ID: 950073969

View in Genome Browser
Species Human (GRCh38)
Location 3:10174077-10174099
Sequence ATCCACACACACTCCCATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 285}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950073969_950073976 3 Left 950073969 3:10174077-10174099 CCAAGATGGGAGTGTGTGTGGAT 0: 1
1: 0
2: 0
3: 30
4: 285
Right 950073976 3:10174103-10174125 CAATGCTTCGTGGGGGGAGATGG 0: 1
1: 0
2: 1
3: 6
4: 112
950073969_950073973 -4 Left 950073969 3:10174077-10174099 CCAAGATGGGAGTGTGTGTGGAT 0: 1
1: 0
2: 0
3: 30
4: 285
Right 950073973 3:10174096-10174118 GGATGACCAATGCTTCGTGGGGG 0: 1
1: 0
2: 0
3: 1
4: 52
950073969_950073972 -5 Left 950073969 3:10174077-10174099 CCAAGATGGGAGTGTGTGTGGAT 0: 1
1: 0
2: 0
3: 30
4: 285
Right 950073972 3:10174095-10174117 TGGATGACCAATGCTTCGTGGGG 0: 1
1: 0
2: 0
3: 1
4: 48
950073969_950073974 -3 Left 950073969 3:10174077-10174099 CCAAGATGGGAGTGTGTGTGGAT 0: 1
1: 0
2: 0
3: 30
4: 285
Right 950073974 3:10174097-10174119 GATGACCAATGCTTCGTGGGGGG 0: 1
1: 0
2: 0
3: 3
4: 47
950073969_950073971 -6 Left 950073969 3:10174077-10174099 CCAAGATGGGAGTGTGTGTGGAT 0: 1
1: 0
2: 0
3: 30
4: 285
Right 950073971 3:10174094-10174116 GTGGATGACCAATGCTTCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 44
950073969_950073970 -7 Left 950073969 3:10174077-10174099 CCAAGATGGGAGTGTGTGTGGAT 0: 1
1: 0
2: 0
3: 30
4: 285
Right 950073970 3:10174093-10174115 TGTGGATGACCAATGCTTCGTGG 0: 1
1: 0
2: 1
3: 6
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950073969 Original CRISPR ATCCACACACACTCCCATCT TGG (reversed) Intronic
902805048 1:18855757-18855779 ATCCACACCCTCCCCCATCTTGG + Intronic
902918020 1:19650483-19650505 TTCCACACTCACTCACTTCTAGG - Intronic
904987020 1:34559989-34560011 ATGTACACACATTCCCAGCTAGG + Intergenic
907000462 1:50847893-50847915 ACACACACACACACCCCTCTAGG + Intronic
907936895 1:59049501-59049523 ATGCACACACATTCCCTTCTCGG - Intergenic
911220277 1:95238006-95238028 ATGCACAAACACTCCCCTTTGGG - Intronic
912171153 1:107101065-107101087 ATGTACCCACACTCCCATCCTGG - Intergenic
912624872 1:111198649-111198671 ATGCCCACTCATTCCCATCTGGG + Exonic
914788608 1:150855904-150855926 ATACACACACACACACATTTCGG - Intronic
914812438 1:151038749-151038771 TCCAACACACACACCCATCTTGG + Intronic
915369470 1:155336403-155336425 ATACACACACACACACAACTTGG + Exonic
915590312 1:156866751-156866773 ATCTACACACACTGCCTTCCAGG + Intronic
916624484 1:166540406-166540428 ACACACACACACACACATCTTGG + Intergenic
917311382 1:173682707-173682729 ACACACACACACACACATCTTGG + Intergenic
917485124 1:175448682-175448704 AACCACACACCCTCCCAGGTGGG + Intronic
918432659 1:184478182-184478204 ATCCTCACTCACTCCCCTTTTGG - Intronic
919773456 1:201177785-201177807 ACACACACACACACCCGTCTAGG - Intergenic
920204252 1:204280354-204280376 ATGCACACACACTCCCAGGCTGG + Intronic
921105298 1:211971031-211971053 ATCCACACACACTTCCAAATTGG + Intronic
921654321 1:217716883-217716905 ATCCACACAAACCCCCTTTTGGG + Intronic
921718417 1:218443525-218443547 ATCAACACACACTCAAATCTGGG - Exonic
922583382 1:226715473-226715495 ATCAACACACACAACCATCCTGG + Intronic
1064106392 10:12504234-12504256 ACACACACACACACACATCTAGG + Intronic
1065291981 10:24239668-24239690 ACACACACACACACACATCTGGG - Intronic
1070368620 10:75760385-75760407 AGCCACTCTCAATCCCATCTTGG - Intronic
1071411869 10:85405290-85405312 ACACACACACACACACATCTGGG - Intergenic
1071457034 10:85858787-85858809 ATCCACACACTCACACATCAGGG + Intronic
1072642038 10:97218870-97218892 ATACACACACACACCGACCTTGG - Intronic
1074956770 10:118398173-118398195 ATACACACACACAACTATCTAGG + Intergenic
1075297190 10:121288062-121288084 ATACACACACACACCCATCCAGG + Intergenic
1075319975 10:121483614-121483636 TTACACACACACTCCCCTGTTGG - Intronic
1075347331 10:121692995-121693017 TTCCACCCAAACTCCCCTCTTGG - Intergenic
1075350432 10:121719838-121719860 ACACACACACACACCCCTCTAGG + Intergenic
1076288681 10:129326792-129326814 ACCCTCACAAACTCCCATCCAGG + Intergenic
1076509761 10:131004550-131004572 ATCCACAGACATTCCTCTCTTGG + Intergenic
1077130170 11:968057-968079 CTCCACACCCTCACCCATCTCGG - Intronic
1077312241 11:1894099-1894121 ACACACACACACTCCCAGCCCGG - Intergenic
1079475493 11:20825262-20825284 CTCCACACACAATCCCCACTGGG + Intronic
1079962425 11:26940849-26940871 ACCCACACAGACTCCCTACTGGG - Intergenic
1080784376 11:35461633-35461655 ACCCACACACACACACACCTTGG + Intronic
1081557284 11:44176751-44176773 ATCCACACCTACTCCCACCTCGG - Intronic
1081852183 11:46281452-46281474 CTCCCCACACCCTCCCAGCTGGG - Intronic
1082102427 11:48183891-48183913 ATACACACACACACACATTTTGG - Intergenic
1082949616 11:58798593-58798615 ACACACACACACACTCATCTTGG + Intergenic
1083039285 11:59670010-59670032 ATCCAGACACACTAACATTTAGG - Intergenic
1083464268 11:62834768-62834790 ATCCCCCCATACTCCCATCTAGG + Intronic
1084261663 11:67983065-67983087 ATGCACACCCACTGCTATCTTGG - Intergenic
1084810981 11:71611046-71611068 ATGCACACCCACTGCTATCTTGG + Intergenic
1086799364 11:91152523-91152545 CCCCACACACAGTCCCCTCTGGG - Intergenic
1086873879 11:92072511-92072533 ATCAAAACACACTACTATCTAGG + Intergenic
1087050049 11:93877721-93877743 ACACACACACACACACATCTTGG + Intergenic
1087184457 11:95173439-95173461 ATACACACACACACACACCTAGG + Intronic
1087541925 11:99531951-99531973 ACCCACACAGAGTCCCTTCTGGG + Intronic
1087858863 11:103128365-103128387 ATCCATACACTCTCCTCTCTTGG - Intronic
1089821648 11:121233625-121233647 ATACACACACATACCCTTCTAGG + Intergenic
1092140683 12:6181384-6181406 ATACACACACACACACATATAGG - Intergenic
1092148238 12:6229434-6229456 TTACACACCCACTCCCCTCTGGG + Intronic
1095191128 12:39259408-39259430 ATACACACACACACACATCTTGG + Intergenic
1096520316 12:52181229-52181251 CTCCACACCCACTCCCCTCCAGG + Intronic
1097346984 12:58504364-58504386 ATCAACACACTCTCCACTCTGGG + Intergenic
1098523079 12:71455428-71455450 ACCCACACCCACTCCCATTTTGG + Intronic
1099668471 12:85660266-85660288 CTCCACACAGAGTCCCTTCTGGG + Intergenic
1099789417 12:87312670-87312692 ATCTACACATACTTGCATCTTGG + Intergenic
1102032935 12:109753413-109753435 ATACATACACACCCCCATCAGGG - Intronic
1102407441 12:112686007-112686029 ACCCACACACTCTTCCACCTCGG - Intronic
1105659666 13:22479984-22480006 AACCACACACACACACATTTGGG + Intergenic
1108848242 13:54700224-54700246 CTCCACACACACACACACCTTGG - Intergenic
1109777444 13:67060342-67060364 TTCCCCACACGCTCACATCTTGG + Intronic
1109830747 13:67784142-67784164 ATACACACACACACACATATGGG - Intergenic
1109871820 13:68342628-68342650 AGCCACACAGAGTCCCGTCTGGG - Intergenic
1110298790 13:73900830-73900852 CTCCACACACATTCTCATCAGGG + Intronic
1112937361 13:104817750-104817772 ATACACACACACACACATATGGG + Intergenic
1113203064 13:107888050-107888072 CTCCACACAAAGTCCCCTCTGGG - Intergenic
1114451240 14:22827105-22827127 ATCCACAGACACACGCATCTTGG + Intronic
1117147846 14:52853144-52853166 ATACACACACACTCTCAGTTGGG - Intergenic
1118496068 14:66309098-66309120 ACCCACACATATTCCCTTCTGGG - Intergenic
1119052899 14:71387531-71387553 AGCCACACACACACCTTTCTTGG - Intronic
1120600774 14:86505196-86505218 ATACACACACACACACAACTTGG - Intergenic
1122278348 14:100606927-100606949 ATGCCCAGACACTCCCCTCTTGG + Intergenic
1122308705 14:100781245-100781267 AGCCTCACACCCTCCCCTCTGGG - Intergenic
1125593547 15:40870598-40870620 AGCCTGACACACTCCCCTCTGGG - Intergenic
1128804420 15:70519950-70519972 ACACACACACACCCCAATCTGGG + Intergenic
1129783116 15:78287818-78287840 AACCAAAAACGCTCCCATCTAGG + Intronic
1131550907 15:93356009-93356031 ACCCACCCGCACCCCCATCTTGG - Intergenic
1132668267 16:1091578-1091600 ACCCACCCACACTCCCAAATGGG + Intronic
1133150367 16:3823980-3824002 ACACACACACACACTCATCTAGG + Intronic
1134537524 16:15038377-15038399 ACCCACACACATTTCCATCTAGG + Intronic
1136554700 16:31001082-31001104 AGCCACACTCACTCTCATCTGGG + Exonic
1140225125 16:73070956-73070978 ACACACACACACACACATCTGGG + Intergenic
1141097604 16:81174023-81174045 ACCCACACACACACCCCTGTGGG - Intergenic
1141191877 16:81830987-81831009 AACCATACACATTTCCATCTTGG + Intronic
1144811841 17:18005505-18005527 ATCAACACTAACTCCCATTTGGG + Intronic
1145325682 17:21822184-21822206 ATCCATACACACTACTTTCTGGG - Intergenic
1146777533 17:35634956-35634978 AGAAACACACACACCCATCTTGG - Intronic
1147028259 17:37608815-37608837 GTCCACACACACACCCCCCTTGG + Intronic
1148709384 17:49666481-49666503 ACACACACACACACCCATATAGG + Intronic
1148876753 17:50692182-50692204 AGCCACCCACACTCCCAGGTTGG + Exonic
1149015925 17:51908103-51908125 ACCCACAAACACTACCATCCAGG + Intronic
1150854451 17:68737641-68737663 ATATACACACACACACATCTAGG - Intergenic
1151093120 17:71465143-71465165 ATACACACACACACCAATCTAGG + Intergenic
1151212279 17:72553583-72553605 ATCCACACACTCATCCACCTGGG + Intergenic
1151212294 17:72553695-72553717 ATCCACACACTCATCCACCTGGG + Intergenic
1152220978 17:79066246-79066268 ATACACACACACACACATATAGG + Intergenic
1152314693 17:79573345-79573367 ATCCACACACACACACCTGTGGG + Intergenic
1153020410 18:623707-623729 ACACACACACACTCCTGTCTGGG + Intronic
1156415651 18:36886491-36886513 ACACACACACACACCCCTCTAGG - Intronic
1158740565 18:60136905-60136927 ACGCACACACACTCACATATAGG + Intergenic
1159946622 18:74448612-74448634 GTGCACACACACTTCCCTCTTGG - Intronic
1160016436 18:75144390-75144412 ATGAACACACACCCCCATGTAGG - Intergenic
1160449017 18:78949330-78949352 GTCCACACGGGCTCCCATCTCGG - Intergenic
1160472640 18:79151310-79151332 GCCCAAACACACTCCCACCTCGG - Intronic
1160543882 18:79640259-79640281 TTCCACTCAGACTCCCATGTGGG - Intergenic
1160958663 19:1707205-1707227 ACCCACACTCACTCCCGCCTTGG + Intergenic
1161911497 19:7197951-7197973 ACACACACACACTCCCACCATGG - Intronic
1161911503 19:7197976-7197998 ACACACACACACTCCCACCATGG - Intronic
1161911510 19:7198026-7198048 ACACACACACACGCCCATCATGG - Intronic
1162079590 19:8210028-8210050 CTCCGCACACACTCCCGGCTAGG - Intronic
1163242689 19:16074034-16074056 ATACACACACACACACATATGGG + Intronic
1163359706 19:16837931-16837953 ATCCACACACAGCCCCGCCTGGG - Intronic
1163579676 19:18130889-18130911 ATCCTCACACACTCCTGTCTGGG - Intronic
1164155658 19:22595664-22595686 TTCCAGACACACCCCCCTCTCGG - Intergenic
1167768306 19:51498967-51498989 CTCCACACACACACCTATTTTGG - Intronic
1168117332 19:54230820-54230842 ACACACACACCCTCCCTTCTTGG - Intronic
1168237886 19:55075140-55075162 ACCCAGACACACTCCCCTCACGG + Intronic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
926836697 2:17031384-17031406 CTCCACACACACTCCCCACTGGG - Intergenic
927011226 2:18906620-18906642 ACACACACACACACACATCTTGG - Intergenic
930059090 2:47273614-47273636 CACCAGACACACTCCCACCTCGG + Intergenic
931254975 2:60562853-60562875 CTCCACACCCACTTCCATCAGGG + Intergenic
932194565 2:69772154-69772176 ATGCAAACACGCTCCCATTTTGG - Intronic
933608823 2:84412927-84412949 AACCACACTCATTCCCATTTGGG + Intergenic
933707814 2:85304716-85304738 ATCCAGACATAACCCCATCTAGG + Intronic
936874493 2:117172220-117172242 CTCCACACACAGTCCCCACTGGG + Intergenic
937210798 2:120268560-120268582 CCCCACACACACTCCCGTCCTGG - Intronic
937368712 2:121283571-121283593 CTCCAGACAAACTTCCATCTCGG + Intronic
939003699 2:136763623-136763645 CTGCACACACACCCCCATATGGG - Intergenic
939422957 2:141997372-141997394 ATGTACACACACACACATCTTGG - Intronic
939500514 2:142977352-142977374 ATCCACACAAAATTCCATCCAGG - Intronic
939907966 2:147941753-147941775 ATACACACACATCTCCATCTGGG - Intronic
940334201 2:152508225-152508247 CTCCACACACCATCCTATCTCGG - Intronic
941184022 2:162298800-162298822 ACACACACACACTCACATTTTGG + Intronic
941694672 2:168538273-168538295 AGCCACACACAGTGCCTTCTAGG - Intronic
942127012 2:172837120-172837142 ATACACACACACACCCAACATGG - Intronic
942960395 2:181823476-181823498 ATACACACACACACATATCTTGG - Intergenic
943262089 2:185679016-185679038 ACACACACACACACACATCTTGG + Intergenic
944836660 2:203587116-203587138 ACACACACACACTCACATCAAGG + Intergenic
944905526 2:204257965-204257987 ATGCACACACACTTCCCTTTTGG + Intergenic
945561469 2:211345950-211345972 GTCCACACAGACTGCCATCATGG + Intergenic
945988539 2:216373558-216373580 ACACACACACACACCCCTCTAGG + Intergenic
948792192 2:240384862-240384884 ATCCGCACACACTCCCACCGTGG + Intergenic
948996498 2:241582883-241582905 TTCCACACACCCTTCCAGCTGGG + Intergenic
1168868217 20:1107205-1107227 ATACACACACACACACAGCTTGG - Intergenic
1170702785 20:18718699-18718721 ATGCACACACACACCCCTCTAGG + Intronic
1171983149 20:31640979-31641001 ACACACACACACACACATCTTGG + Intronic
1173025602 20:39304950-39304972 ACCAACACACATACCCATCTTGG + Intergenic
1173485131 20:43435455-43435477 ACATACACACACTCACATCTTGG - Intergenic
1173567714 20:44053650-44053672 ATGCACACACACTCCAAACTTGG + Intronic
1175467836 20:59204599-59204621 CTCCACACACATTCCTTTCTGGG - Intronic
1175934292 20:62507997-62508019 AACCAAACACACTTCCATCATGG - Intergenic
1176205806 20:63887490-63887512 ATCCACACACAACCCCAACTTGG - Intronic
1176657685 21:9602471-9602493 ATCCCCACAGACTCCCCACTAGG - Intergenic
1176864801 21:14041257-14041279 ATCAACATACACGCCCATCAGGG - Intergenic
1177399694 21:20586903-20586925 ATACACACACACACCCCTCCTGG - Intergenic
1178293074 21:31386323-31386345 ACCCACTCACCCTCCCTTCTTGG + Intronic
1179097163 21:38326273-38326295 ATTCACATACACTCGCAGCTTGG + Intergenic
1179169796 21:38963963-38963985 ATCCTCATATCCTCCCATCTCGG + Intergenic
1180213078 21:46307379-46307401 ATTCACACACACCCCTACCTCGG + Intronic
1181107100 22:20582009-20582031 AGCCACACACACACCCATGGTGG - Intronic
1181597583 22:23926703-23926725 ATCCACTCACCCACCCCTCTGGG + Intergenic
1182700129 22:32230109-32230131 ATCCACACACACTCTGTCCTAGG - Intronic
1182741333 22:32570153-32570175 CTCCACACACACTGCCTTCTAGG + Intronic
1183477493 22:38043477-38043499 ATGCACACACACTCCCATTGGGG + Intergenic
1183730943 22:39618002-39618024 ACACACACTCACTCCCTTCTTGG - Intronic
949882505 3:8672820-8672842 ATGCACACCCACTGCTATCTTGG + Intronic
950073969 3:10174077-10174099 ATCCACACACACTCCCATCTTGG - Intronic
951427398 3:22563716-22563738 ATACACACACACTCATAGCTTGG + Intergenic
951820352 3:26803001-26803023 ACACACACACACTCCCTTGTGGG - Intergenic
952052304 3:29399202-29399224 ATACACACACACACACATGTGGG - Intronic
954453580 3:50585081-50585103 TTCCTCACCCACTCCCTTCTGGG - Intergenic
955475660 3:59333520-59333542 CTCCCTACACACTCACATCTAGG - Intergenic
955782574 3:62501077-62501099 ATCCAGCCACATTTCCATCTGGG - Intronic
957076735 3:75608645-75608667 ATGCACACCCACTGCTATCTTGG - Intergenic
958765444 3:98361570-98361592 CTCCACACACACTCCTCTCAAGG - Intergenic
958936082 3:100257421-100257443 ATCAACAGGCACTCTCATCTGGG - Intergenic
959032995 3:101323936-101323958 ACACACACACACACCCCTCTAGG + Intergenic
959962179 3:112310707-112310729 ATACACACACACACACATTTTGG + Intergenic
960028576 3:113035382-113035404 ATGCACACACACAAACATCTTGG - Intergenic
961029682 3:123590807-123590829 ATCCACACAGAGTCCCCACTGGG - Intergenic
961071995 3:123940636-123940658 ATTCACACACTCTACCTTCTTGG + Intronic
963760458 3:149283115-149283137 ACACACACACACACACATCTTGG - Intergenic
965250499 3:166337392-166337414 ATACACACACACACACATCATGG - Intergenic
965864088 3:173183520-173183542 ACCCACACAGAGTCCCTTCTGGG + Intergenic
966526143 3:180921291-180921313 CTCCACACACACCCCCACCCTGG - Intronic
968067889 3:195768936-195768958 CTGCACACACACTCCCATCCTGG - Intronic
969020188 4:4134940-4134962 ATGCACACCCACTGCTATCTTGG - Intergenic
972559383 4:40213387-40213409 TCTCACACACACACCCATCTTGG + Intronic
973245936 4:48011415-48011437 ACACACACACACACACATCTTGG + Intronic
973885068 4:55312609-55312631 AGCCACAAACACTCCAATTTTGG + Intergenic
974240496 4:59239415-59239437 ATACACACACACACACATCATGG + Intergenic
975578681 4:75887826-75887848 ATCCACACACATTCCTCTCCTGG - Intronic
976039434 4:80865036-80865058 ATCCAAACTCACACCCAGCTTGG - Intronic
979243100 4:118466733-118466755 ACACACACACACTCACATCCTGG + Intergenic
981124111 4:141086056-141086078 ACACACACACACACCCTTCTAGG + Intronic
983450502 4:167904914-167904936 ATACACACACACACACATATAGG - Intergenic
984774297 4:183467268-183467290 CTCCACACAGACTCCCTCCTGGG + Intergenic
986365936 5:7031658-7031680 ACACACACACACACACATCTTGG + Intergenic
987453741 5:18118483-18118505 ACACACACACACACACATCTTGG - Intergenic
988498420 5:31764139-31764161 ATCCACACTCATTCCCTTCACGG + Intronic
989256512 5:39371453-39371475 ACCCACACACACTCCCTTTCCGG - Intronic
990232760 5:53732524-53732546 ATACACACACACACATATCTGGG - Intergenic
992559930 5:77941370-77941392 CTCCCCACCCACCCCCATCTTGG + Intergenic
992980980 5:82171622-82171644 ATCCAAACACACTTCCAATTTGG - Intronic
992985628 5:82226110-82226132 ATACACACACAGTCACATCTTGG - Intronic
993524059 5:88942640-88942662 ACACACACACACTCCCCACTTGG + Intergenic
996273431 5:121636587-121636609 CTCTACACAGACTCCCTTCTGGG - Intergenic
998640888 5:144010141-144010163 ATCCACCCACCCCCCCACCTCGG + Intergenic
999804862 5:155071988-155072010 CTCCACACACAGTCCCTACTGGG - Intergenic
1004646612 6:17568357-17568379 ACACACACACACACACATCTTGG + Intergenic
1005104892 6:22213805-22213827 ATGCCCCTACACTCCCATCTGGG - Intergenic
1006413694 6:33891107-33891129 TTCCAAGCACACTCCCATTTGGG + Intergenic
1009927052 6:70132684-70132706 ATCCACAGAGACTCCGATTTAGG + Intronic
1010495045 6:76523679-76523701 AGTCACATACACTCACATCTAGG - Intergenic
1012059865 6:94464713-94464735 ATCTACACATGCTCCCAGCTAGG + Intergenic
1014110356 6:117613749-117613771 ACACACACACACACACATCTTGG - Intergenic
1016079299 6:139836340-139836362 ATACACACACACACACATATAGG - Intergenic
1016796492 6:148123533-148123555 ATCCACACACACACTCCTCACGG - Intergenic
1017158284 6:151341778-151341800 AAACCCACACACACCCATCTCGG - Intronic
1018145630 6:160884668-160884690 ACACATACACACTCACATCTTGG - Intergenic
1018193217 6:161329567-161329589 ATACACACACACACACATCTTGG + Intergenic
1018837375 6:167495510-167495532 ACACACACACACACACATCTGGG + Intergenic
1018987220 6:168647070-168647092 CCCCATACACACTCCCACCTGGG - Intronic
1020105166 7:5419463-5419485 ATGCACACACACACACATCACGG + Intronic
1020307601 7:6846969-6846991 ATGCACACCCACTGCTATCTTGG - Intergenic
1023030850 7:36089430-36089452 TTTCTCATACACTCCCATCTAGG - Intergenic
1023895991 7:44433257-44433279 ATACACACACACACACATGTTGG - Intronic
1024698591 7:51882955-51882977 ATCCAAACACACTCACATTTTGG + Intergenic
1025184980 7:56850648-56850670 ATCCACACTCTTTCCCCTCTGGG + Intergenic
1025638412 7:63345578-63345600 ATCCACAATCACACCCATGTAGG - Intergenic
1025644284 7:63402511-63402533 ATCCACAATCACACCCATGTAGG + Intergenic
1025686954 7:63726316-63726338 ATCCACACTCTTTCCCCTCTGGG - Intergenic
1026081485 7:67225528-67225550 ACCCCCACACCCTCCCATCTTGG + Intronic
1026695591 7:72588481-72588503 ACCCCCACACCCTCCCATCTTGG - Intronic
1027976021 7:85156967-85156989 ATGCAAACACACTTCCATTTGGG - Intronic
1028984634 7:96999839-96999861 ACACACACACACACGCATCTAGG - Intergenic
1029078719 7:97955913-97955935 ATGCACACCCACTGCTATCTTGG - Intergenic
1029172367 7:98640112-98640134 ATTCAGACTCACTCCCAGCTGGG + Intergenic
1029843374 7:103388978-103389000 ATTCACACCCATTCCAATCTGGG + Intronic
1029946084 7:104534401-104534423 TTCTACCCACACTTCCATCTCGG + Intronic
1031904619 7:127447037-127447059 AGCCACACACACACCCTTCCGGG + Intergenic
1032360569 7:131251088-131251110 ACACACACACACACACATCTGGG - Intronic
1032747744 7:134805090-134805112 ATCCACAAACTGTCTCATCTGGG - Intronic
1032841243 7:135714943-135714965 ACTCACACACACTCTCACCTGGG - Intronic
1033167641 7:139054649-139054671 AGCCACACACAGTCTCATTTGGG - Intronic
1033760313 7:144430162-144430184 ATCCAAACACTCTCCTATTTTGG - Intergenic
1036393868 8:8349982-8350004 ATGCACACACACACACATTTCGG + Intronic
1037501816 8:19493890-19493912 ACACACACACACACACATCTAGG + Intronic
1037555669 8:20019807-20019829 ATGCACACACACGCACATCCTGG - Intergenic
1037897589 8:22668600-22668622 ATCAAAACCCACTCCCTTCTGGG - Intronic
1041956882 8:63566073-63566095 AGCCACACACTGTCCCATCAGGG - Intergenic
1043763615 8:84100944-84100966 ATATACACACACACCCCTCTGGG + Intergenic
1045337497 8:101221753-101221775 GTACACACACACACCCATCTTGG - Intergenic
1045648071 8:104318505-104318527 ATCCACAGACACTCCCCACTGGG + Intergenic
1046938756 8:119910934-119910956 ACACACACACACACCCCTCTAGG - Intronic
1047425731 8:124743996-124744018 ATACACACACACACACATATAGG - Intergenic
1049188046 8:141269527-141269549 ACCCACACACACACCCACATAGG - Intronic
1050988693 9:12117785-12117807 ATGCACACACACACCTCTCTGGG + Intergenic
1052121141 9:24717816-24717838 ATACACACACACACACATCATGG - Intergenic
1052594148 9:30537034-30537056 ACCCACACACAGTCCCTACTGGG + Intergenic
1052859361 9:33427357-33427379 GTCCACATCCACTCCAATCTGGG + Intergenic
1052961328 9:34299799-34299821 ACACACACACACACACATCTTGG - Intronic
1054141403 9:61534247-61534269 ATCCACACACACACAAATCACGG - Intergenic
1054461103 9:65464899-65464921 ATCCACACACACACAAATCACGG - Intergenic
1054907561 9:70424098-70424120 ATCCATACTCACTCCCTTCCTGG + Intergenic
1055666013 9:78553827-78553849 ACACACACACACACCCTTCTGGG - Intergenic
1056105362 9:83341785-83341807 AACAACACACACACCCATTTCGG + Intronic
1057771527 9:97972403-97972425 ATCCACAGCCACCCTCATCTGGG + Intergenic
1057776890 9:98018680-98018702 TTCCACACTCACTGCAATCTTGG - Intergenic
1058835955 9:108858856-108858878 ACACACACACACTCACATTTGGG + Intergenic
1062564771 9:137159277-137159299 CTCCACACACACTCCAGTCCTGG + Intronic
1203635413 Un_KI270750v1:106045-106067 ATCCCCACAGACTCCCCACTAGG - Intergenic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619870 X:1447270-1447292 TTCGACACACACTGCCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1186254972 X:7708546-7708568 ATGCACACACACACACATATAGG + Intergenic
1186269117 X:7865965-7865987 ATCTATACACAGTCCCATCCTGG - Intergenic
1188453102 X:30330127-30330149 ATCCACCCACCCCTCCATCTTGG - Intergenic
1189316363 X:40059522-40059544 ATCCCATCACCCTCCCATCTAGG - Intronic
1189630283 X:42945096-42945118 AACCACACATTCTCCCAGCTTGG - Intergenic
1190707631 X:53043841-53043863 CTCCAAACACACTACCCTCTGGG + Intergenic
1190708792 X:53050568-53050590 ATCCCTACACACACCCATCAGGG - Intronic
1191689794 X:63927878-63927900 CCCCACACACACTCCCCACTGGG + Intergenic
1192241902 X:69338448-69338470 ATCCACACATACACACATCGTGG - Intergenic
1192399684 X:70822554-70822576 ACACACACACACACCCATATCGG + Intronic
1193054916 X:77139645-77139667 ATTCACCTACACACCCATCTAGG - Intergenic
1193474798 X:81949911-81949933 ACACACACACACACACATCTTGG - Intergenic
1193532104 X:82668335-82668357 ATACACACAAACACACATCTTGG + Intergenic
1194199880 X:90941486-90941508 TCCCACACAGAGTCCCATCTGGG - Intergenic
1194200225 X:90945335-90945357 ACCCATACACACACACATCTTGG - Intergenic
1194505196 X:94725791-94725813 ATACACACACACACCCACCATGG + Intergenic
1198238946 X:134764314-134764336 AACCACACACTCTCACCTCTAGG - Intronic
1199228700 X:145409774-145409796 CTCCACACACAGTCCCCACTGGG + Intergenic
1199869028 X:151879784-151879806 ACACACACACACACACATCTTGG - Intergenic
1200008020 X:153100670-153100692 ATTCACCCACACTCCCCTCGTGG - Intergenic
1200545871 Y:4517902-4517924 TCCCACACAGAGTCCCATCTGGG - Intergenic
1202390820 Y:24368812-24368834 ACACACACACACTCACATCCTGG + Intergenic
1202479964 Y:25301304-25301326 ACACACACACACTCACATCCTGG - Intergenic