ID: 950065959

View in Genome Browser
Species Human (GRCh38)
Location 3:10111938-10111960
Sequence ATGCTGTTCTTGAGTGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950065959_950065963 17 Left 950065959 3:10111938-10111960 CCATCTTCACTCAAGAACAGCAT No data
Right 950065963 3:10111978-10112000 TAGAATTACAAGGGAGATTCTGG No data
950065959_950065962 8 Left 950065959 3:10111938-10111960 CCATCTTCACTCAAGAACAGCAT No data
Right 950065962 3:10111969-10111991 TGAGTCATCTAGAATTACAAGGG No data
950065959_950065964 23 Left 950065959 3:10111938-10111960 CCATCTTCACTCAAGAACAGCAT No data
Right 950065964 3:10111984-10112006 TACAAGGGAGATTCTGGAACAGG No data
950065959_950065961 7 Left 950065959 3:10111938-10111960 CCATCTTCACTCAAGAACAGCAT No data
Right 950065961 3:10111968-10111990 TTGAGTCATCTAGAATTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950065959 Original CRISPR ATGCTGTTCTTGAGTGAAGA TGG (reversed) Intergenic
No off target data available for this crispr