGGGAGAGGG - Intronic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1022479704 7:30734732-30734754 CAGCAGAGGGAGCTAGGAGAGGG - Intronic
1022538664 7:31114900-31114922 CATCAGGGGCAGAGGGGAGGAGG - Intergenic
1022756567 7:33298740-33298762 AATCAGAGGGAGCTGGGAAATGG + Intronic
1023494787 7:40783558-40783580 CATAAGAGTCAGAGGGGAGAAGG + Intronic
1023689243 7:42769129-42769151 CATCAGTGGGATGCGGGAGCTGG + Intergenic
1023817118 7:43959673-43959695 CATGAGAGGGATAAGGGCGAGGG + Intergenic
1024813232 7:53237693-53237715 CATAAGGGAGAGAAGGGAGAGGG + Intergenic
1025775000 7:64553609-64553631 CATCAGAGGGAGACAGGAGAGGG - Intronic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026045767 7:66904409-66904431 CATCAGCGGGAGGCAGGAGCTGG - Intergenic
1026180589 7:68036004-68036026 CATCAGAGGGCAAGTGGAGAGGG - Intergenic
1026228756 7:68465398-68465420 CTTCAGAGTGAGAAGGAAGAGGG - Intergenic
1026442793 7:70458644-70458666 CAACAAAGGGAGAAGGGAGGTGG - Intronic
1026533278 7:71218818-71218840 CATCTGGGGGTGATGGGAGACGG - Intronic
1026574714 7:71562481-71562503 CATCTGGGGGTGATGGGAGACGG + Intronic
1027486760 7:78771174-78771196 CATAAGCGAGAGAGGGGAGAAGG - Intronic
1028595849 7:92545844-92545866 AGGGAGAGGGAGACGGGAGACGG + Intergenic
1029477304 7:100792579-100792601 CAGCAGAGGTGGACGGCAGAGGG - Intronic
1029538140 7:101167606-101167628 CATCCAAGAGAGAAGGGAGAGGG + Intergenic
1030396736 7:108995453-108995475 CAAGAGAGAGAGATGGGAGAAGG + Intergenic
1030771724 7:113483995-113484017 CATCTGGGGGCGATGGGAGATGG - Intergenic
1031003596 7:116446586-116446608 CATCAGAGGGAGACGTAAGGAGG - Intronic
1032436135 7:131901690-131901712 AATCAGCGTGAGAAGGGAGAGGG + Intergenic
1032486595 7:132292271-132292293 AATCAGAGGGAGGCTGGAGGTGG + Intronic
1033007249 7:137579985-137580007 CATCAGAGTGAGAAGGGAGCAGG - Intronic
1033185542 7:139224890-139224912 CAACAGAGGGAGACCGAAGAAGG - Intergenic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033919673 7:146374638-146374660 CATCAGAGTCAGAGGGGATATGG + Intronic
1034256525 7:149727753-149727775 CAACAGAGGGAGCCGGGAGTTGG - Intronic
1034420247 7:150986782-150986804 CAGGAGAGGGAGACAGGAGGAGG + Intergenic
1034541058 7:151758492-151758514 CATCTGAGGGAGGAGGGAAAAGG + Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035412218 7:158654089-158654111 CATCAGATGATGACGGGAAAGGG - Intronic
1035692804 8:1571192-1571214 GATGAGATGGAGAGGGGAGAGGG + Intronic
1035692879 8:1571562-1571584 GATGAGATGGAGAGGGGAGAGGG + Intronic
1036483142 8:9154867-9154889 AAAGAGAGGGAGACGGGAGAGGG + Intronic
1037751363 8:21684508-21684530 CTTCAGAGGGAGAGGTCAGAGGG - Intergenic
1037974140 8:23197521-23197543 TATCTGAGGGTGATGGGAGACGG - Intronic
1038033504 8:23665388-23665410 CATAATAGGGAAACTGGAGAGGG - Intergenic
1038421357 8:27436046-27436068 CTTCAGAGGGAGCAGGGTGATGG + Intronic
1038448137 8:27618283-27618305 CATCAGTGGCAGACTGGATAAGG - Intergenic
1038565849 8:28619533-28619555 CAGCAGTGGGAGAGGGGAGCTGG - Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038687715 8:29733800-29733822 CATCAGAGGGTGAAGGGAGAGGG - Intergenic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1040053035 8:43034001-43034023 AGGGAGAGGGAGACGGGAGAGGG + Intronic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040087487 8:43360653-43360675 CATCTGGGGGTGACAGGAGATGG - Intergenic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1040823881 8:51596282-51596304 CATCAGTGGTAGACTGGATAAGG - Intronic
1040944449 8:52869046-52869068 CATGAGAGGCAGCTGGGAGAGGG - Intergenic
1040999330 8:53434921-53434943 CATCCGAAGGGGATGGGAGAGGG + Intergenic
1041357863 8:57021193-57021215 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1041357869 8:57021212-57021234 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1041357877 8:57021237-57021259 AAGGAGAGGGAGACGGGAGAGGG - Intergenic
1041433119 8:57806457-57806479 TTTCAGAGGGATACGGAAGAAGG - Intergenic
1043517127 8:81005173-81005195 CATCTGAGAGAGACAGGACATGG + Intronic
1043958713 8:86390694-86390716 GACGAGAGGGAGACGGGAGAGGG + Intronic
1044767908 8:95596865-95596887 CATGAGAGGGAGGGTGGAGATGG + Intergenic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045906022 8:107345783-107345805 CATCAGATGAACATGGGAGATGG - Intronic
1046223944 8:111251961-111251983 CTTCACAGGAAGACAGGAGAGGG + Intergenic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1046703444 8:117426195-117426217 CAACAGAGGGAGACCAAAGAAGG - Intergenic
1046889641 8:119408414-119408436 TACCAGAGGGAGAAGGGAGGCGG + Intergenic
1047404395 8:124573203-124573225 GATGAGAGGGAGAGGAGAGAGGG - Intronic
1047794787 8:128243521-128243543 CATCAGAGGGACCCAGGAGGAGG + Intergenic
1048025904 8:130586385-130586407 GATCAGAGGGAGAGGAGAAAGGG + Intergenic
1048104714 8:131395451-131395473 CATCACAGGCAGAACGGAGAGGG - Intergenic
1048383116 8:133885843-133885865 CAAGAGAGAGAGACTGGAGAAGG + Intergenic
1049844543 8:144793478-144793500 CGTGAGAAGGAGACAGGAGAGGG + Intergenic
1050144622 9:2553541-2553563 TTTCAGAGGGAGGCAGGAGATGG + Intergenic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1051070987 9:13166763-13166785 AATCAGTGGGAGAGGGGAAACGG + Intronic
1054355017 9:64051948-64051970 CATAAGAGTGAGAGGGGAGGAGG - Intergenic
1055294567 9:74820953-74820975 AAGCAGAGGGAGATGGTAGAGGG + Intronic
1055580745 9:77703883-77703905 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1055727946 9:79251625-79251647 CATTAGGGGAAGACTGGAGATGG - Intergenic
1056603369 9:88064309-88064331 CATCCAAGAGAGACAGGAGATGG - Intergenic
1057194797 9:93110951-93110973 CATGAGAGAGAGACGGAGGAAGG - Intronic
1057367987 9:94442054-94442076 ATACAGAGGAAGACGGGAGAAGG - Intronic
1059986727 9:119827650-119827672 CATCAGAGAGAGAAGGGGCAGGG + Intergenic
1061754754 9:132804623-132804645 GAGCAGAGGGACACGGGAGGGGG - Intronic
1061995612 9:134181313-134181335 CATCAGAGAGAGCAGGGAGAGGG + Intergenic
1062176637 9:135166863-135166885 CATCAGAGGAAGGAGTGAGATGG + Intergenic
1185986285 X:4838095-4838117 CATCTGGGGGTGATGGGAGATGG - Intergenic
1186080124 X:5922052-5922074 AATCAGAGGGAAAAGGGAGAAGG + Intronic
1186149746 X:6661661-6661683 CATCAGAAAGAGATGGAAGAAGG - Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1188644843 X:32553174-32553196 CATCAGTGGTAGACTGGATAAGG + Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190037630 X:47040481-47040503 CATCTGGGGGTGATGGGAGACGG - Intronic
1190712743 X:53081753-53081775 CAGCAGTGGGGGATGGGAGAAGG + Intergenic
1190778799 X:53577542-53577564 CATCAGAGGGAGACCATGGAAGG - Intronic
1191835201 X:65456462-65456484 CATCAGAGGGAGACCATGGAAGG - Intronic
1192106769 X:68325610-68325632 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1192106775 X:68325629-68325651 CGGGAGAGGGAAACGGGAGAGGG - Intronic
1192350313 X:70350463-70350485 CAACAGAGGGAGACGGGAGAGGG + Intronic
1192360062 X:70433806-70433828 CATCAGGGGGAGATGGGAGGAGG + Intergenic
1194609066 X:96018232-96018254 CAACAGAGGGAGAAGAGAGGGGG + Intergenic
1197199127 X:123733498-123733520 CGGGAGAGGGAGACGGGAGAGGG - Intergenic
1197199131 X:123733511-123733533 GGGGAGAGGGAGACGGGAGAGGG - Intergenic
1197549610 X:127873746-127873768 CATCTGTGGGTGATGGGAGACGG + Intergenic
1199037644 X:143072062-143072084 TATCAGAGGGGGATGGAAGATGG + Intergenic
1199324950 X:146488463-146488485 CTTCACAGGGTGACAGGAGAGGG + Intergenic
1199924859 X:152451416-152451438 CAGCAAAGGGGGAGGGGAGAAGG - Intergenic
1201702474 Y:16899491-16899513 CATAAGGGAGAGAAGGGAGAGGG - Intergenic
1202028601 Y:20551023-20551045 CAACAGAGGGAGACCGAAGAAGG - Intergenic