ID: 950085414

View in Genome Browser
Species Human (GRCh38)
Location 3:10254157-10254179
Sequence CTGTTGTTGCCAAGGACAAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950085406_950085414 23 Left 950085406 3:10254111-10254133 CCACTTGGCACATGTCTAGTGCA 0: 1
1: 0
2: 1
3: 8
4: 109
Right 950085414 3:10254157-10254179 CTGTTGTTGCCAAGGACAATCGG 0: 1
1: 0
2: 2
3: 9
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950085414 Original CRISPR CTGTTGTTGCCAAGGACAAT CGG Intronic
901078684 1:6571444-6571466 CAGTAGTTCCCAAGGAGAATGGG - Intronic
901238945 1:7681841-7681863 CTCTTCTGGCCAAGGACACTGGG + Intronic
902271574 1:15308778-15308800 CTGCTGTGGCCAAGAACAACGGG - Intronic
903541894 1:24101154-24101176 CTGTTCCTGCCAAGGACAGAGGG - Intronic
904925542 1:34044825-34044847 CTTTTATTCCCAAGGTCAATTGG - Intronic
905451676 1:38061053-38061075 TGGTTTTTGCCAAGGCCAATTGG + Intergenic
906300644 1:44678874-44678896 CGCTTGTTGCCAAGGACCTTTGG + Intronic
906836329 1:49086496-49086518 CAGTTGTTTCCTAGGACAACGGG - Intronic
908085464 1:60627822-60627844 CAGTAGTTGCCAAAGACAAAGGG - Intergenic
908450193 1:64247019-64247041 GTGTTGTTTCCAAAGACAAGTGG - Intronic
913566536 1:120078357-120078379 CTTTTATTGCCAATCACAATTGG + Intergenic
913631595 1:120715187-120715209 CTTTTATTGCCAATCACAATTGG - Intergenic
914287294 1:146239069-146239091 CTTTTATTGCCAATCACAATTGG + Intergenic
914548326 1:148689811-148689833 CTTTTATTGCCAATCACAATTGG + Intergenic
914618355 1:149381897-149381919 CTTTTATTGCCAATCACAATTGG - Intergenic
919588283 1:199466276-199466298 CAGTTTTTTCCAAGAACAATAGG + Intergenic
921493601 1:215809243-215809265 CTGTTGTTGCCCTGTACCATGGG - Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
924878239 1:248128962-248128984 CTGCTGGTGCTAAGGAGAATGGG + Intergenic
1064518055 10:16171349-16171371 CAGTTCATGCCAAGGACTATTGG + Intergenic
1067961547 10:50857736-50857758 TTGTTGTTGGCAAGGAGAAGTGG + Intronic
1072917519 10:99548222-99548244 CTGATGTTGCCAGGGACCAGAGG + Intergenic
1075279124 10:121123650-121123672 CTGTTGTTGAGTAGGTCAATTGG - Intergenic
1078131179 11:8615399-8615421 ATGATGTTGTCAAGGACAAAAGG + Exonic
1079887145 11:26003114-26003136 CTGAGGTTGCCAAGTTCAATAGG - Intergenic
1082829613 11:57606066-57606088 CTGTTGTTGCTTAGGACTCTGGG - Exonic
1085514941 11:77106432-77106454 CTGTGGTTTCCAGGGAAAATGGG - Intronic
1085932832 11:81105634-81105656 CTGTTATAATCAAGGACAATTGG + Intergenic
1086572025 11:88296056-88296078 CTGTTGTTGGCAAAGGCAAAAGG - Intronic
1092624427 12:10311474-10311496 CTGTTCTTGCCAAGAAAAATGGG + Intergenic
1093348551 12:18069780-18069802 CTGAGGTTGCCAAGTTCAATAGG - Intergenic
1096031859 12:48424894-48424916 CTGTGGTTGCCAAGGGCCAAGGG + Intergenic
1098715656 12:73826317-73826339 CAGTTTATGCCAAGGACTATTGG - Intergenic
1104598296 12:130134641-130134663 CTCTTGGTGCCAAGGCCGATGGG + Intergenic
1106798589 13:33232930-33232952 GTGTTGCAGCCAAGGAGAATGGG - Intronic
1106868512 13:33993812-33993834 CTGTTCTTGGATAGGACAATAGG + Intergenic
1107052474 13:36066343-36066365 GTGTTGTGGCCAAGGACCAATGG - Intronic
1108876671 13:55057497-55057519 CTGAGGTTGCCAAGTTCAATAGG - Intergenic
1109934650 13:69265156-69265178 CAGGTGTTCCCCAGGACAATAGG + Intergenic
1110241027 13:73266978-73267000 CTATTGTAGCCAAGGACCAAAGG - Intergenic
1110375070 13:74783956-74783978 CTTTTGATGCTAAGGAAAATGGG + Intergenic
1111851173 13:93577003-93577025 CTTTTGGTGCCAGGCACAATGGG + Intronic
1112695234 13:101940410-101940432 CTGTTCTTTCCAAGGTGAATGGG + Intronic
1115142287 14:30186062-30186084 CAGTTCTTTCTAAGGACAATGGG + Intronic
1115916976 14:38326220-38326242 AAGTTGTTGCCAGGGACACTGGG - Intergenic
1117366120 14:55029482-55029504 TTTTTGCTCCCAAGGACAATTGG + Intronic
1117630346 14:57684347-57684369 CTGTTTTTTCCAAGGACAATGGG + Intronic
1119698100 14:76730116-76730138 GTGCTGTGGCCAAGGAGAATGGG + Intergenic
1122247702 14:100415910-100415932 CTCTGGTTGCCAAGCACGATTGG + Intronic
1124154393 15:27212735-27212757 CAGTTGTTGCCAAGGTCAGGGGG - Intronic
1125258577 15:37796306-37796328 CCTTTGTTTCAAAGGACAATTGG - Intergenic
1129624790 15:77185546-77185568 CTCATGTTGCCAAGTCCAATGGG - Intronic
1131472139 15:92706702-92706724 CTGTGGTTTGCAAGGACAAGTGG + Intronic
1132330859 15:101011731-101011753 CCATTATTTCCAAGGACAATGGG + Intronic
1132387741 15:101412161-101412183 CTGTTGCTGCAGAGGACAAGGGG - Intronic
1132954802 16:2585924-2585946 CTGTGGAGGCCAAGGACAAGGGG - Intronic
1133726419 16:8541913-8541935 CTGTTCTTTCCAAGAACAAAGGG + Intergenic
1134557497 16:15178072-15178094 CAGTGGTTGCCAGGGACTATGGG + Intergenic
1134918065 16:18089751-18089773 CAGTGGTTGCCAGGGACTATGGG + Intergenic
1135224726 16:20646045-20646067 CTGAGGTTGCCAAGTTCAATAGG - Intronic
1135971938 16:27078700-27078722 CTGCTGTTGCCAGGGGGAATGGG - Intergenic
1137364326 16:47847697-47847719 CTGATGTTCCCAATGACATTTGG + Intergenic
1145932691 17:28697401-28697423 CTGTTGTTCCCAAGCACTAGGGG + Intronic
1147481130 17:40764360-40764382 CTATTCTTTCCAAGAACAATTGG - Intergenic
1150826723 17:68482738-68482760 CTGTTTTTACTAAGGTCAATCGG + Intergenic
1153136853 18:1927258-1927280 ATGTTAATGCCAAAGACAATGGG + Intergenic
1155988173 18:32252705-32252727 ATGTTATTCCCAAAGACAATGGG - Intronic
1158346090 18:56518514-56518536 CTTTTGTTGCAAAGGAGACTTGG + Intergenic
1163201811 19:15775087-15775109 CAGCTGTGGCCAAGGACACTTGG - Intergenic
1163437175 19:17302791-17302813 CTGTGGTTGCCATGGACACGGGG - Intronic
1164057346 19:21632969-21632991 CTGAGGTTGCCAAGTTCAATAGG - Intergenic
1164323148 19:24168493-24168515 CTGAGGTTGCCAAGTTCAATAGG + Intergenic
1168722346 19:58561104-58561126 CTGCTGTTGCCAAGGGGAAGAGG - Intergenic
926502510 2:13673521-13673543 CTGTTATTCCCCAAGACAATGGG - Intergenic
927612882 2:24559576-24559598 CAGTTGATGCCCAGGACAAATGG - Intronic
935427121 2:102931767-102931789 CTCTTGTTAGCAAGGACCATGGG - Intergenic
939190814 2:138914647-138914669 CTTTTGATGCCAAGGGCAACAGG - Intergenic
945043063 2:205758614-205758636 CTGTTGTTGCCAATGATACAGGG - Intronic
946108308 2:217391266-217391288 ATGTTATTCCCAAAGACAATAGG - Intronic
947047089 2:225999930-225999952 GTGTTGATGCAAAGGACAATAGG - Intergenic
947202999 2:227632691-227632713 CAGTTGTTGCCAGGGACGAGGGG + Intronic
947761771 2:232608574-232608596 CTCTTTTTCCCAAGTACAATTGG - Intronic
1169310929 20:4539208-4539230 TTGTGGTTGCCAAGGACTGTGGG + Intergenic
1170135591 20:13070341-13070363 CTGTTGTCACCAAGGACCAAAGG + Intronic
1170181646 20:13537632-13537654 ATGTTTTAGTCAAGGACAATAGG - Intronic
1170565456 20:17599686-17599708 CTGTAGTTGTCAAAGACATTGGG + Intronic
1173983595 20:47243864-47243886 CTGTTGTTGCAGAGAACAATAGG - Intronic
1177469121 21:21533293-21533315 CTGTAGTTGCCAGGGACTAGAGG - Intronic
1179640994 21:42747182-42747204 CTGCTGTTGACAAAGACAAAAGG - Intronic
1184844231 22:47071310-47071332 CTGCTGTGGCCAAGGAAAAGAGG + Intronic
950085414 3:10254157-10254179 CTGTTGTTGCCAAGGACAATCGG + Intronic
951360106 3:21714946-21714968 CTGTTCTTGCCAAGGGCATCGGG - Intronic
953071522 3:39525534-39525556 CTGGTGTGGCCAAGCACAGTCGG + Intronic
953615661 3:44488556-44488578 CAGTTGTTGACATGGACAGTGGG + Intergenic
954008425 3:47612643-47612665 ATGTTGTAGGCAAGGAAAATTGG - Intronic
955046590 3:55366834-55366856 CTGATGTTCTCAAGGACACTGGG + Intergenic
955291338 3:57695013-57695035 CAGTTGTGGCCAAGCACAGTGGG + Intergenic
956336868 3:68174814-68174836 ATGTTATTGCCTAAGACAATGGG + Intronic
961717779 3:128870495-128870517 CTGCTGTTGCCAGGGATACTTGG - Intergenic
963470515 3:145735899-145735921 ATGTTATTCCCAAGAACAATTGG + Intergenic
964430687 3:156603449-156603471 CTTTGGTTGCCAAGTACAAGAGG + Intergenic
966245666 3:177805128-177805150 CTGTGGTTGCCTAGGACAATAGG + Intergenic
966624883 3:182005233-182005255 CTGTTGTCTCCTAAGACAATTGG + Intergenic
968528732 4:1078671-1078693 CTGTTGGTGTCAAGGAGAAAGGG - Intronic
970363814 4:15337775-15337797 CTGAGGTGGCCAAGGAGAATGGG - Intergenic
972781351 4:42289352-42289374 CTGAGGTTGCCAAGTTCAATAGG + Intergenic
975313819 4:72930109-72930131 CTGAGGTTGCCAAGTTCAATAGG + Intergenic
975673101 4:76801696-76801718 CTGTTGTCAGCAAGGACAGTCGG - Intergenic
976360679 4:84174517-84174539 GTGTTGTTGCTAAGGTCAAATGG + Intergenic
976498274 4:85755956-85755978 CTGATGTTACCAATCACAATTGG - Intronic
977930782 4:102746636-102746658 CAGTTCATGCCAAGGACTATGGG + Intronic
978342242 4:107730741-107730763 CAGTTTCTGCCAAGGACTATCGG + Intergenic
978909555 4:114048236-114048258 CTGAGGTTGCCAAGTTCAATAGG - Intergenic
979302758 4:119106492-119106514 CAGTTGTCACCAAGGACAACTGG + Intergenic
979776565 4:124596007-124596029 CAGTTGTTGCCAGGGACTGTGGG + Intergenic
982807333 4:159782688-159782710 CTGTGGTTGCCAGGGACTAAGGG - Intergenic
982948954 4:161664165-161664187 ATGTTTTTCCCAAAGACAATTGG - Intronic
983036692 4:162875462-162875484 CTTTCCTTGCCAAGGAGAATGGG + Intergenic
984723746 4:183000815-183000837 CTGAGGTTGCCAAGTTCAATAGG - Intergenic
984983854 4:185308428-185308450 CTGCTGTTGCCAAGATCACTAGG - Intronic
985966562 5:3342653-3342675 CTGGTGTGGCCCAGGACAAGAGG - Intergenic
986038221 5:3961089-3961111 CTGTTGTTTCCACGGATACTTGG - Intergenic
986442104 5:7791830-7791852 CTGTTATCTCCAAGGACACTGGG + Intronic
986625831 5:9723215-9723237 CTGTTGTTGCCATGAAGACTGGG + Intergenic
988211478 5:28210178-28210200 CTGTTGTTATGAAGGACAACGGG - Intergenic
991009832 5:61871307-61871329 TTTTTTTTGCCATGGACAATGGG - Intergenic
992471396 5:77058996-77059018 CTATTGTTGCCAGGGTAAATGGG + Intronic
993398436 5:87419547-87419569 ATTTTGTTGACTAGGACAATGGG - Intergenic
997373573 5:133381068-133381090 CTGTTGTTTCCAAGGAAAGCTGG + Intronic
1001088959 5:168722987-168723009 CTGTTGTTGCTCAGGTCACTAGG + Exonic
1001293491 5:170483041-170483063 CTTTTGTTTCCAAGGACAGATGG + Intronic
1002781376 6:369444-369466 CTCTTCTTTCTAAGGACAATAGG - Intergenic
1004456952 6:15800135-15800157 CTTATGTTGACAAGGACAAGAGG - Intergenic
1011189780 6:84716814-84716836 CTGAGGTTGCCAAGTTCAATAGG + Intronic
1013022237 6:106231767-106231789 CTGAGGTTGCCAAGTTCAATAGG - Intronic
1014265342 6:119270532-119270554 CAGTGGTTGCCTAGGACAAGAGG - Intronic
1016305915 6:142683216-142683238 CTGTTTCTGCCAATGTCAATTGG + Intergenic
1016809553 6:148246540-148246562 CTTTTGGTGCCAAGTACAAAAGG + Intergenic
1017224297 6:152002139-152002161 CTGTTGTTGCCAAGAACCCAGGG - Intronic
1018599464 6:165524398-165524420 CAGTTTATGCCAAGGACTATTGG - Intronic
1023439300 7:40169802-40169824 CTGAGGTTGCCAAGTTCAATAGG + Intronic
1027170154 7:75866259-75866281 ATGCTGTTTCCAAGGACAGTGGG - Intronic
1027471546 7:78580341-78580363 CAGTTCTTGAAAAGGACAATAGG + Intronic
1030864948 7:114689833-114689855 CTGTTGTCACTAAGGACATTGGG - Exonic
1032426094 7:131823182-131823204 CTGAGGTTGCCAAGTTCAATAGG + Intergenic
1033531844 7:142272056-142272078 CTGTTCTTGGCAAGGACACTTGG - Intergenic
1037491434 8:19400322-19400344 CTGTTGCTGCCAAAAACTATGGG - Intergenic
1038861287 8:31391671-31391693 CTGCTGGTGTCAAGGACAACAGG + Intergenic
1039918722 8:41878140-41878162 TTATTGTTGCCAATGACATTTGG - Intronic
1041244439 8:55877189-55877211 CTGTTGTTGCTAAGCACCAGAGG - Intergenic
1042431416 8:68710696-68710718 CTGTGGTAGCCAAAGACAAAGGG + Intronic
1043064314 8:75547601-75547623 GTGTTGTTGACAAGGACAAAAGG + Exonic
1047225315 8:122951629-122951651 CTGACGTGGCCAAGGACAGTTGG + Exonic
1047443881 8:124902506-124902528 CTGAGGTTGCCAAGTTCAATAGG + Intergenic
1048437712 8:134433403-134433425 CTGTTGTTTCCCATGACAACTGG - Intergenic
1052528993 9:29657172-29657194 CTGATGTTGCCAAGTTCAATAGG + Intergenic
1053505519 9:38640197-38640219 CTGTTGTTTTCAATGGCAATCGG + Intergenic
1056182788 9:84102093-84102115 CAGTGGTTCCCAGGGACAATGGG - Intergenic
1056508927 9:87284304-87284326 CTCTTGTTACCCAGGACAGTAGG - Intergenic
1057291141 9:93808261-93808283 CTGCTGTTGCCAAGGCCACTTGG + Intergenic
1058530374 9:105900256-105900278 CTGCTGGTGCCAAGGAAACTGGG - Intergenic
1059035938 9:110753503-110753525 CTGTTGGTGCCATTGAGAATGGG - Intronic
1186254250 X:7701942-7701964 CTGAGGTTGCCAAGTTCAATAGG + Intergenic
1187079042 X:15966704-15966726 CCATTTTTGCCAAAGACAATCGG + Intergenic
1188748273 X:33873620-33873642 ATGTTATTGCCAAAGACAATGGG - Intergenic
1188935264 X:36167698-36167720 CTGTTTTTGCCAAGAACATAGGG - Intergenic
1191043805 X:56114197-56114219 CTGTGGGTGCCAAGGAGACTGGG - Intergenic
1192939974 X:75901842-75901864 CTGAGGTTGCCAAGTTCAATAGG + Intergenic
1193258354 X:79376920-79376942 CTCTTGCTGCCAAGAACTATAGG - Intergenic
1193698729 X:84739347-84739369 CTGTTGATGACAAGGACGGTGGG - Intergenic
1194223122 X:91222059-91222081 CTGTAGTTGCCAAAGATTATGGG + Intergenic
1199106524 X:143875518-143875540 ATGTTAATCCCAAGGACAATGGG + Intergenic
1199713344 X:150488089-150488111 CTGTAGATGCCAGGGACACTGGG - Intronic
1200306447 X:155030717-155030739 CTCTTGTTGCCCAGGAAAATGGG + Intronic
1200559604 Y:4685478-4685500 CTGTAGTTGCCAAAGATTATGGG + Intergenic
1201311046 Y:12598409-12598431 CTGCTGGTGGCAAGGACAGTGGG + Intergenic
1201943497 Y:19484268-19484290 TGGGTGATGCCAAGGACAATGGG + Intergenic