ID: 950091859

View in Genome Browser
Species Human (GRCh38)
Location 3:10301363-10301385
Sequence CTGACTCGCAGGTGACCCTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950091859_950091862 -1 Left 950091859 3:10301363-10301385 CCACAGGGTCACCTGCGAGTCAG 0: 1
1: 0
2: 1
3: 10
4: 140
Right 950091862 3:10301385-10301407 GTGCACAAGCAGATTATCACGGG 0: 1
1: 0
2: 0
3: 8
4: 93
950091859_950091861 -2 Left 950091859 3:10301363-10301385 CCACAGGGTCACCTGCGAGTCAG 0: 1
1: 0
2: 1
3: 10
4: 140
Right 950091861 3:10301384-10301406 AGTGCACAAGCAGATTATCACGG 0: 1
1: 0
2: 1
3: 7
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950091859 Original CRISPR CTGACTCGCAGGTGACCCTG TGG (reversed) Exonic
900144176 1:1150781-1150803 CGGACTCCCTGGGGACCCTGGGG + Intergenic
900703517 1:4062172-4062194 CTGACTAGGAAGAGACCCTGGGG + Intergenic
901702533 1:11053325-11053347 CTGAGATGCAGGAGACCCTGGGG + Intergenic
903982712 1:27201431-27201453 CCGCCTCGAAGGTGACCCGGCGG + Intergenic
906483828 1:46219693-46219715 ATGGCTCGCAGGTAAGCCTGGGG - Exonic
915098183 1:153478880-153478902 CTGACTCCCAAATGTCCCTGAGG + Intergenic
917655678 1:177123094-177123116 CTGACTAGCACCTGACCCTGTGG - Intronic
1067824803 10:49563058-49563080 CTGACTCACAGTGGGCCCTGTGG - Intergenic
1069595005 10:69664793-69664815 CTGAGTGGCAGGTGACCCTCTGG + Intergenic
1071058911 10:81547370-81547392 CTGAGTCACAGCTGACCCCGAGG - Intergenic
1074467074 10:113692697-113692719 CTACCTCACAGGTGACCTTGTGG - Intronic
1076741680 10:132488773-132488795 CTGCCTCGCACTTGACACTGGGG - Intergenic
1077246825 11:1543801-1543823 ATGGCCTGCAGGTGACCCTGGGG - Intergenic
1078103862 11:8346287-8346309 GTGAGCCCCAGGTGACCCTGCGG + Intergenic
1078957215 11:16213011-16213033 GTGACTCTCAGGAGACCTTGAGG + Intronic
1079353567 11:19713094-19713116 CTGCGTCGCGGGTGACACTGCGG + Intronic
1080653679 11:34242216-34242238 CTGACTCAGGGGTGACCCAGAGG - Intronic
1080795266 11:35557459-35557481 GTGAGTCCCAGGTGAACCTGGGG + Intergenic
1083421187 11:62554221-62554243 CTGACTCACAGGGGACCCAAGGG - Intronic
1083897373 11:65626791-65626813 CTGACTCCTCGGAGACCCTGGGG - Intronic
1083923896 11:65794527-65794549 CTCACCCACAGGTGACCCTTGGG + Exonic
1084589812 11:70084134-70084156 CTGAGTCCCAGGTGCGCCTGAGG - Intronic
1085672064 11:78476315-78476337 CTGTCTCACAGGGAACCCTGGGG - Intronic
1087009757 11:93502012-93502034 CAGGCTAGCAGGTGACCCAGGGG + Intronic
1087208686 11:95423722-95423744 CTGACTGGTAAGTGACACTGTGG + Intergenic
1088612700 11:111593228-111593250 CTTACTAGCTGGTGACCTTGGGG - Intergenic
1088921940 11:114265895-114265917 CTGACTCGCAGATGACCCCAAGG - Intronic
1089783447 11:120891174-120891196 ATGACACCCAGGTGAGCCTGTGG + Intronic
1090124941 11:124075669-124075691 CTGGCCTGCAGGTGCCCCTGGGG - Intergenic
1090595125 11:128312565-128312587 GTGACTCTCAGGTGAACTTGAGG - Intergenic
1091334830 11:134758539-134758561 CTGACTCCCAGGGGACCCTCCGG - Intergenic
1092769635 12:11884923-11884945 CTGACTCACAGGGGACCTTTGGG + Intronic
1093599420 12:21003074-21003096 GTGCCTCACAGGGGACCCTGTGG - Intergenic
1096181051 12:49550531-49550553 CGATCTCGCAGGTGTCCCTGGGG + Intronic
1103588658 12:121974766-121974788 CTGACTGGCATGGGTCCCTGTGG + Intronic
1104923046 12:132301045-132301067 CTGGCTCGGAGGGAACCCTGGGG - Intronic
1106593984 13:31121460-31121482 CTGACACGCAGGCGACCTCGTGG - Intergenic
1106686694 13:32067750-32067772 GTGGCTCTCAGGTGACCTTGGGG - Intronic
1113710194 13:112458004-112458026 CTGGCTTGGAGGTGTCCCTGGGG - Intergenic
1114212851 14:20630761-20630783 CTGGCTCGCAGATTACTCTGAGG - Intergenic
1114799155 14:25752724-25752746 CTGACTCCCAGGTGAGACAGAGG - Intergenic
1115387850 14:32818737-32818759 CTGACTTGCAGGTGCCACTTGGG + Intronic
1121561242 14:94877607-94877629 CTGCCTTACAGGTGAGCCTGGGG - Intergenic
1122203406 14:100136184-100136206 GTGACACGCAGGTCACCCTGGGG - Intronic
1123999232 15:25740916-25740938 CTGCCACGCAGGGAACCCTGAGG + Intronic
1125831301 15:42718746-42718768 ATGACAGACAGGTGACCCTGGGG - Exonic
1126999274 15:54482529-54482551 CTGACTCTGAGCTGATCCTGAGG + Intronic
1129241030 15:74252345-74252367 ATGACTCACAGGTGACCCATGGG + Intronic
1130443632 15:83978729-83978751 TTGACTGGCAGGTGTGCCTGGGG - Intronic
1134056210 16:11171246-11171268 CTGACTCCCTGGTCACCCAGAGG + Intronic
1136024675 16:27461947-27461969 CTGACTCCCATGTGTGCCTGGGG - Intronic
1136067505 16:27768796-27768818 CTGGCTCTCATGTGCCCCTGGGG - Intronic
1137444879 16:48525635-48525657 GAGACTCCCAGGTTACCCTGAGG + Intergenic
1139752024 16:69114732-69114754 CTGACTCGTAGGTCATCCAGAGG - Exonic
1141662623 16:85449486-85449508 TGGATTCTCAGGTGACCCTGTGG - Intergenic
1141795662 16:86271966-86271988 CTGACTCCCCGCTGACCCTGGGG - Intergenic
1141971286 16:87484913-87484935 CTGACCTACAAGTGACCCTGAGG + Intronic
1142150131 16:88509022-88509044 CTGCCTCCCGTGTGACCCTGGGG + Intronic
1149006696 17:51813522-51813544 CTCACTCTCAGGTGACCCTAAGG + Intronic
1152279799 17:79378675-79378697 CTGGCTCCCAGGTGAGGCTGGGG - Intronic
1153331584 18:3880014-3880036 CCGAGTCGCAGGTGACCCCGTGG + Exonic
1160685744 19:435918-435940 CTGACTCCCCGGTGTGCCTGAGG - Intronic
1162164456 19:8743042-8743064 CTGAGTCGCAGGGCTCCCTGTGG + Intergenic
1162165528 19:8750510-8750532 CTGAGTCGCAGGGCTCCCTGTGG + Intergenic
1162166593 19:8757966-8757988 CTGAGTCGCAGGGCTCCCTGTGG + Intergenic
1162167659 19:8765422-8765444 CTGAGTCGCAGGGCTCCCTGTGG + Intergenic
1162168598 19:8771720-8771742 CTGAGTCGCAGGGCTCCCTGTGG + Intergenic
1162170344 19:8784484-8784506 CTGAGTCGCAGGGCTCCCTGTGG + Intergenic
1166258792 19:41623961-41623983 CTGAGTCTCATCTGACCCTGGGG - Intronic
1166330107 19:42073119-42073141 CTGGCAGGCAGGTGAGCCTGGGG + Intronic
1166728466 19:45043648-45043670 CTGTCTCACAGGTGACTGTGGGG - Intronic
1167300116 19:48673150-48673172 CTGGCTGGCAGGGGTCCCTGTGG - Intergenic
1168129441 19:54308164-54308186 CTGACTTTCAGGAGCCCCTGAGG - Intronic
932490390 2:72116291-72116313 CTGGCCTGCAGGTGGCCCTGGGG - Intergenic
934847625 2:97672408-97672430 CTGCCTGGCAGGTGACCAGGAGG + Intergenic
934849389 2:97687824-97687846 CTGCCTGGCAGGTGACCAGGAGG + Intergenic
941357818 2:164514577-164514599 CTGTCTCACAGGGGTCCCTGGGG + Intronic
941703752 2:168635263-168635285 CTGACCAGCTGGTGTCCCTGAGG + Intronic
945576355 2:211534841-211534863 CTGACTGCCAAATGACCCTGTGG + Intronic
946715194 2:222546935-222546957 CAAACTCCCAGGTGACACTGAGG - Intronic
947547057 2:231017557-231017579 CTGACTCACAGGTGGCCCCTAGG - Intronic
947856267 2:233326655-233326677 CTGAACAGCAGGTGACCATGGGG + Intronic
1170092000 20:12599518-12599540 CTAACTAGCAGGTGATGCTGAGG - Intergenic
1171384989 20:24764008-24764030 TTGACTTCCAGATGACCCTGAGG + Intergenic
1172970735 20:38871372-38871394 CTGGCCCAGAGGTGACCCTGAGG - Intronic
1174207033 20:48847782-48847804 CTGACTGGAAGGGGACCCGGGGG - Intergenic
1175673859 20:60930674-60930696 CTGACTCGCAGTGGGACCTGTGG - Intergenic
1176051434 20:63121534-63121556 CTGACTCTTAAGTGACCCTGAGG - Intergenic
1176167711 20:63682705-63682727 CTGAGTCACAGGTGACCCTGGGG + Intronic
1183588559 22:38767178-38767200 CTGTCTGGAAGGTGTCCCTGGGG - Intronic
1184188161 22:42878161-42878183 CTGCCTCAGAGGAGACCCTGGGG - Intronic
1184858722 22:47161063-47161085 CTGCCTCCCAGCTGGCCCTGGGG + Intronic
1185332126 22:50256569-50256591 CTGCCTGGCAGGGGGCCCTGAGG - Intronic
950091859 3:10301363-10301385 CTGACTCGCAGGTGACCCTGTGG - Exonic
952533877 3:34290081-34290103 AGGACTCCCAGGTGAGCCTGGGG - Intergenic
954865236 3:53723387-53723409 GTGTCTTGCAGGAGACCCTGAGG + Intronic
955532231 3:59886238-59886260 CTCATTCCCAGGTGAGCCTGAGG + Intronic
958737185 3:98023121-98023143 CTAACTCCCAGGTGATTCTGCGG + Intronic
961171394 3:124800208-124800230 CTGACCCGCAGATGCCTCTGTGG - Intronic
962953719 3:140244965-140244987 CTAACATGCAGGTGCCCCTGTGG + Intronic
966355275 3:179072408-179072430 CTGTCTTGCAGGTGAGCCTCTGG - Intergenic
969464195 4:7344977-7344999 TTGACTCGCAGATGACCCCTGGG + Intronic
969641603 4:8402123-8402145 CTGACTCCCAGGACAGCCTGAGG + Intronic
971761298 4:30769346-30769368 CTGACTTGCAGGAAACCATGCGG - Intronic
972673367 4:41235304-41235326 CTCACCTGCAGCTGACCCTGAGG - Intergenic
978829727 4:113069691-113069713 ATGACTCACATGTGCCCCTGAGG - Intronic
985488167 5:163354-163376 CTGGCTGGCAGGAGTCCCTGGGG - Exonic
985547184 5:515622-515644 CTGAGGAGCAGGGGACCCTGTGG - Intronic
987856079 5:23422553-23422575 CTGTCTCACAGGTGATCCTTTGG - Intergenic
992962752 5:81972178-81972200 CTGCCGCGCCGGTGACCCTACGG - Exonic
993927830 5:93893143-93893165 CTGATTTGCAGGTGTTCCTGGGG + Intronic
995893229 5:116981118-116981140 CTGACTCCCAAGTGTCCCAGAGG + Intergenic
997720414 5:136074071-136074093 CTTACTCCCAGAAGACCCTGTGG - Intergenic
999148307 5:149410255-149410277 CTGATTCCCAGCTGAGCCTGAGG + Intergenic
1001036064 5:168297174-168297196 CTGACATGCAGGGGACACTGAGG + Intronic
1002351919 5:178589671-178589693 CTGCCTGGCACGGGACCCTGAGG + Intronic
1002536734 5:179880010-179880032 CTGACTCGCTGGTGAGAGTGGGG - Intronic
1003666131 6:8113029-8113051 CTGACAGGCAGGTGAAACTGGGG + Intergenic
1005343489 6:24865726-24865748 ATGACTCCCAGGTGACTTTGTGG + Intronic
1006447250 6:34086607-34086629 CAAACTCTCAGGTGACCCCGTGG + Intronic
1006457782 6:34141886-34141908 CTGCCTCCCAGATGAACCTGAGG - Intronic
1006627420 6:35407114-35407136 CTGAGCCTCTGGTGACCCTGGGG - Intronic
1008977664 6:57446758-57446780 CTGACTCGCAACTCACCTTGAGG - Intronic
1009165803 6:60339705-60339727 CTGACTCGCAACTCACCTTGAGG - Intergenic
1010183331 6:73113757-73113779 CTCCCTCACAGGTAACCCTGTGG + Intronic
1010824494 6:80455893-80455915 CTGAGTCCCAGCTGCCCCTGAGG - Intergenic
1012211306 6:96521845-96521867 CTGACTCGCAGTAGACGCGGAGG - Exonic
1015631269 6:135234211-135234233 TTGACTCTCAGCTGATCCTGTGG - Intergenic
1016498470 6:144690632-144690654 CTGTCTCACAGGAGACCTTGTGG - Intronic
1021184133 7:17543056-17543078 CTGACTTGCAGGAGATCCTTGGG + Intergenic
1022532228 7:31074202-31074224 CTGAGTCACAAGTGAGCCTGCGG + Intronic
1022567760 7:31420705-31420727 CTGACTAGATGGTGGCCCTGAGG - Intergenic
1024481469 7:49867688-49867710 CTGACTGACAGGTGAGCCTTGGG - Intronic
1026473018 7:70710279-70710301 CTGCCTGGCAGTTGCCCCTGGGG - Intronic
1032017849 7:128391292-128391314 CTGAGTCAGAGGTGACCCAGCGG - Intergenic
1032578573 7:133081895-133081917 CCGCCTCGAAGGTGACCCGGCGG + Exonic
1035343702 7:158183539-158183561 CTGCCTCACAGGGGACCTTGCGG - Intronic
1036207103 8:6813604-6813626 CTGACTCCCAGCCGACCCTTGGG - Intronic
1036380908 8:8235939-8235961 TTCACTCACAGGTGACCTTGGGG + Intergenic
1036750852 8:11443098-11443120 CTGACTCGCAGGTGTCACCTGGG + Intronic
1040479148 8:47807942-47807964 CTGACCCTCAGGTGATCCTTGGG + Intronic
1045542903 8:103103355-103103377 CAGACCACCAGGTGACCCTGGGG - Intergenic
1052102243 9:24462665-24462687 TTAACTGGCAGGTGACCGTGTGG + Intergenic
1057037448 9:91821580-91821602 GTGACTCACAGGTGAGCATGTGG - Intronic
1057206949 9:93179155-93179177 CCGGCTCCCAGGTGGCCCTGAGG - Intergenic
1057941849 9:99292004-99292026 CTGCCTCTCAGGGGACCATGAGG - Intergenic
1061304427 9:129724261-129724283 CTGACCAGCAGGAGAGCCTGGGG + Intergenic
1061755157 9:132807202-132807224 CTAACTGGCAGCTGCCCCTGTGG - Intronic
1062617602 9:137405050-137405072 CTGTCTCACAGGTGAGCCAGGGG + Intronic
1199846220 X:151694733-151694755 CTGAATGGCAGGTGAGCCCGGGG + Intergenic
1200102516 X:153695024-153695046 GGGACGAGCAGGTGACCCTGGGG + Intronic
1200236322 X:154469506-154469528 CTGGCTCCCAGGTGGCCCTGGGG - Intronic