ID: 950081360

View in Genome Browser
Species Human (GRCh38)
Location 3:10224533-10224555
Sequence ATAATATTCTTGGTAGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950081360 Original CRISPR ATAATATTCTTGGTAGGTGC AGG (reversed) Intronic
903484416 1:23679014-23679036 ATAATATTTTTGGTATGGGTAGG - Intergenic
904080040 1:27866530-27866552 ATAATATTCATTGTATGGGCCGG + Intergenic
905076473 1:35276096-35276118 ATATGATTCTTGATATGTGCTGG - Intronic
905523533 1:38618666-38618688 ATAATTTTCTTGGTTTGGGCAGG + Intergenic
906503623 1:46360688-46360710 TTAACACTCTGGGTAGGTGCTGG + Exonic
907543358 1:55237181-55237203 AAAATATTCTAGGTCGGGGCTGG - Intergenic
907728119 1:57039389-57039411 ATTATTTGCTTGGTAGGTGAGGG + Intronic
908890985 1:68847645-68847667 GCAATATTCTTGGTAGGTAAGGG - Intergenic
909085293 1:71163220-71163242 ATAACATACTTAGTAGTTGCTGG + Intergenic
909277038 1:73699859-73699881 GTATTTTTCTTGGGAGGTGCTGG + Intergenic
910950913 1:92647417-92647439 ATGCTATGCTTGGAAGGTGCAGG - Intronic
911921799 1:103772538-103772560 AAAATATTCTTGATGGGGGCAGG + Intergenic
912365887 1:109133571-109133593 ATAATAATCTCGGTAGATACTGG - Intronic
913542154 1:119831954-119831976 ATATTATTCTGGGTGTGTGCTGG + Intergenic
918004061 1:180525208-180525230 ATTATTTCATTGGTAGGTGCTGG + Intergenic
920823610 1:209403874-209403896 ATAAAACTGTTGGTAGGAGCTGG + Intergenic
920901893 1:210116929-210116951 AAAAGATTCTTAGTAGGGGCAGG - Intronic
921110711 1:212034176-212034198 ATAATTTTCTTGGTTGATGGGGG + Intronic
924413408 1:243831507-243831529 AGAAAATTAGTGGTAGGTGCAGG + Intronic
1063749577 10:8927603-8927625 ATAATATTCTTGGGAAGTAAAGG - Intergenic
1064887923 10:20133472-20133494 ATAGTATTCTTGGTCATTGCTGG + Intronic
1071685328 10:87748983-87749005 ATGACATTTTTGGTAGTTGCTGG + Intergenic
1072927642 10:99630303-99630325 AAAATATTTTTGGTAGACGCGGG + Intergenic
1075537866 10:123286221-123286243 ATGATATTCTTGGTAGGACATGG - Intergenic
1078968953 11:16383462-16383484 ATTATATTATTGGTAAGTGGTGG - Intronic
1080496628 11:32827152-32827174 ATAATATTCTTGGTCGGGCACGG - Intergenic
1088525417 11:110748148-110748170 TTAATATTTTTTGTAGGTTCAGG + Intergenic
1091351745 11:134903369-134903391 CCAATATTCTAGGGAGGTGCTGG - Intergenic
1095556835 12:43516968-43516990 ATAATCATCTTGGTACATGCAGG + Intronic
1098517807 12:71398408-71398430 ATAATATTCTTGGAATCTTCTGG + Intronic
1100599710 12:96102818-96102840 TTTATATTTTTGGTAGGGGCAGG - Intergenic
1100870116 12:98901920-98901942 ATAATAAAATTGGTAAGTGCTGG - Intronic
1100987590 12:100218286-100218308 ATAATGTTCTTGGAAGTTTCAGG - Intronic
1101369164 12:104109121-104109143 ATAATCTTTTTGGTTGGAGCTGG - Intergenic
1105587436 13:21758030-21758052 ATAATATTCTAGGTTGGAGTGGG + Intergenic
1107968965 13:45622985-45623007 AACATATACCTGGTAGGTGCAGG - Intergenic
1108753624 13:53474064-53474086 ATAACATTCTTGGGAGACGCTGG - Intergenic
1112266954 13:97933004-97933026 ATGATATTTTGGGTATGTGCGGG - Intergenic
1118646396 14:67845369-67845391 ATGAAATTCTTGGTTGGGGCTGG + Intronic
1125364574 15:38900332-38900354 ATTATATCCTTTGGAGGTGCTGG + Intergenic
1125478763 15:40065646-40065668 ATCATATTCTAGGCTGGTGCAGG - Intergenic
1125670205 15:41466356-41466378 ATACTATTCTGGGTATGTGCTGG - Intronic
1126846352 15:52764293-52764315 ATAATATTGATGGTATTTGCAGG - Intronic
1129050849 15:72780622-72780644 TTTATATTCTTGGTAGGGACAGG - Intronic
1131939860 15:97549516-97549538 ATATTATTCTTGTTGGGTGCAGG + Intergenic
1133575228 16:7082407-7082429 TTGATATTTTTGGTAGATGCAGG - Intronic
1135848784 16:25943347-25943369 ATAATATCAGTGGTAAGTGCAGG + Intronic
1138227416 16:55309367-55309389 CTAATATTCATGGTGGATGCAGG - Intergenic
1138318472 16:56090600-56090622 AGAAGATTCTTGGTGGGGGCAGG - Intergenic
1139044077 16:63035060-63035082 ATAAAATTTTTGGTGGCTGCTGG + Intergenic
1144146817 17:12406799-12406821 CTAATCATCTTGGTAGGTGTTGG - Intergenic
1146040105 17:29444334-29444356 ACAATATTCTGAATAGGTGCAGG + Intronic
1149360316 17:55888530-55888552 ATAGGCTTCTTGGTAGGTGTGGG - Intergenic
1151597216 17:75085891-75085913 ATAATTTGGTGGGTAGGTGCTGG - Intergenic
1152267485 17:79304797-79304819 CTAAGATTCTCGGAAGGTGCTGG + Intronic
1153159121 18:2182642-2182664 AGAATACTCTGGGTAGGAGCCGG + Intergenic
1155486366 18:26347213-26347235 ATAATATTCTTGGCTGGGCCGGG - Intronic
1155651108 18:28143131-28143153 AAAATATTCATGGTAATTGCAGG + Intronic
1155676321 18:28433431-28433453 ATAATATTCATTGTTGGTGAGGG + Intergenic
1156062222 18:33093095-33093117 ATAATATTCTTTTTTGATGCAGG + Intronic
1156591267 18:38491335-38491357 ATATTTTTCTTATTAGGTGCTGG + Intergenic
1156697502 18:39784466-39784488 AGAATATTCTTGCAAGTTGCAGG - Intergenic
1156748241 18:40418633-40418655 ATATTATGCTTAGTATGTGCTGG - Intergenic
1159273544 18:66186574-66186596 ATAATTCTCATGGTAGGTGAAGG - Intergenic
1159793004 18:72807368-72807390 AAAATATTATTGATATGTGCTGG + Intronic
1160887794 19:1359713-1359735 AACGTATTCTTGGTTGGTGCAGG - Intronic
1164802917 19:31092550-31092572 ATAATATTCCTGGCAGGCTCAGG - Intergenic
1168618098 19:57854742-57854764 ATAATTTTATTTGTAGGCGCTGG + Intronic
925079481 2:1052101-1052123 ATAACCTTCTTGTTAGGTTCTGG + Intronic
927388556 2:22565273-22565295 ATGATATACTTAGTAAGTGCTGG - Intergenic
927499282 2:23571483-23571505 ATCATATTCTCGGCAGGGGCTGG - Intronic
928131075 2:28650482-28650504 CTAATATTTTTTGTGGGTGCAGG - Intergenic
929572717 2:43032786-43032808 ATATTATTCTTGGTAGCTCTGGG + Intergenic
932172216 2:69567351-69567373 ATTATATTCATGGTATGTCCTGG - Intronic
932531115 2:72533689-72533711 ATAATGTTCTTGGTAGTTTCTGG - Intronic
933210200 2:79558126-79558148 ATAACATTCTTAGTATGTTCAGG + Intronic
939646221 2:144702251-144702273 CTATAATTCTTGGTAGCTGCAGG - Intergenic
940386371 2:153078006-153078028 ATAATTTTCTTTGTAGGTTTTGG + Intergenic
940634553 2:156282891-156282913 ATAATTTTCTTGGTAGGCTGAGG - Intergenic
943152178 2:184128336-184128358 AAATTATTCTTGGTGGATGCAGG - Intergenic
943587740 2:189760425-189760447 AAAATACTCTTGGGAGGTGGGGG - Intronic
944688948 2:202141853-202141875 TTAATACTCTTTTTAGGTGCTGG - Intronic
947688512 2:232112904-232112926 AGAATATTCTTGGTATGAACAGG + Intronic
948295201 2:236855421-236855443 CTAATACTCATGGTATGTGCAGG - Intergenic
1168782636 20:506737-506759 ATAATAATCATGGCAGGTGTAGG + Intronic
1170041255 20:12041990-12042012 ATAATATCCTTTGTAGGAGCAGG - Intergenic
1174814440 20:53674647-53674669 TTTGTATTCTTGGTAGATGCGGG + Intergenic
1175004022 20:55663234-55663256 ATAATATTCTTAGAGCGTGCTGG - Intergenic
1179206229 21:39281861-39281883 ATATTTTTTTTGGTAGGTGAAGG - Intronic
950081360 3:10224533-10224555 ATAATATTCTTGGTAGGTGCAGG - Intronic
951218034 3:20041895-20041917 ATACTCTTCTTGGTACTTGCAGG + Intronic
951706920 3:25552781-25552803 AAAATAATCTTGGGAGGTGTGGG + Intronic
952202185 3:31142096-31142118 AAAATATTAGTGGTAGGTTCTGG - Intergenic
953988174 3:47461701-47461723 ATTATTTTGTTGGGAGGTGCTGG - Intronic
954418584 3:50406460-50406482 ATAATATTGATGGTGGGTGATGG - Intronic
957826856 3:85458280-85458302 ATAATATCCCTGTTATGTGCAGG - Intronic
958889473 3:99767489-99767511 TTAATATTCTTGGTAACAGCTGG + Intronic
959121097 3:102233206-102233228 ATTATATTCTTGATAAGTGTGGG + Intronic
960797315 3:121501254-121501276 ATAATATTCTTAGTTGAGGCTGG - Intronic
963342831 3:144057813-144057835 AAAATTTTCTTGGGAGGTTCAGG - Intergenic
964237332 3:154546942-154546964 ACAAACTTCTTGGTAGGTACTGG - Intergenic
972809038 4:42562570-42562592 ATAATATTTTTGTTAGATACTGG + Intronic
972910394 4:43809234-43809256 GTAATAATCTTGGGAGGTGCTGG + Intergenic
974826012 4:67132097-67132119 ATAATAAGCTGGGTAGCTGCAGG + Intergenic
976059868 4:81114692-81114714 ATTAAACTGTTGGTAGGTGCAGG - Intronic
976588507 4:86825571-86825593 ATTTTCTTTTTGGTAGGTGCAGG - Exonic
977741922 4:100494917-100494939 ATTAAAATCTTGGTAGGTGATGG - Intronic
980046560 4:127995889-127995911 AAAAAATTCTTTGTAGGTACTGG + Intronic
980719089 4:136669838-136669860 ATAATAATCTTGGTATTTACTGG - Intergenic
982034705 4:151334311-151334333 ATAAGATCCATGGTAGATGCAGG + Intergenic
984214100 4:176886933-176886955 AAAATTGTCTTGGTAGGAGCAGG - Intergenic
987380482 5:17280896-17280918 ATAATATTTTTGGTAGAGACAGG + Intergenic
988179086 5:27766550-27766572 CTGATATTCCTGGTAGGTGGGGG - Intergenic
989232426 5:39101697-39101719 AAAATATTTTTGGTTGGTTCTGG + Intergenic
989552446 5:42751673-42751695 ATAACATTGTTGGTGGGGGCAGG - Intergenic
992025746 5:72667171-72667193 GTAATGATCTTGGTAGGTGGTGG - Intergenic
993021804 5:82601062-82601084 CTAATATTCTAGGAAGGTGTGGG - Intergenic
994390562 5:99187706-99187728 ATAATTTTCTTGATAAGTGTTGG + Intergenic
998802731 5:145886680-145886702 ATAATATTATTGGAGAGTGCTGG - Intergenic
1001090220 5:168734523-168734545 GTAATATCATTGGTAGGTGTGGG - Intronic
1003737547 6:8893827-8893849 ATTATATGCATGTTAGGTGCTGG + Intergenic
1003910876 6:10742548-10742570 TTAAAATTCTTGGTGGGGGCCGG + Intergenic
1005064833 6:21807938-21807960 AGCATATTCTTGGAAGGTGTGGG + Intergenic
1008977491 6:57445128-57445150 GTATTATTTTTGGTAGGTTCAGG + Intronic
1009165627 6:60338079-60338101 GTATTATTTTTGGTAGGTTCAGG + Intergenic
1009929390 6:70158724-70158746 AAAATATTCTTGGTAGCAACTGG + Intronic
1012817694 6:104044765-104044787 ATAATCTTTTTGGTAGGGGCTGG + Intergenic
1016341091 6:143061764-143061786 ATGATAATCTTGACAGGTGCAGG + Intronic
1016416042 6:143834903-143834925 ATAATCTTGTTGGGAGGTGATGG + Intronic
1017518973 6:155185060-155185082 ATAATACTTTTGGTACTTGCGGG + Intronic
1026259512 7:68742109-68742131 ATAATACTGTTGGGAAGTGCTGG - Intergenic
1027842254 7:83327904-83327926 ATAAAATTCTTGGAAGGGGCTGG + Intergenic
1029914716 7:104197088-104197110 TTAATATTGTTGATAGGTTCTGG + Intronic
1031398192 7:121298909-121298931 AAAATCTTGTTTGTAGGTGCTGG - Intergenic
1032354616 7:131198818-131198840 ATAATATTATTTTTAGGTGACGG - Intronic
1036742469 8:11376720-11376742 ATAACATTCTTGGTATTTGCTGG - Intergenic
1038844271 8:31214241-31214263 ATAATATTTTTGGTAGATTAGGG + Intergenic
1038896714 8:31791441-31791463 AGAATATTCTTGATAGGAGGTGG - Intronic
1040759260 8:50818478-50818500 ATAATTTTCTTAGTAAGTGATGG - Intergenic
1041440555 8:57891655-57891677 CTAATTTTCTTGGGAGGTGGGGG + Intergenic
1044782982 8:95762656-95762678 ATAGAATTCTTGGCAGGTGATGG + Intergenic
1045926290 8:107581350-107581372 ATATTATTCTTGGTATCTGGGGG + Intergenic
1045927790 8:107591428-107591450 ATAATATTATTGGTGGGAGAGGG + Intergenic
1046850374 8:118965501-118965523 ACAAGATTCCTGGTAGGTTCTGG + Intergenic
1048262544 8:132957187-132957209 ACAATAATCTCTGTAGGTGCTGG + Intronic
1051868149 9:21705776-21705798 ATAATAGGCTTCGTAGATGCTGG + Intergenic
1054957672 9:70931978-70932000 CTAACATTCTTGGAAGGTACAGG + Intronic
1058604831 9:106709102-106709124 ACAATATACTTGGAATGTGCTGG - Intergenic
1190623331 X:52311078-52311100 ATAATTTACTTGGTAGCTGATGG - Intergenic
1192399902 X:70824647-70824669 ATGATCTTCTTGGTAGTTTCTGG - Intronic
1192566034 X:72164324-72164346 AAAATATTTTTAGTAGGGGCGGG - Intergenic
1194260396 X:91687182-91687204 ATAAAATTCTTGGTTGGGCCGGG - Intergenic
1194303309 X:92213150-92213172 ATAACATTATTTGTAAGTGCAGG + Intronic
1199913070 X:152308383-152308405 ATAACATTGTTGGGAGGTCCTGG - Intronic
1200579089 Y:4926239-4926261 ATAAAATTCTTGGTTGGGCCGGG - Intergenic
1201467165 Y:14295253-14295275 ATAATATTTTTGGTCTGTCCTGG - Intergenic