ID: 950062763

View in Genome Browser
Species Human (GRCh38)
Location 3:10085856-10085878
Sequence TCGGCTACTAAGGACATGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 53}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950062763_950062773 22 Left 950062763 3:10085856-10085878 CCCTCCATGTCCTTAGTAGCCGA 0: 1
1: 0
2: 0
3: 3
4: 53
Right 950062773 3:10085901-10085923 AGCCTTTGGAGGAACTACTCAGG 0: 1
1: 0
2: 0
3: 3
4: 103
950062763_950062771 11 Left 950062763 3:10085856-10085878 CCCTCCATGTCCTTAGTAGCCGA 0: 1
1: 0
2: 0
3: 3
4: 53
Right 950062771 3:10085890-10085912 AGAACACAGCCAGCCTTTGGAGG 0: 1
1: 0
2: 3
3: 24
4: 236
950062763_950062770 8 Left 950062763 3:10085856-10085878 CCCTCCATGTCCTTAGTAGCCGA 0: 1
1: 0
2: 0
3: 3
4: 53
Right 950062770 3:10085887-10085909 GGGAGAACACAGCCAGCCTTTGG 0: 1
1: 0
2: 3
3: 21
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950062763 Original CRISPR TCGGCTACTAAGGACATGGA GGG (reversed) Exonic
900775618 1:4582808-4582830 TCAGTTAATAAGGACTTGGATGG - Intergenic
901407952 1:9062525-9062547 TTGGCTACAGAGCACATGGAGGG - Intronic
901646094 1:10717627-10717649 ACGGCTCCTGAGGACATGGATGG + Intronic
902234359 1:15048143-15048165 TTGGCTCCTCAGGACATGGGGGG - Intronic
902637481 1:17743960-17743982 TCGGCTCCTGGGGACAGGGAAGG + Intergenic
905033275 1:34901809-34901831 TCGATTATGAAGGACATGGAAGG + Intronic
906843851 1:49168825-49168847 TGAGCCACTAAGGAGATGGATGG - Intronic
910437144 1:87216777-87216799 TCCCCTACTCAGGAGATGGAAGG - Intergenic
923779329 1:237008294-237008316 TGGGCTGCTGAGGACATGGTGGG - Intergenic
1063974145 10:11401915-11401937 GGGGCTCCTGAGGACATGGACGG + Intergenic
1068791383 10:61034577-61034599 TCTGATATTAATGACATGGAAGG - Intergenic
1069812210 10:71170409-71170431 TCGGCTACAAAGGCAATTGAAGG - Intergenic
1070820118 10:79349469-79349491 TCAGGTACTGAGGACAGGGAAGG + Intronic
1073633331 10:105171329-105171351 TCAGGTACAAAGGAGATGGAGGG - Intronic
1094740854 12:33286910-33286932 TGAGCTAGTAAGGGCATGGATGG - Intergenic
1114375726 14:22144475-22144497 TTGGACACTAAGGACCTGGAAGG + Intergenic
1116579206 14:46617092-46617114 TTGGCTACTAGGGACAGGGAGGG + Intergenic
1126303353 15:47225175-47225197 TCTGCTAAGAAGCACATGGAGGG - Intronic
1126840977 15:52717304-52717326 ATGGCTACTAAGGAAATGTATGG + Intergenic
1128986284 15:72224103-72224125 TCGGCATCTGAGGACATTGAGGG - Intronic
1133098938 16:3467386-3467408 TCTGCTCCTGAGGTCATGGATGG + Intronic
1133830537 16:9319314-9319336 CCTGCTCCTAAGGTCATGGAGGG - Intergenic
1135109767 16:19681469-19681491 TGGGCTAGCAAGGCCATGGAAGG + Intronic
1148546911 17:48526204-48526226 TCTGCATCTAAGGAGATGGAAGG + Intergenic
1156963558 18:43062190-43062212 GCAGATACTCAGGACATGGATGG + Intronic
1166067543 19:40368808-40368830 TCAGATACTCAGGAGATGGAAGG + Intronic
1167761327 19:51451595-51451617 TCGGCTACTCAGGACAGGGCTGG - Exonic
931245564 2:60489927-60489949 TGGGATACTCAGGGCATGGATGG - Intronic
931899045 2:66767580-66767602 TGGGATACAAAAGACATGGAAGG - Intergenic
945571630 2:211474824-211474846 TGGGCCATTAAGTACATGGATGG + Intronic
948624888 2:239262787-239262809 TCAGGCACTAAGGACACGGAGGG + Intronic
1182727775 22:32461508-32461530 TCTGCCTCTCAGGACATGGAGGG - Intronic
1184062481 22:42091997-42092019 GTGGCTACTAAGGACATCTAAGG - Intergenic
949340177 3:3021091-3021113 TCAGCTACTAAGTACATGCTGGG - Intronic
950062763 3:10085856-10085878 TCGGCTACTAAGGACATGGAGGG - Exonic
957227538 3:77469254-77469276 TGGGCTCTTAAGGACATGGCTGG - Intronic
958470424 3:94510468-94510490 TCGGCTGTTGAGAACATGGAGGG - Intergenic
960090217 3:113631019-113631041 GCAGCTACAAAGGACAAGGATGG - Intergenic
964048242 3:152357872-152357894 TCAGCTTATCAGGACATGGATGG + Intronic
975161934 4:71134360-71134382 TAGGCTAATCTGGACATGGATGG - Intergenic
976926568 4:90505225-90505247 TGGGCTACAAAGGACTTGGCTGG + Intronic
977341750 4:95767131-95767153 TCTTCTCCTAAGCACATGGATGG + Intergenic
994816364 5:104592490-104592512 TCTGCTGTTAAAGACATGGAAGG - Intergenic
1004925522 6:20411988-20412010 TGGGGTACCAAGCACATGGAAGG - Intronic
1017208416 6:151828550-151828572 TGGGCTGCAAAGTACATGGAAGG + Intronic
1021909587 7:25370779-25370801 TGGGCTTCTAAGGACATAGCTGG - Intergenic
1023791415 7:43756718-43756740 TCTGCTCTCAAGGACATGGAGGG + Intergenic
1028222915 7:88218319-88218341 ACACCTAATAAGGACATGGAGGG + Intronic
1029619183 7:101679293-101679315 TAGGCTGCTAAGGGCCTGGATGG + Intergenic
1041576746 8:59406058-59406080 TCCTCTACTATAGACATGGAAGG - Intergenic
1049410077 8:142469969-142469991 TTGCCTGCTAGGGACATGGACGG - Intronic
1050343699 9:4665588-4665610 TCTGTTACTAACTACATGGAAGG + Intronic
1055751161 9:79506885-79506907 TTGGCTACCAAAGACATAGATGG + Intergenic
1059682892 9:116603815-116603837 GCTGCTACTAAGGACAAGAATGG + Intronic
1189613813 X:42764664-42764686 TCTGCTATTAAAGACATGGCAGG - Intergenic
1195486640 X:105415739-105415761 TGTGCTACTAAGTACAAGGAAGG - Intronic
1197018746 X:121660113-121660135 TCTTCAACAAAGGACATGGATGG + Intergenic