ID: 950067297

View in Genome Browser
Species Human (GRCh38)
Location 3:10123259-10123281
Sequence CTGTTTTCACAGATGGAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 355}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950067297 Original CRISPR CTGTTTTCACAGATGGAATG TGG Intronic
900920283 1:5665740-5665762 CTGTTTTGACCAAAGGAATGTGG + Intergenic
901809096 1:11756084-11756106 TTGATTTCAGAGCTGGAATGTGG + Intergenic
902898936 1:19500447-19500469 GTGTTTTAACTAATGGAATGTGG + Intergenic
903654259 1:24939505-24939527 CTGTTTACACAGCTGTGATGTGG - Intronic
905860366 1:41346552-41346574 CTCATTTCACAGATGAAAAGAGG + Intergenic
907566730 1:55442470-55442492 CTGTTTTCACTGAAGGAAATAGG - Intergenic
907623446 1:56005920-56005942 CTCTTTCCACTGATGGAAGGAGG + Intergenic
907996481 1:59637923-59637945 CTGTTTTTACAGATGAGAAGAGG + Intronic
912889906 1:113519063-113519085 CTGTTTTCATAGAGAGAATTAGG - Intronic
914941282 1:152024993-152025015 CTGTGTTCCCAGAAGGCATGGGG - Intergenic
915084025 1:153372277-153372299 ATCGTTTCAGAGATGGAATGAGG - Intergenic
916156634 1:161856184-161856206 CTGTTTTCATACATAAAATGAGG + Intronic
922004722 1:221518291-221518313 CTGTTTTGACCAATAGAATGTGG + Intergenic
922226448 1:223649998-223650020 CAGTTTTCACAGCTGTAAAGTGG - Intronic
922354782 1:224765400-224765422 CTGTTTCCACTGCTGGAAGGAGG + Intergenic
922570619 1:226632782-226632804 CTTCTTTCACAGATGGAGTAAGG + Exonic
923450854 1:234116064-234116086 CTCCTTTCACATATGAAATGTGG - Intronic
924243842 1:242062909-242062931 CTTTTCTTACAGTTGGAATGAGG - Intergenic
1064646382 10:17464350-17464372 TTTTTTCCACAGATGGAGTGGGG - Intergenic
1064723020 10:18249121-18249143 CTATTTTCTCAGATGAAATTAGG - Intronic
1064750961 10:18528294-18528316 GTGTTTACAGAGATGGTATGTGG + Intronic
1065611669 10:27477251-27477273 CAGTTTTTATATATGGAATGAGG + Intergenic
1065735189 10:28745133-28745155 ATGTATTCACAGGTGGAATAGGG + Intergenic
1067093309 10:43282710-43282732 CTCATTTCACAGAAGAAATGGGG + Intergenic
1067824421 10:49559693-49559715 CTCTTTTCACATGTGCAATGTGG - Intergenic
1067830689 10:49609814-49609836 CTGTTCTCGCAGCTGGATTGTGG - Intronic
1069546556 10:69333449-69333471 CTGTTCTCCCCGAGGGAATGGGG + Intronic
1070909771 10:80107845-80107867 CTGAATGCAAAGATGGAATGAGG + Intergenic
1071146643 10:82582356-82582378 CTGTTTTCACAAAGGGCAGGGGG + Intronic
1071601435 10:86960427-86960449 CTGTTTTCACTTATAAAATGGGG - Intronic
1072557993 10:96539711-96539733 GTGTTTTTACAGATGTACTGAGG - Intronic
1073875619 10:107918444-107918466 TTGTTTTCACTGATGCGATGGGG - Intergenic
1074544673 10:114393376-114393398 CTGTTCTCACACAGGGAATGTGG + Intronic
1075039037 10:119093002-119093024 CTGTTCCCAGAGCTGGAATGCGG - Intergenic
1075103223 10:119520110-119520132 CTTCTTCCAGAGATGGAATGTGG + Intronic
1075672292 10:124270821-124270843 CTGTTCTCACTGAAGGAAAGTGG + Intergenic
1076296024 10:129385511-129385533 CTGTTTGGACATGTGGAATGTGG + Intergenic
1076712938 10:132348785-132348807 CTCTTTTCACAGGTAAAATGTGG - Intronic
1078348799 11:10575370-10575392 CTGTTTTCAAAGAGAGAATAGGG + Exonic
1079083523 11:17429879-17429901 ATGGGTTCAAAGATGGAATGGGG - Intronic
1079091896 11:17486532-17486554 CTGTTTGCACACGTGGACTGTGG + Intergenic
1080211425 11:29790739-29790761 CTTTTTTCACAGATTCTATGAGG - Intergenic
1081963164 11:47153122-47153144 CTGTTTTGACATCTGGATTGAGG - Intronic
1083949083 11:65944083-65944105 CTGTTTTCTCATAGGCAATGGGG - Intergenic
1084994142 11:72958888-72958910 CTGTTTCCATAGATGGAAATGGG - Intronic
1085566130 11:77515402-77515424 ATGTTTTCCCTGAAGGAATGTGG + Intronic
1086010421 11:82096323-82096345 CTGTTTTCCTATATAGAATGTGG - Intergenic
1086402035 11:86468902-86468924 CTGTTTCCAGAGAAGGAATCTGG + Intronic
1087525733 11:99309604-99309626 CTGCTATCAAAGACGGAATGTGG - Intronic
1088560274 11:111108037-111108059 GTGTTTTCACAGATCTAATGAGG - Intergenic
1088819664 11:113446591-113446613 CTGTTTCCACAGTGGCAATGAGG + Intronic
1088939672 11:114440091-114440113 ATGTTCTCACTTATGGAATGAGG - Intronic
1089630976 11:119783966-119783988 CAGTTTTCACAAATAGAATATGG + Intergenic
1089861312 11:121592230-121592252 CTGTTTGCACTGATGGATGGTGG - Intronic
1090855051 11:130603574-130603596 CTGTTTTCTCACCTGTAATGTGG + Intergenic
1090933581 11:131321581-131321603 CTGTCTTCTGAGAAGGAATGAGG + Intergenic
1092505073 12:9090397-9090419 CCGTTTGCACAGATGCAGTGAGG + Exonic
1093158894 12:15721384-15721406 CTGTTTTCCTAGATGTAATGAGG + Intronic
1093823850 12:23657115-23657137 CTCTTTTCATTGTTGGAATGTGG + Intronic
1094070480 12:26407430-26407452 CTGTTGTCACAACTGGGATGGGG - Intronic
1094081797 12:26544893-26544915 CTCTTTTCACATTTGCAATGTGG + Intronic
1094813236 12:34162124-34162146 CTTTTCTTACAGTTGGAATGAGG + Intergenic
1097217587 12:57426349-57426371 CTTTTTTCACAGATTGATTTTGG - Intronic
1099308361 12:80986474-80986496 CTGTTTTCACAACTGGATTGTGG - Intronic
1099360715 12:81696581-81696603 ATATTTTTACAGATCGAATGGGG + Intronic
1099417422 12:82408675-82408697 CTATTTTGATAGATGGAATATGG + Intronic
1099878039 12:88433641-88433663 CTGTTTACACAAATAGTATGCGG + Intergenic
1100468613 12:94871719-94871741 CTGATTTCTCAGTTTGAATGCGG + Intergenic
1100908111 12:99324992-99325014 CTGATTTCAGAAAGGGAATGAGG - Intronic
1101762181 12:107667878-107667900 AGCTTTTCAAAGATGGAATGAGG + Intergenic
1103033336 12:117635750-117635772 TTGTTTTGACAGATGTATTGTGG - Intronic
1103091669 12:118102491-118102513 CTGCTTTCCCAGTTGGAATTGGG - Intronic
1104567564 12:129899065-129899087 CTGTGTTCACTGAAGGCATGTGG + Intronic
1106122643 13:26873407-26873429 CTGTTGTCACACTTGGAAAGGGG - Intergenic
1106136325 13:26976265-26976287 CTGCTGGTACAGATGGAATGAGG - Intergenic
1108325302 13:49324700-49324722 CTGACTTCACAGATGGGGTGAGG + Intronic
1109240763 13:59884405-59884427 CTTTTTTCATAGATGGCAGGGGG - Intronic
1111132554 13:83996298-83996320 CTGGGTTCACAGATGGTTTGAGG - Intergenic
1114194923 14:20469069-20469091 CTATTGACACAGCTGGAATGAGG + Intronic
1114327909 14:21608026-21608048 GTGTATTCTCAGGTGGAATGTGG + Intergenic
1114349127 14:21830578-21830600 ATGGTTTCACAGATGGTATCTGG - Intergenic
1115384263 14:32777430-32777452 CTGCTTGAACATATGGAATGCGG - Intronic
1116657208 14:47667394-47667416 CTCTTCTCACTGATGGATTGTGG - Intronic
1116936438 14:50745285-50745307 TTGTTTTCACAACTGGAAGGTGG - Intronic
1117869665 14:60186949-60186971 CTGTTTCCCCAGTGGGAATGCGG - Intergenic
1118525430 14:66635245-66635267 CTCTTTTGACCAATGGAATGTGG - Intronic
1120715509 14:87837014-87837036 CTGCTTTCACAGTGGGAATAAGG - Intergenic
1121263521 14:92583791-92583813 ATTTTTCCACAGATGGGATGGGG + Intronic
1124913709 15:33948034-33948056 ATGTTTTCAGAGATAGCATGTGG - Intronic
1127312923 15:57768288-57768310 CTGTTTTCTCAGCTGAAAAGGGG + Intronic
1128879655 15:71231507-71231529 GTCTTTTCACAGATGGATTCAGG - Intronic
1130313261 15:82772616-82772638 CTGCTTTCATTGATGGTATGGGG + Intronic
1130726519 15:86444818-86444840 CTTTTTCCCAAGATGGAATGTGG - Intronic
1130889869 15:88124545-88124567 ATGTTTTCTCAGGTGGAAGGAGG + Intronic
1133625168 16:7564221-7564243 CTGTGTTCTCAGATGGAAGAGGG - Intronic
1133958087 16:10464715-10464737 ATGTTTACAGAGATGGAAAGGGG + Intronic
1134234933 16:12458196-12458218 CTGGGCTCACAGATGGAACGTGG - Intronic
1134832029 16:17331424-17331446 CTGTTTCCACAGACTAAATGAGG - Intronic
1136072547 16:27796678-27796700 CTGTTTTAGGAGATTGAATGGGG + Intronic
1137953007 16:52801465-52801487 CTGTTTACATAGATGAAAAGTGG - Intergenic
1138139711 16:54557718-54557740 CTGTTTCCAAAGCTGAAATGAGG + Intergenic
1138908328 16:61365486-61365508 TTGTTCTCACAGGTGGAGTGTGG + Intergenic
1139787327 16:69404404-69404426 CCCTTTTCACCGAGGGAATGTGG + Intronic
1141270412 16:82535140-82535162 TTGTTTTCTGAGATGGAATTTGG + Intergenic
1141436775 16:84004143-84004165 CTGTTTTCTCACCTGTAATGTGG + Intergenic
1141604164 16:85143525-85143547 CTGTTGTCCCACCTGGAATGTGG + Intergenic
1142123863 16:88400590-88400612 CTGTTTTCACAGCTGAGAGGAGG - Intergenic
1142589055 17:993208-993230 CTGGTCTGACAGATGGAATAAGG - Intergenic
1142981493 17:3674848-3674870 CCGTCATCACAGACGGAATGGGG - Intronic
1143555961 17:7660481-7660503 TTGTTTTCTGAGATGGAATCTGG - Intergenic
1143710311 17:8729965-8729987 CTGTTTTCAGGGATAGAGTGAGG + Exonic
1144242944 17:13331887-13331909 CTGGATTTAAAGATGGAATGAGG + Intergenic
1146297139 17:31659114-31659136 CTGTGTGCTCACATGGAATGGGG + Intergenic
1146313570 17:31789798-31789820 CAGTTCTCACACATGGAAGGTGG + Intergenic
1146564612 17:33901579-33901601 CTGCTTTCCCAGCTGAAATGTGG - Intronic
1147529732 17:41264447-41264469 CTGTTTTCAGTGAGGGAATTAGG - Intergenic
1147813286 17:43189154-43189176 GTGTTGGCACAGGTGGAATGTGG + Intronic
1147924656 17:43938917-43938939 TTGTTTTCACTGAGGGGATGAGG - Exonic
1148061704 17:44841199-44841221 CTGTCTTGAAAGATGGAAAGAGG + Intergenic
1148171344 17:45523283-45523305 CTGTTTTCACAGTCTCAATGTGG - Intergenic
1148364675 17:47045268-47045290 CTGTTTTCACAGTCTCAATGTGG + Intronic
1148909772 17:50935198-50935220 CTGTTTTCACAGTGGGAAGCAGG - Intergenic
1148935981 17:51165149-51165171 CTGTTTTCACAGTTGACATTTGG + Intronic
1149535246 17:57428626-57428648 CTGTTTTCATATTTAGAATGAGG + Intronic
1151299073 17:73208548-73208570 CCAGTTTCACTGATGGAATGTGG + Exonic
1152376410 17:79920993-79921015 CTGTTTTCTCAGAAGGGAAGGGG + Intergenic
1153671931 18:7419787-7419809 GTGTTTTCACAGTGGGCATGTGG - Intergenic
1154146631 18:11872104-11872126 CATTCTTTACAGATGGAATGAGG + Intronic
1155060988 18:22228265-22228287 CTGTTTTTACATTTGAAATGTGG + Intergenic
1155803172 18:30134550-30134572 TTGTTTTAATAGATGGAATAAGG - Intergenic
1156005459 18:32435758-32435780 CTAATTTCACACATGGAATCTGG + Intronic
1156735842 18:40258231-40258253 CTGTTTTCATAGGTTGAAAGAGG + Intergenic
1157333690 18:46721676-46721698 CTGCTGGTACAGATGGAATGAGG - Intronic
1159918399 18:74205519-74205541 CTGCTTTCCCAGATGCAATCAGG + Intergenic
1161323408 19:3651739-3651761 CTGTTTTCACACTTGGGACGGGG + Intronic
1162796480 19:13089994-13090016 CCTTTTTCACAGCTGGGATGAGG - Intronic
1165321716 19:35089493-35089515 CTGTTTTCCCAAATGTAAAGTGG - Intergenic
1166400993 19:42479897-42479919 CTGGTTTCAAAGATGGAAAAGGG - Intergenic
1168373392 19:55855328-55855350 CTCTTTTCACAGTTGGTTTGAGG + Intronic
925774957 2:7325880-7325902 CTGGTTTCACAGATAAAATTTGG + Intergenic
926233505 2:11022451-11022473 CTGTTGTAACAGACTGAATGAGG + Intergenic
926547550 2:14260611-14260633 CTATTTTCACAATTGGAGTGGGG - Intergenic
926752061 2:16205712-16205734 TTGTTTTCACATCTGGCATGGGG + Intergenic
926995521 2:18731071-18731093 CTGAATTCAAAGATGAAATGTGG + Intergenic
927599706 2:24430287-24430309 CTGTTTTCACTGATGGTTTAAGG + Intergenic
929404542 2:41626396-41626418 CAGTTTTAACAAATTGAATGTGG - Intergenic
930886680 2:56334199-56334221 CTGTCTTCACCGCTGGAATGTGG + Intronic
931178069 2:59873337-59873359 CTTTGTTCACAGAAGGAATCAGG + Intergenic
931800436 2:65752886-65752908 TAGTTTTCAGAGAGGGAATGGGG + Intergenic
931908294 2:66866866-66866888 CTGTGTTCCCTGATGGAGTGGGG + Intergenic
933002199 2:76939448-76939470 ATTTTTTCACCAATGGAATGTGG - Intronic
933468140 2:82682708-82682730 CTGTTTTCTCAGAGGGAAATTGG - Intergenic
933907645 2:86911138-86911160 TTGTTTTCACATATATAATGTGG + Intronic
933908893 2:86920853-86920875 TTGTTTTCACATATATAATGTGG + Intronic
934023832 2:87982532-87982554 TTGTTTTCACATATATAATGTGG - Intergenic
935366781 2:102301537-102301559 TTTTTTTCACATATGGAATTTGG + Intergenic
935585390 2:104796219-104796241 CTGTTTACAGAGGTGGAGTGAGG + Intergenic
935614690 2:105065043-105065065 CTGTCTCCACTGATAGAATGAGG + Intronic
936364488 2:111840255-111840277 TTGTTTTCACATATGTAATGTGG - Intronic
937669766 2:124525910-124525932 CTGTTTTCACTGGTGGGCTGTGG - Intronic
942596739 2:177598809-177598831 CTCTTTTCACAGATGGAAAAAGG + Intergenic
944068754 2:195646887-195646909 CTTTTTCCACAGATGGCAGGGGG - Intronic
944684272 2:202104510-202104532 TGGTTTTCACAGAAGGAATATGG + Intronic
944908152 2:204283339-204283361 CTGTTATCACAGAAGAGATGTGG + Intergenic
945352133 2:208793335-208793357 CACTTTTCACATATGGTATGAGG - Intronic
946223471 2:218248875-218248897 CTGTTTTCACAGTGAGAATATGG + Intronic
946883324 2:224197900-224197922 CTGGTTTGACCAATGGAATGTGG - Intergenic
947386309 2:229594110-229594132 CTGGTTTCTCTGAAGGAATGTGG - Intronic
947558024 2:231115367-231115389 CTGTTTCCAGAGTTGGTATGTGG + Intronic
948212482 2:236204937-236204959 ATTTTTTAACAGATGGGATGTGG - Intronic
948304353 2:236935636-236935658 CTGTGTTCTCAGAGGAAATGGGG - Intergenic
948573087 2:238929765-238929787 CTGTTTACACAGAAGGGCTGTGG - Intergenic
949073177 2:242039048-242039070 CTGGCTTCACAGATGGGATCTGG + Intergenic
1169958443 20:11131855-11131877 CAGTATCCTCAGATGGAATGAGG + Intergenic
1170324814 20:15145177-15145199 CTGTATTCACAGATGACATTTGG + Intronic
1170550861 20:17474845-17474867 CTGAGCCCACAGATGGAATGAGG + Intronic
1172196764 20:33097223-33097245 CTGTTTTCTCATCTGTAATGTGG + Intronic
1172855345 20:37997517-37997539 CTGTTCTGAAAGATAGAATGAGG - Intronic
1173793818 20:45844823-45844845 CTTATTTCACTGATGAAATGGGG - Intronic
1174037708 20:47678473-47678495 CTGTCTTCCCATCTGGAATGTGG - Intronic
1174048345 20:47749662-47749684 TTGTGTTCACAGATGGAAAGTGG + Intronic
1174405757 20:50302298-50302320 CTGTGTTCCCTGATGGACTGCGG - Intergenic
1175160163 20:57002463-57002485 CTGTTTTGTGAGATGGAATCTGG + Intergenic
1177029036 21:15959099-15959121 CTGTTTTCACTTATGGATTCTGG + Intergenic
1177176417 21:17704824-17704846 TTGCTTTCACAGCTGGAAAGTGG + Intergenic
1179587897 21:42385287-42385309 GTGTTATCTCAGATGGAAGGTGG - Intronic
1179612653 21:42562681-42562703 CTGTGTTCACACATGACATGGGG - Intronic
1181276033 22:21688061-21688083 TTGTTTTCACAGATCCAAGGGGG + Exonic
1182270031 22:29147639-29147661 CTGTTTTCCCAGATGCAAGGAGG - Intronic
1183392052 22:37551228-37551250 CTGTTCTCAGAGGTGGAAAGAGG + Intergenic
1183577164 22:38699335-38699357 CTGTCTTTAAAGGTGGAATGTGG - Intronic
1183725601 22:39587557-39587579 CTGTGGCCACAGGTGGAATGAGG + Intronic
1184543703 22:45150365-45150387 CTGTCTTCACATATGCATTGAGG + Intergenic
1184640557 22:45867886-45867908 CTGTTTCCAGAGCTGGAAGGAGG - Intergenic
950067297 3:10123259-10123281 CTGTTTTCACAGATGGAATGTGG + Intronic
951074295 3:18370359-18370381 CTGATTTAACAGAGGGAAAGGGG - Intronic
951346518 3:21553042-21553064 CTGTTTTTGAAGATGAAATGGGG + Intronic
951487491 3:23230386-23230408 CTTATTTCACTGATAGAATGTGG + Intronic
951708927 3:25570361-25570383 TGGATTTCACAGATGGATTGGGG - Intronic
952732093 3:36649373-36649395 CTGTAATAACAGATGGAATGAGG - Intergenic
953522669 3:43657845-43657867 CTGCTTTCAAAGATGGAATTTGG - Intronic
953924385 3:46974712-46974734 CTGTTTTTTCAGTTGGAAAGTGG + Intronic
955343458 3:58143480-58143502 CTGTCTTCCCAGAAGGCATGTGG - Exonic
955949195 3:64225114-64225136 CTGTTTTCCCTGAGGGAATGTGG - Exonic
956298244 3:67738227-67738249 CTTTTTCCACAGATGGGCTGGGG + Intergenic
956706581 3:72004394-72004416 CTGGTATCACAGCTGGAGTGTGG - Intergenic
956742075 3:72282960-72282982 CTGCTTTCACAAATGGAATATGG + Intergenic
957801585 3:85090885-85090907 ATTTTTCCACAGATGGAAAGGGG - Intronic
958118949 3:89259839-89259861 CAGTTTTCATGGGTGGAATGGGG - Intronic
959473623 3:106783425-106783447 CTGTCTTAACAGATTGAATTTGG - Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
960920253 3:122739372-122739394 GTGTTGTCACAGAGGGAAGGAGG - Intergenic
961092843 3:124129832-124129854 CCCCTTTCACAGATGAAATGAGG - Intronic
961127071 3:124429105-124429127 CTGTTGTCACTGGTGGACTGTGG - Intronic
963346958 3:144106327-144106349 GTGGTTTCACAGATGAAATCTGG + Intergenic
963351811 3:144160844-144160866 CTGTATCCACAGTTAGAATGTGG + Intergenic
963526665 3:146423778-146423800 CTGGTTTTAAAGATGGAAGGAGG + Intronic
965081312 3:164036289-164036311 CTGTTTTCCAGGCTGGAATGTGG - Intergenic
966702388 3:182869459-182869481 CAGTTTTCACAAAAGGAATGTGG - Intronic
966958319 3:184908117-184908139 CTGTTTTCACAAATGTCCTGGGG + Intronic
967550061 3:190782282-190782304 TTAAATTCACAGATGGAATGTGG - Intergenic
968029410 3:195470345-195470367 CTGTTTTCAATGGTGTAATGTGG + Intergenic
968569267 4:1331100-1331122 TTGTCTCCAGAGATGGAATGAGG + Intronic
969528129 4:7714515-7714537 TGGTTCTAACAGATGGAATGAGG - Intronic
970731405 4:19107932-19107954 CTGGTTTCAAAGATGGAAAGGGG + Intergenic
970759604 4:19468940-19468962 TGGTTGTCACAAATGGAATGGGG - Intergenic
973561001 4:52135327-52135349 CTATTTTTACAGATGCCATGTGG + Intergenic
973643306 4:52924867-52924889 CTGCATTCACAGATGAGATGTGG - Intronic
973743631 4:53942323-53942345 CAGTTTTCTCAGCTGGAATATGG + Intronic
974180332 4:58376275-58376297 CTGGTTTCACAGAATGAATTAGG + Intergenic
974225669 4:59039620-59039642 ATGTGTTCACAGATGGAAAAAGG - Intergenic
975200565 4:71583415-71583437 CTGTTTTGACAAATGTACTGAGG + Intergenic
976417901 4:84800683-84800705 ATTTTTTCACAGATGGATTGTGG + Intronic
978767867 4:112422936-112422958 CTGTTTTGACAAATGGAATGTGG - Intronic
979188214 4:117824954-117824976 CTGTTTTCAAAGAGGAAAGGTGG + Intergenic
979743516 4:124180487-124180509 CTGTTGTCAGGGATGGAATGGGG + Intergenic
980985710 4:139692350-139692372 CTGTATTCCCAGAAGGAATTGGG - Intronic
981024451 4:140063078-140063100 CTGTTTTCTCATCTAGAATGGGG - Intronic
981510458 4:145551312-145551334 CTGTTTGCATATATGGTATGAGG - Intronic
981631917 4:146829223-146829245 CTGTTTTCCCAGTTGGAAACTGG - Intronic
981725791 4:147845838-147845860 CTGTACTCTCAAATGGAATGTGG + Intronic
982023398 4:151227987-151228009 CAGTCTGCACAGCTGGAATGTGG + Intronic
982301249 4:153881364-153881386 CTGCTTTCACAGCTGGTGTGAGG - Intergenic
982631513 4:157835466-157835488 TTGCTTTGACCGATGGAATGTGG - Intergenic
983718294 4:170814269-170814291 TTGATTTCACAGATAGTATGTGG + Intergenic
984084363 4:175290226-175290248 CTGTTTTCAGTGATTGTATGAGG - Intergenic
984444291 4:179814933-179814955 GTGTTTTTAAAGTTGGAATGAGG + Intergenic
986526470 5:8683890-8683912 CTGATTCCACAGGTTGAATGAGG - Intergenic
987692268 5:21282605-21282627 CTGAATGCAAAGATGGAATGAGG - Intergenic
987710274 5:21495442-21495464 CTGTTTTCAAAGATGGTCTTTGG + Intergenic
987811582 5:22843228-22843250 GTGTTTTCACAGATAGAATTGGG - Intronic
988749340 5:34178731-34178753 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
988916630 5:35900892-35900914 ATGTATTCACAGATGGTGTGTGG - Intergenic
989001800 5:36768722-36768744 TTGTTTTGACAAATAGAATGTGG - Intergenic
990091261 5:52052700-52052722 CTGTGTTCTCACATGGAAGGAGG + Intronic
990928480 5:61057486-61057508 ATGTATTCACAGATGGACTGGGG + Intronic
990957879 5:61361967-61361989 ATGTTTTCACATATGGAAATAGG + Intronic
991333756 5:65523880-65523902 CTGTCTTTTAAGATGGAATGTGG - Intronic
991737595 5:69641923-69641945 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
991748092 5:69767446-69767468 CTGAATGCAAAGATGGAATGAGG + Intergenic
991760599 5:69914502-69914524 CTGTTTTCAAAGATGGTCTTTGG + Intergenic
991786733 5:70203599-70203621 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
991789171 5:70221649-70221671 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
991799672 5:70347293-70347315 CTGAATGCAAAGATGGAATGAGG + Intergenic
991813921 5:70496755-70496777 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
991817052 5:70518039-70518061 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
991828925 5:70662745-70662767 CTGAATGCAAAGATGGAATGAGG - Intergenic
991839830 5:70789552-70789574 CTGTTTTCAAAGATGGTCTTTGG + Intergenic
991879178 5:71203984-71204006 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
991881618 5:71222013-71222035 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
991892030 5:71346722-71346744 CTGAATGCAAAGATGGAATGAGG + Intergenic
992114237 5:73523959-73523981 TTGTTTTCACAAATGTAATATGG - Intergenic
993250044 5:85510110-85510132 CTGTTTTCATAGAATGAATTAGG + Intergenic
993347306 5:86800257-86800279 CTGTTTTCACAAATGCAAAGTGG - Intergenic
994422226 5:99535547-99535569 CTGTTTTCAAAGATGGTCTTTGG + Intergenic
994460145 5:100061993-100062015 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
994484293 5:100375418-100375440 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
994630059 5:102274403-102274425 ATGTTTTGACATATGGTATGTGG - Intronic
995473061 5:112523544-112523566 CTATTTTCACAGCTGGGAGGTGG - Intergenic
995881829 5:116851875-116851897 CAGTTTTCACCGGTGCAATGTGG + Intergenic
996332003 5:122340340-122340362 CTGTGTTCACATATACAATGAGG - Intronic
996925214 5:128817280-128817302 CTGTTTTCATAGATTGAATTGGG - Intronic
998499033 5:142615978-142616000 CCTGTTTCACAGATGGCATGGGG - Intronic
1000976899 5:167774879-167774901 CTGTCTTAACAGATGCACTGGGG - Intronic
1000978855 5:167794892-167794914 TTCTTTTCACAGATGTACTGTGG + Intronic
1001842991 5:174895356-174895378 TTTTTTTCACAGATGGGAAGGGG + Intergenic
1002494019 5:179599654-179599676 CTGTTTTCCCAGAGGGGAGGAGG + Intronic
1002508404 5:179696842-179696864 GTGTTTTTACAAATTGAATGTGG + Intronic
1002692192 5:181058223-181058245 CAGTTGTCACAGTGGGAATGGGG + Intronic
1004919881 6:20366623-20366645 CTGTTTGCTCTGATGGAGTGTGG - Intergenic
1005547414 6:26885077-26885099 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
1006259705 6:32857598-32857620 CTGTGTTCACATATAGAATGTGG - Intronic
1006936251 6:37720572-37720594 CTGTCTGCAAAGATGGGATGGGG + Intergenic
1008483540 6:52010946-52010968 ATTTTTTCACAGTTGGAATTAGG - Intronic
1009018177 6:57926144-57926166 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
1010388154 6:75306009-75306031 CTGTCTTCACAAATGGAAGTTGG + Intronic
1010862780 6:80934284-80934306 CTGGTTTCACAGATTGATTTAGG + Intergenic
1011527625 6:88282360-88282382 CTATTTTCACAGCTGCTATGAGG + Intergenic
1012960482 6:105616661-105616683 CTGTCCCCACAGATGGAATGAGG - Intergenic
1013318523 6:108964101-108964123 CTTGTTTTACAGATGGTATGGGG - Intronic
1013563869 6:111335600-111335622 CTTTTTTAACAGATGGAAAATGG - Exonic
1013914329 6:115316425-115316447 CTGTTTTTACAGAAGGCTTGTGG + Intergenic
1015015221 6:128404730-128404752 ATGATTTCACAGATGAAAAGAGG + Intronic
1015891922 6:137978047-137978069 CAGACCTCACAGATGGAATGAGG + Intergenic
1018058102 6:160069651-160069673 GTTTTGTCACAGATGGACTGGGG - Intronic
1018486661 6:164247193-164247215 CTGGTGTCACAGCTGGCATGTGG + Intergenic
1020083287 7:5297699-5297721 CTGGTTTCCCTGAGGGAATGTGG + Intronic
1021251138 7:18326968-18326990 TTGCTTTTACAGATGTAATGAGG - Intronic
1021268929 7:18560722-18560744 CTGTTTTGATAGAGGGAACGTGG + Intronic
1022177857 7:27889270-27889292 CTGTTTTCAGAGGTTCAATGGGG + Intronic
1022574005 7:31480200-31480222 CTGGTTTCACAGCTCGCATGTGG - Intergenic
1024237332 7:47408339-47408361 CTGTTGTAGCAGTTGGAATGAGG - Intronic
1024801035 7:53078751-53078773 CTGTTTTTACAGATTGAATAGGG - Intergenic
1025161745 7:56667183-56667205 CTGTCTCCACAGTTGGAATTGGG + Intergenic
1025613309 7:63096772-63096794 CTGTTTTCAGAGATGGTCTTTGG + Intergenic
1025927241 7:65969994-65970016 CTGTTTTCACAGATGGTCTTTGG - Intronic
1025984080 7:66432424-66432446 CCATTTTCACTGAGGGAATGAGG - Intergenic
1026001352 7:66561184-66561206 CCATTTTCACTGAGGGAATGAGG - Intergenic
1026502628 7:70956089-70956111 CTCTTTTCACACGTGAAATGTGG + Intergenic
1027207242 7:76110772-76110794 CCATTTTCACTGAGGGAATGAGG - Intergenic
1027711371 7:81605641-81605663 CTGTGTTCACAGATCGAATTCGG + Intergenic
1027943261 7:84712069-84712091 CTTTATTCACAGATGAAGTGTGG - Intergenic
1028876082 7:95824834-95824856 CGGTTTACACAGAAGGAATTCGG + Intronic
1028900939 7:96100008-96100030 CTGATGTCCCAGATGAAATGTGG + Intronic
1029819573 7:103132932-103132954 CTGTTTCCACAGATTGATTGGGG - Intronic
1030224042 7:107128991-107129013 CTATTTTCACATTTGGAATATGG - Intronic
1030750967 7:113232315-113232337 CTGTTTCCACATATGTAATATGG - Intergenic
1031662515 7:124443551-124443573 CTGTTTCCTCATATGGCATGAGG + Intergenic
1032255438 7:130293414-130293436 CTGATTTCACAGATGAAATGGGG - Intronic
1034201937 7:149288102-149288124 CTGCTTTGGAAGATGGAATGGGG + Intronic
1034283176 7:149867391-149867413 CTATTTTCAAAGATGAAAGGAGG + Exonic
1034853344 7:154516614-154516636 CTGATTTAACACATGGAGTGAGG + Intronic
1034855709 7:154544743-154544765 CAGTTGTAACAGCTGGAATGTGG + Intronic
1035283299 7:157791309-157791331 CTGTTTTCAAACATGGAATCGGG - Intronic
1036133735 8:6140083-6140105 CTGTTTACACAAAGGGAATAGGG - Intergenic
1036943602 8:13073713-13073735 TTGTTTTCAGAGATGGGATCTGG - Intergenic
1037985199 8:23286620-23286642 CTGTTTTCAGAGACAGCATGTGG + Intronic
1038136989 8:24796969-24796991 ATGTTTGCAGAGATGGAGTGTGG - Intergenic
1039170273 8:34737488-34737510 ATGTTTGCAAAGATGGATTGAGG - Intergenic
1039848753 8:41344428-41344450 CTGTTTTCTCAGATGTCCTGGGG - Intergenic
1041047191 8:53898742-53898764 CTGTTTTTCCAGATGCACTGTGG + Intronic
1041349814 8:56937259-56937281 CTGTTTTCAAAGGTGGTGTGGGG - Intergenic
1041365431 8:57098154-57098176 CTATTTTCACAGAAGGAGTTAGG + Intergenic
1041869736 8:62619130-62619152 GTGTTTTCACAGATGAAAGCAGG - Intronic
1042484668 8:69336905-69336927 CTGGCTTCACAGATGGGATCTGG + Intergenic
1042797675 8:72682628-72682650 CTGTTTCCCAGGATGGAATGCGG + Intronic
1043482303 8:80665663-80665685 CTGTTTTCAGAGGTTGAATGGGG - Intronic
1046584401 8:116133549-116133571 TTGTTTTCACAGTTCAAATGGGG - Intergenic
1047179869 8:122576779-122576801 CTGGATTCAGAGATGGAAGGGGG - Intergenic
1047193573 8:122700781-122700803 CTGATTAGACAGGTGGAATGTGG - Intergenic
1047643294 8:126843804-126843826 CAGTTTGCACAGATGGAAGCAGG - Intergenic
1048290442 8:133177294-133177316 CTGTTTTCACAGCTGTAAAATGG + Intergenic
1049250149 8:141583887-141583909 CTGCTTCCAGAGATGGAAAGTGG + Intergenic
1050301102 9:4259715-4259737 CTCTATTCACAGATGGGGTGGGG + Intronic
1050496966 9:6253225-6253247 CTGTTGTGAAAGATGGAAAGAGG + Intronic
1050856685 9:10366192-10366214 CTGTATTTACAGATGGCATAGGG - Intronic
1051111040 9:13637036-13637058 CTGGCTTTACAGATGGAATGGGG + Intergenic
1052835436 9:33246610-33246632 ATGTGTTCACAGATGGGCTGTGG - Exonic
1053557878 9:39157237-39157259 CTGTTTTCACAGTTGCTCTGTGG + Intronic
1053619555 9:39801546-39801568 CTGTTATCCAAGCTGGAATGTGG - Intergenic
1054139236 9:61461714-61461736 CTGTTTTCACAGTTGCTCTGTGG - Intergenic
1054338480 9:63830951-63830973 TTGTTTTCACAACTGGAATACGG - Intergenic
1057287664 9:93773231-93773253 GTGATATTACAGATGGAATGAGG + Intergenic
1059322659 9:113481547-113481569 CTGTTTGCACAGCTGGAGTCAGG - Intronic
1060317122 9:122522457-122522479 ATTTTGTCACAGATGGAAAGTGG + Intergenic
1060582747 9:124766532-124766554 CTGTTTTTACACATGAAATAAGG + Intronic
1061017738 9:127992107-127992129 CAGTTTTCACAGCTGAAAAGTGG + Intergenic
1061110885 9:128570130-128570152 TTGTTTTCCCAGAGTGAATGAGG + Intronic
1061533792 9:131235180-131235202 CTGTGTTCACAGGTGAAGTGGGG + Intergenic
1061579141 9:131526215-131526237 CTGTCTTCTGTGATGGAATGGGG - Intronic
1185823231 X:3224874-3224896 CAGGGTTCACAGAAGGAATGAGG + Intergenic
1186169813 X:6864724-6864746 CTGGCTTCAAAGATGGAAGGAGG - Intergenic
1186717370 X:12266535-12266557 CTGCTTTCACCAATAGAATGAGG - Intronic
1187205733 X:17179257-17179279 CTATTTCCACAAATAGAATGTGG + Intergenic
1187533569 X:20117379-20117401 CTGTGTTCACACATTGAGTGAGG - Intergenic
1187910959 X:24110835-24110857 CTGTTTTTAAAAAAGGAATGGGG - Intergenic
1188586580 X:31783590-31783612 TTGTTTTCACAATTAGAATGAGG + Intronic
1189088382 X:38051047-38051069 CTGTTTTGGGTGATGGAATGTGG + Intronic
1190048096 X:47128650-47128672 CTTTTTTCACAGGTGCAGTGAGG + Intergenic
1190287854 X:48972381-48972403 CTGTTTTTAGATATGAAATGAGG + Intergenic
1191141030 X:57117139-57117161 GTGGTTTCAGAGATGTAATGGGG - Intergenic
1193144738 X:78065028-78065050 CCCTTTTCACAGATGGTATAAGG + Intergenic
1193964754 X:87972034-87972056 CAGTAATCACAGATGTAATGTGG + Intergenic
1196189514 X:112780136-112780158 CTGTTGACACAGATTGAGTGTGG + Intronic
1198478621 X:137019667-137019689 CTGTTTTCTCAGCTGGAAAATGG - Intergenic
1198775879 X:140178555-140178577 CTGTTTTCAAAGATGGGGCGGGG - Intergenic
1199013342 X:142782321-142782343 CTGTTTACTCAGAAGCAATGAGG - Intergenic
1201758372 Y:17514173-17514195 CTTTTCTTACAGCTGGAATGAGG + Intergenic
1201843183 Y:18391817-18391839 CTTTTCTTACAGCTGGAATGAGG - Intergenic